|
|
||||||||
Center for Immunology and Department of Pathology, Washington University School of Medicine, St. Louis, MO 63110
| Abstract |
|---|
|
|
|---|
ß
TCR genes from a class I MHC (Kd)-restricted, pancreatic
ß cell Ag-specific T cell clone develop diabetes significantly faster
than nontransgenic NOD mice. In these TCR transgenic mice, a large
fraction of T cells express both transgene derived and endogenous TCR
ß chains. Only T cells expressing two TCR showed reactivity to the
islet Ag. Development of diabetogenic T cells is inhibited in mice with
no endogenous TCR expression due to the SCID mutation. These results
demonstrate that the expression of two TCRs is necessary for the
autoreactive diabetogenic T cells to escape thymic negative selection
in the NOD mouse. Further analysis with MHC congenic NOD mice revealed
that diabetes development in the class I MHC-restricted islet
Ag-specific TCR transgenic mice is still dependent on the presence of
the homozygosity of the NOD MHC class II
I-Ag7. | Introduction |
|---|
|
|
|---|
During development, T cells undergo positive and negative selection in the thymus (11). These selection events ensure the generation of mature peripheral T cells capable of responding to foreign Ag-derived peptides bound to the self MHC complex and elimination of self-reactive T cells. However, in the NOD mouse, both class I and class II MHC-restricted, self Ag-reactive T cells escape negative selection in the thymus, emigrate to the periphery, and are activated to differentiate into diabetogenic effector T cells. For CD4 T cells, we have demonstrated a link between the unique biochemical nature of NOD class II MHC, I-Ag7, and poor negative selection in the thymus (12, 13). However, it is still not known how self-Ag-specific (islet Ag), class I MHC-restricted diabetogenic CD8 T cells are generated in the thymus. Furthermore, the underlying events leading to the activation of self-Ag-specific CD8 T cells are not well understood. In this report, using transgenic NOD mice carrying islet Ag-specific, class I MHC-restricted TCR gene, we demonstrate that the expression of two TCRs during thymic selection is required for the generation of self-reactive T cells in the thymus and that this mechanism plays an important role in the generation of islet-Ag-specific diabetogenic CD8 T cells in the periphery. We also show that the diabetes development in the islet Ag-specific class I-restricted TCR transgenic mice is influenced by class II MHC gene.
| Materials and Methods |
|---|
|
|
|---|
NOD and NOD.SCID mice were purchased from The Jackson Laboratory
(Bar Harbor, ME) and maintained at the Washington University School of
Medicine animal facility under specific pathogen-free conditions.
NOD.GD mice carrying Kd, I-A
d/ßd, no I-E and
Db, MHC genotype was established in our animal
facility by introducing MHC locus form B10GD to NOD mice (14 generation
backcross).
Establishment of NOD transgenic mice carrying islet Ag-specific class I MHC-restricted TCR
The 9.33 T cell clone recognized murine ß cells expressing
Kd, class I MHC molecules and exhibit cytolytic
activity (14). The 9.33 clone was positively stained with
an anti Vß6 mAb and express in-frame Vß6-Dß1-Jß1.4-Cß1 mRNA.
Two
-chain mRNAs were found in the clone, a V
19 and a second from
a previously undescribed V
family, referred to as V
clone 6. The
V
19 gene was rearranged to the J
32 segment. The junctional
sequence of this cDNA was in-frame, and the mRNA encoded a functional
TCR
-chain. Sequence analysis of the V
clone 6 revealed an
out-of-frame joining. Genomic fragments of each receptor chain were
cloned. A clone containing V
/J
was further subcloned into a TCR
shuttle vector (provided by Dr. M. M. Davis, Stanford
University, Stanford, CA) (15) using
XhoI/NotI restriction sites. The VDJ fragment of
TCR ß-chain was subcloned into a TCR ß-chain shuttle vector (also
provided by Dr. M. M. Davis) (15) using
ClaI/NotI restriction sites. A mixture of TCR
- and ß-chain constructs was injected into fertilized eggs from
NOD mice, and the injected egg was implanted into pseudo-pregnant
hosts. Mice were screened by PCR analysis of tail biopsy DNA using TCR
- and ß-specific primers (V
, GCCATGAAAACATATGCTCCTACA and J
,
CAGAGAACTGAGCCTAATG; and Vß, CCAAACTATGAACAA and Jß,
CGCCCAGTTCCCCGT) (data not shown). Positive offspring were tested
for the expression of transgene derived TCR using anti-Vß6 mAbs.
Two independent founders were identified and gave identical results.
The founder mice were mated with NOD mice, and offspring were screened
for the presence of the transgene using anti-Vß6 mAb staining of
peripheral blood lymphocytes.
9.33 TCR transgenic mice were mated with NOD.GD (H-2g6) mice, and the resulting F1 mice were backcrossed to NOD.GD mice to produce 9.33 TCR-positive NOD mice with H-2g7/g7, H-2g7/g6, and H-2.g6/g6 mice. In the MHC heterozygous mice, expression of I-Ag7 and I-Ad class II MHC molecules are equivalent as demonstrated in the previous study (16).
Diabetes
Mice were monitored for the development of diabetes by measuring urine glucose with Chemistrip (Boehringer Mannheim, Indianapolis, IN) twice a week. Mice with glucosuria were tested for the blood glucose level, and those showing >250 mg/dl of blood glucose for two consecutive readings in a week were considered diabetic.
Abs and surface immunofluorescence staining
mAbs used in this study are as follows: anti-CD4 (GK1.5 and RL172.4), anti-CD8 (3.155), anti-TCR ß-chain (H57), and a series of anti-TCR V ß-chain Abs (KJ25:Vß3, MR9-4:Vß5, RR4-7:Vß6, MR10-2:Vß9, MR11-1:Vß12, and MR12-4:Vß13) were produced in our laboratory and biotynilated. PE-conjugated anti-CD4 Ab (H129.19) and FITC-conjugated anti-CD8 Ab (53-7.3) were purchased from PharMingen (San Diego, CA). Cells were stained with a combination of Abs described in the text with appropriate secondary reagents as described previously (17). Stained cells were analyzed by FACScan using the CellQuest software (Becton Dickinson, San Jose, CA). Sorting of stained cells were conducted using FACSVantage fluorescence-activated cell sorter as described (17).
Proliferation assay and the establishment of islet Ag-specific cell line
Pancreatic islet cells were prepared by the methods described previously (14). Responder cells (5 x 104) were incubated with an indicated numbers of irradiated (2000 rads) islet cells in a final volume of 200 µl 5% FCS DMEM in flat-bottom 96-well microtiter plates. Cultures were harvested after 5 days of incubation with a 6-h pulse with 1 µCi of [3H]thymidine. Islet-reactive CD8-positive T cells were established by culturing CD4-depleted lymph node cells from 9.33 TCR transgenic mice (1 x 105) with 2 x 103 irradiated islet cells in 200 µl 5% DMEM in U-bottom 96-well microtiter plates. After 1 wk of incubation, recovered cells (2 x 104) were stimulated with irradiated NOD spleen cells (2.5 x 105) and 2 x 103 irradiated islet cells in the same fashion and maintained by weekly stimulation with Ag. Spleen cells (2 x 105/ml) from NOD mice or Vß6-positive T cells obtained by FACS sorting (5 x 104/ml) and stimulated with Con A (1 µg/ml) in the presence of rIL-2 (25 U/ml) were used as control.
Diabetes transfer
Transfer of diabetes by spleen cells was conducted by the method described previously (18). In brief, spleen cells (2 x 107) from diabetic mice were injected i.v. into irradiated (650 rads) young prediabetic NOD male mice. Mice were monitored for the development of diabetes for 3 wk. For the depletion of T cell subsets, spleen cells were treated two cycles by either anti-CD4 (RL172.4) or anti-CD8 (3.155) Ab plus complement. This treatment depletes >99% of specific T cell subset.
| Results |
|---|
|
|
|---|
TCR V
J
- and VßDßJß-chain genes were cloned from the
9.33 islet Ag-specific CD8 T cell clone (14) and inserted
into TCR transgenic vectors containing the constant region of the TCR
and other regulatory elements known to direct specific expression of
transgenic TCR in vivo. TCR
and ß constructs were coinjected into
NOD fertilized eggs. Offspring were initially identified for the
presence of transgene. Transgene-positive mice were further screened
for the expression of transgenic TCR ß-chain (Vß6) on peripheral
blood T lymphocytes. Two founder mice were identified and used for the
subsequent experiments. Mice were mated to NOD mice, and
transgene-positive offspring were screened by the same method. All
female transgenic offspring from both founders developed diabetes
significantly earlier than nontransgenic (Fig. 1
). The control mice developed diabetes
with similar incidence and kinetics to the original NOD mice obtained
from The Jackson Laboratory (Fig. 1
). The rapid development of diabetes
made it difficult to use female transgenic mice for breeding, and
therefore only male 9.33 TCR transgenic NOD mice were used for
breeding. However, male transgenic mice also developed diabetes
significantly faster than normal NOD male with higher penetrance (100%
of transgenic mice were diabetic at 35 wk compared with only 25%
diabetes incidence in nontransgenic littermate, data not shown).
|
|
Thymocytes and lymph node T cells from 9.33 TCR transgenic mice
were analyzed for the T cell development and the expression of
transgene derived TCR ß-chain. Unlike other transgenic mice carrying
CD8 T cell-derived TCR genes (19, 20), no skewing to CD8
single positive (SP) T cell subset was evident among the thymocytes.
The lymph node T cells also showed no skewing to CD4 or CD8 SP T cell
subset distribution (Fig. 2
A).
A majority of thymocytes expressed Vß6 TCR chains at a high or low
level and some were negative (Fig. 2
B). These populations
represent the developmental stages of the thymocyte, from CD4 CD8
double negative (DN) TCR-negative T cell precursor, immature CD4 and
CD8 double positive (DP) TCRlow thymocytes, and
mature CD4 or CD8 SP TCRhigh T cells.
|
-chain expression was conducted by
RT-PCR using PCR primer corresponding to the J
-V
sequence of the
transgene. Abundant message was found in both thymus and peripheral T
cell populations. However, surface expression of the transgenic TCR
-chain could not be monitored due to the lack of TCR
-chain-specific Ab. This TCR expression pattern was present in both
transgenic founder mice, ruling out the founder effect for this
phenotype.
|
|
The presence of intermediate Vß6 expressing CD8-positive T cells
in 9.33 TCR transgenic mice prompted us to examine whether these T
cells were expressing two different TCR ß-chains on their cell
surface. T cells were stained with anti-Vß6 Ab and counterstained
with a mixture of anti-VßAbs (anti-Vß3, -5, -8, -9, -12,
and -13). Staining of the cells from normal NOD mice showed an absence
of T cells expressing two TCR ß-chains (Fig. 5
), confirming a strict allelic exclusion
for the expression of TCR ß-chain. In contrast, a large number of T
cells from 9.33 TCR transgenic mice expressed both transgene-derived
Vß6 and other TCR ß-chains (Fig. 5
). It should be noted that
analysis of TCR Vß-chain usage among Vß6 intermediate T cell
populationx showed no dominant endogenous Vß-chain usage, indicating
a polyclonal nature of this double TCR ß-chain expressing T cells
(data not shown). Thus, it seems that allelic exclusion for TCR
ß-chain expression is not operational in this TCR transgenic
mouse line.
|
|
40% of all freshly isolated T cells and about 30%
of islet reactive Vß6-positive T cells. Thus the distribution of
non-Vß6 TCR chain expression on the islet Ag-specific Vß6-positive
T cell population was similar to that of normal T cell population in
nontransgenic NOD mice. These results clearly demonstrate that islet
reactive T cells in 9.33 TCR transgenic mice were contained in the T
cell population expressing both transgenic TCR Vß-chain and
endogenous Vß-chains.
|
To test whether the expression of two TCR ß-chains is necessary
for the generation of mature 9.33 TCR-positive T cells and for the
development of diabetes, the 9.33 TCR transgenic mice were crossed onto
the NOD.SCID mice. Mice were screened for the lack of B cells and for
the presence of transgene as described in the previous section. Female
mice were monitored for the development of diabetes (Table III
). At the end of the experiments (35
wk of age), neither transgene positive nor control NOD.SCID mice
developed diabetes.
|
|
Lack of T cell development in 9.33 TCR transgenic SCID mice did
not allow us to examine whether 9.33 TCR-positive CD8 T cell alone can
cause diabetes in vivo. Therefore, we used the T cell transfer system
to examine the diabetogenecity of CD8 T cells from 9.33 TCR transgenic
mice (Table IV
). CD4- or CD8-depleted
spleen cells from diabetic 9.33 TCR transgenic NOD mice were
transferred to sublethally irradiated prediabetic NOD male mice. Mice
that received neither CD4- nor CD8-depleted spleen cells developed
diabetes, but those that received a mixture of spleen cells developed
diabetes within 3 wk after cell transfer (Table IV
). This result suggests that, although
accelerated, diabetes development still needs both CD4 and CD8 T cell
subsets in 9.33 TCR transgenic NOD mice.
|
dßd instead of
diabetes susceptible NOD class II MHC I-A
dßg7). None of NOD.GD
and (NOD.GD x NOD)F1 female mice developed
diabetes within 35 wk of observation. Two of five (NOD.GD x
NOD)F1 mice carrying 9.33 TCR transgene developed
diabetes with significantly delayed kinetics compared with NOD 9.33 TCR
transgenic mice. The five NOD.GD mice carrying the 9.33 TCR transgene
also remained free of diabetes (Table V
|
|
| Discussion |
|---|
|
|
|---|
Analysis of transgenic TCR expression on the total T cell population as well as islet Ag-specific CD8-positive T cells from 9.33 TCR transgenic mice revealed that a majority of islet Ag-specific CD8 T cells express both transgenic TCR and endogenous Vß-chains. In contrast, islet Ag nonreactive CD8 T cells and all of the CD4 T cells seem to express a single TCR Vß-chain. T cell development in 9.33 TCR transgenic mice was severely impaired on the NOD.SCID background at the DP stage, and no mature T cells emigrated to the periphery. These results strongly indicate that T cells expressing transgenic TCR are capable of interacting with Ag(s) expressed in the thymus, and this interaction impedes T cell development in the absence of endogenous TCR rearrangement in SCID mice. However, in the presence of endogenous TCR ß-chain rearrangement, T cells expressing two TCR ß-chain (transgene-derived Vß and endogenous Vß-chains) are capable of escaping this negative influence in the thymus. At present we do not know whether the ligand expressed in the thymus is the same as the ligand expressed in pancreatic ß cell to which the 9.33 T cell clone was originally raised. However, it has been demonstrated that certain pancreas-specific Ags, such as insulin, glucagon, and pancreatic polypeptide, are also expressed in the thymus, albeit at a significantly lower level than in the pancreas (22). It is possible that the 9.33 T cell clone may be specific for one of these Ags expressed in both the thymus and the pancreas and thus can be negatively selected on the SCID background. Identification of the antigenic peptide and the pancreatic Ag recognized by the 9.33 T cell clone would be necessary to examine the possible expression of this diabetogenic Ag in the thymus.
The possibility that self-reactive T cells escape by expression of two
TCRs was suggested by a study of T cells from TCR transgenic mice
(23). Similar to our 9.33 TCR transgenic mice, T cells
expressing self C5-specific transgenic TCR were detected only in mice
capable of rearranging endogenous TCR chains but not in the
RAG-/- mice. This finding was further extended
by Sarukhan et al. (24) using a combination of three
transgenic mouse lines expressing hemagglutinin (HA) specific, class II
MHC-restricted TCR transgene, transgenic HA expression driven by rat
insulin promoter (pancreatic islet-specific expression) and expression
of transgenic HA in the thymus. It was shown that T cells expressing
HA-specific TCR can escape thymic negative selection by expressing two
TCR
-chains and are capable of causing diabetes in the mouse
expressing HA in pancreatic ß cells. These results clearly
established that the lack of allelic exclusion in TCR
-chain gene
(expression of two TCRs) plays an important role in the escape of
autoreactive and pathogenic T cells from the thymic-negative selection.
However, these results were obtained under experimental conditions
generated in mice carrying multiple transgenes. Our results, using
transgenic mice carrying TCR from islet Ag-specific T cell clone, are
clearly the first demonstration that in spontaneously developing
autoimmune diabetes, pathogenic T cells escape from thymus-negative
selection by expressing two TCRs and these T cells are capable of
accelerating the disease process.
It has been shown that allelic exclusion mechanism tightly regulates
TCR ß-chain expression and normal T cells express a single TCR
ß-chain (25). In contrast, a majority of T cells exhibit
rearrangement of TCR
-chain gene on both alleles and a significant
number of T cells express two TCR
-chains on their surface
associated with a single TCR ß-chain (26, 27). Thus it
was proposed that lower expression of self-reactive TCR due to
competition from the second TCR
-chain for the TCR ß-chain plays
an important role for the escape of potentially autoreactive T cells
from thymic-negative selection (24, 28). However, in 9.33
TCR transgenic mice, the expression of endogenous TCR ß-chain seems
to play a major role in decreasing the expression of islet Ag-specific
TCR. We do not know whether this lack of allelic exclusion of TCR
ß-chain is a general phenomenon for the diabetogenic CD8 T cells in
NOD mouse or a unique feature of the 9.33 TCR transgenic mice. It has
been shown that NOD mouse carrying transgenic TCR ß-chain from either
OVA-specific I-Ad-restricted CD4 T cells
(29) or islet Ag-specific
Kd-restricted CD8 T cell clone (30)
showed accelerated development of diabetes. In view of our finding that
expression of two TCR ß-chain may be required for the escape of
diabetogenic CD8 T cells, these transgenic TCR ß-chains may rescue T
cells expressing diabetogenic TCR from thymic-negative selection via
similar mechanisms observed in our 9.33 TCR transgenic mice. Thus it is
possible that expression of two TCR ß-chains may play a critical role
in the generation of a pathogenic CD8 T cell repertoire and the
development of diabetes in NOD mice.
There was no evidence for negative selection of diabetogenic CD8 T cells in the thymus of TCR transgenic mice reported previously (10). The possible difference in TCR affinity to the Ags between two islet Ag-specific CD8 T cell clones may account for the disparity in their development in the transgenic mouse thymus. Alternatively, these CD8-positive islet Ag-specific T cells recognize different Ags and the expression of these Ags in the thymus may differ resulting in different developmental pattern in different TCR transgenic mice. Thus, it would be of interest to examine an extended number of islet-specific CD8 T cell clones for their Ag specificity, capacity to accelerate diabetes development in NOD mouse, and susceptibility to the thymic negative selection in vivo.
The second unique feature of our TCR transgenic mice is a CD4 T cell dependency for the development of diabetes in 9.33 TCR transgenic mice. The failure of disease transfer by CD8 T cells from diabetic 9.33 TCR transgenic mice clearly demonstrate that in this transgenic mice as well as normal NOD mouse, both CD4 and CD8 T cells are required for the diabetes development in the recipients. Our study with NOD.GD mice also demonstrated that acceleration of diabetes development in 9.33 TCR transgenic mice depends on the class II MHC genotype of the NOD mice. The lack of diabetes development cannot be accounted for by the absence of islet Ag-specific CD8 T cells, because CD8 T cells from 9.33 TCR transgenic NOD.GD mice vigorously respond to islet Ag stimulation in vitro. These findings show that cooperation of diabetogenic CD4 T cells restricted to I-Ag7 and islet Ag-specific 9.33 TCR-positive CD8 T cells are required for the diabetes development.
Our findings are somewhat different from that observed in the previous
islet Ag-specific class I-restricted TCR transgenic mice
(10). In that study, there was little effect of MHC
heterozygosity on the diabetes development. In 9.33 TCR transgenic
mice, due to the unique selection of 9.33 TCR-positive diabetogenic T
cells in the thymus, only a fraction of CD8-positive T cells are
capable of responding to islet Ag (Fig. 5
). These islet Ag-reactive T
cells express two TCRs resulting in lower Ag-specific TCR expression
and lower interaction affinity to the target pancreatic ß cells.
Under this condition, similar to the normal development of diabetes in
NOD mice, generation of effector CD8 T cells may require help from
I-Ag7-restricted islet Ag-specific CD4 T cells.
The presence of I-Ad class II MHC disrupts this
necessary cellular cooperation and protects mice from diabetes in both
9.33 TCR transgenic NOD.GD and normal NOD.GD mice. Alternatively,
initial interaction between CD8-positive T cells and islet cells may
need to recruit CD4-positive islet Ag-specific T cells to initiate the
diabetogenic process as demonstrated by class I MHC-deficient NOD mice
(6). This process, especially the generation of islet
Ag-specific I-Ag7-restricted CD4 T cells, may be
influenced by class II MHC heterozygosity and would explain the reduced
incidence of diabetes in 9.33 TCR transgenic (NOD x
NOD.GD)F1 mice. Nevertheless, a combination of
the islet Ag-specific class I-restricted TCR transgenic mice and class
II MHC congenic NOD mouse line, NOD.GD, would provide a useful tool to
examine the cooperativity of two types of T cells as well as the
requirement for MHC class II I-Ag7 homozygosity
in the development of diabetes in the NOD mouse model of insulin
dependent diabetes mellitus.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Osami Kanagawa, Department of Pathology, Washington University Medical School, Box 8118, 660 South Euclid Avenue, St. Louis, MO 63110. ![]()
3 Abbreviation used in this study: NOD, nonobese diabetic; DN, double negative; DP, double positive; SP, single positive; RAG, recombination-activating gene. ![]()
Received for publication November 16, 1999. Accepted for publication March 1, 2000.
| References |
|---|
|
|
|---|
-J
segment by secondary rearrangement in the thymus: role of continuous rearrangement of TCR
chain gene and positive selection in the T cell repertoire formation. Proc. Natl. Acad. Sci. USA 95:11834.
genes poses an autoimmune hazard due to low-level expression of autospecific receptors. Immunity 8:563.[Medline]
chains: dual receptor T cells. Science 262:422.
and ß T cell receptor alleles. Cell 69:529.[Medline]
chain T cells in autoimmunity. J. Exp. Med. 182:953.
chains. J. Immunol. 157:4726.[Abstract]
This article has been cited by other articles:
![]() |
H. Ohta, Y. Ohinata, M. Ikawa, Y. Morioka, Y. Sakaide, M. Saitou, O. Kanagawa, and T. Wakayama Male Germline and Embryonic Stem Cell Lines from NOD Mice: Efficient Derivation of GS Cells from a Nonpermissive Strain for ES Cell Derivation Biol Reprod, December 1, 2009; 81(6): 1147 - 1153. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Calderon, A. Suri, and E. R. Unanue In CD4+ T-Cell-Induced Diabetes, Macrophages Are the Final Effector Cells that Mediate Islet {beta}-Cell Killing: Studies from an Acute Model Am. J. Pathol., December 1, 2006; 169(6): 2137 - 2147. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Y. Arnold, A. R. Burton, and D. A. A. Vignali Diabetes Incidence Is Unaltered in Glutamate Decarboxylase 65-Specific TCR Retrogenic Nonobese Diabetic Mice: Generation by Retroviral-Mediated Stem Cell Gene Transfer J. Immunol., September 1, 2004; 173(5): 3103 - 3111. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Suri, J. J. Walters, O. Kanagawa, M. L. Gross, and E. R. Unanue Specificity of peptide selection by antigen-presenting cells homozygous or heterozygous for expression of class II MHC molecules: The lack of competition PNAS, April 29, 2003; 100(9): 5330 - 5335. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Viret and C. A. Janeway Jr. Self-Specific MHC Class II-Restricted CD4-CD8- T Cells That Escape Deletion and Lack Regulatory Activity J. Immunol., January 1, 2003; 170(1): 201 - 209. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. L. Chiu, A. M. Jevnikar, and J. S. Danska Genetic Control of T and B Lymphocyte Activation in Nonobese Diabetic Mice J. Immunol., December 15, 2001; 167(12): 7169 - 7179. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. V. Serreze, E. A. Johnson, H. D. Chapman, R. T. Graser, M. P. Marron, T. P. DiLorenzo, P. Silveira, Y. Yoshimura, S. G. Nathenson, and S. Joyce Autoreactive Diabetogenic T-Cells in NOD Mice Can Efficiently Expand From a Greatly Reduced Precursor Pool Diabetes, September 1, 2001; 50(9): 1992 - 2000. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |