The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
The Journal of Immunology, 2000, 164: 5313-5318.
Copyright © 2000 by The American Association of Immunologists

The IgG Fc Contains Distinct Fc Receptor (FcR) Binding Sites: The Leukocyte Receptors Fc{gamma}RI and Fc{gamma}RIIa Bind to a Region in the Fc Distinct from That Recognized by Neonatal FcR and Protein A1

Bruce D. Wines*, Maree S. Powell*, Paul W. H. I. Parren{dagger}, Nadine Barnes* and P. Mark Hogarth2,*

* The Helen M. Schutt Laboratory for Immunology, Austin Research Institute, Austin Repatriation Medical Centre, Heidelberg, Victoria, Australia; and {dagger} Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The CH2-CH3 interface of the IgG Fc domain contains the binding sites for a number of Fc receptors including Staphylococcal protein A and the neonatal Fc receptor (FcRn). It has recently been proposed that the CH2-CH3 interface also contains the principal binding site for an isoform of the low affinity IgG Fc receptor II (Fc{gamma}RIIb). The Fc{gamma}RI and Fc{gamma}RII binding sites have previously been mapped to the lower hinge and the adjacent surface of the CH2 domain although contributions of the CH2-CH3 interface to binding have been suggested. This study addresses the question whether the CH2-CH3 interface plays a role in the interaction of IgG with Fc{gamma}RI and Fc{gamma}RIIa. We demonstrate that recombinant soluble murine Fc{gamma}RI and human Fc{gamma}RIIa did not compete with protein A and FcRn for binding to IgG, and that the CH2-CH3 interface therefore appears not to be involved in Fc{gamma}RI and Fc{gamma}RIIa binding. The importance of the lower hinge was confirmed by introducing mutations in the proposed binding site (LL234,235AA) which abrogated binding of recombinant soluble Fc{gamma}RIIa to human IgG1. We conclude that the lower hinge and the adjacent region of the CH2 domain of IgG Fc is critical for the interaction between Fc{gamma}RIIa and human IgG, whereas contributions of the CH2-CH3 interface appear to be insignificant.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Acentral player in Ab-mediated immunity is the leukocyte receptor Fc{gamma}RII which triggers cellular responses following binding to the Fc portion of IgG Abs. Fc{gamma}RII occurs in three isoforms, Fc{gamma}RIIa, Fc{gamma}RIIb, and Fc{gamma}RIIc, which perform different functions in the immune system. These receptors bind with similar low affinity to the IgG-Fc, and the ectodomains of these receptors are highly homologous (reviewed in Refs. 1, 2, 3, 4). The ligand interaction site on Fc{gamma}RIIa consists of the BC, C'E, and FG loops in the second EC domain (2, 5).

Multiple sites on IgG have been proposed to interact with Fc{gamma}Rs (Refs. 6 and 7 ; reviewed in Refs. 1, 2, 3). Reduced binding of aglycosylated IgG to Fc{gamma}RII indicated the CH2 domain participated directly or indirectly in binding (Ref. 8 ; reviewed in Ref. 3). Studies using recombinant mutant IgGs found that at least two sites in the Fc portion of IgG contribute to the binding of Fc{gamma}RII. The first is the lower hinge where mutation of amino acid residues L, L, G, G (234–237, EU numbering) diminished binding to Fc{gamma}RII (9, 10, 11). The mutation of either L234 or G237 resulted in the greatest diminution of binding to Fc{gamma}RIIa and Fc{gamma}RIIb (9). The existence of a second site(s) in the Fc that interacts with Fc{gamma}RII is indicated by the specificity of interactions between IgG isotypes and human Fc{gamma}RIIa allotypes. This specificity includes the H134 (low-responder) allotype of Fc{gamma}RIIa which binds to human IgG2 but not to murine IgG1 (12) and the R134 allotype which binds to murine IgG1 but poorly to human IgG2 (13). The lower hinge sequence corresponding to the LLGG motif is only a single valine in murine IgG1 and VAG in human IgG2. The contribution of the lower hinge region is therefore of lesser importance for Fc{gamma}RII binding in these particular interactions. Further evidence for residues outside the lower hinge contributing to binding comes from the mutation of E318 of murine IgG2b, which abrogates binding to murine Fc{gamma}RII (11).

Investigation of Fc{gamma}RI binding also indicated that at least two distinct regions of IgG were important in interaction with this receptor. The first site consists of the same residues, 234–237, in the lower hinge of IgG identified as important for Fc{gamma}RII binding (1, 2, 3, 6, 7, 9, 10, 14, 15, 16, 17). Although the importance of this site is common to both these receptors, the interaction is not identical since, for example, while L235 is of some importance in binding either Fc{gamma}RIIa or Fc{gamma}RIIb, it is crucial in IgG3 binding to Fc{gamma}RI. (9). The second site consists of a loop and strands in the upper CH2 domain adjacent to the lower hinge region. This was evidenced by P331A mutant human IgG1 having 10-fold reduced affinity for Fc{gamma}RI (17). The upper CH2 domain, near the lower hinge, may also be part of the Fc{gamma}RII binding site because the lower hinge contributes to the binding of both Fc{gamma}RI and Fc{gamma}RII. In fact the lower hinge, P331 and E318, together may comprise part of a generic contiguous Fc{gamma}R binding surface (6).

A number of reports indicate the CH2-CH3 interface of IgG also participates in binding Fc{gamma}Rs. Experiments with the bacterial FcR Staphylococcal protein A, which binds at the CH2-CH3 interface, indicated that both the cytophilic receptor (high affinity, Fc{gamma}RI) and opsonic receptors (low affinity receptors) were inhibited by protein A (18). Another study reported that the low affinity receptors alone could be inhibited by protein A (19). In a study where domains were exchanged between human IgG1 and murine IgE it was concluded that both the CH2 and CH3 domains were important for binding to Fc{gamma}RIIa (20). These data may indicate either a direct role for the CH3 in binding or an indirect role, where the autologous CH3 domain is necessary for the structural integrity of the adjoining CH2 domain (16, 20). Recently, Fc{gamma}RIIb has been proposed to bind principally to the CH2-CH3 interface (21).

To investigate further the role of the CH2-CH3 interface, we performed competition studies using recombinant soluble neonatal FcR (rsFcRn)3 or protein A to block this site. In these experiments no significant role for the CH2-CH3 interface, as defined by FcRn and protein A inhibition, was found in the binding of human rsFc{gamma}RIIa or murine rsFc{gamma}RI. The principal role in Fc{gamma}RIIa binding of the lower hinge at the top to the CH2 domain was confirmed by mutagenesis of residues 234 and 235 in human IgG1.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Production of recombinant proteins

Low-responder human rsFc{gamma}RIIa (H134 allotype) was produced as described previously (22). Murine rsFc{gamma}RI was produced by PCR of cDNA (23) using the 5' primer HT33, TTTCCCTCTAGAATGATTCTTACCAGC and a 3' primer NBW4, CTAGTACTTCTCGACAAGCCCGGGTTGAAGCTCCAACTCAGGGCTGCG. This primer was designed for a different purpose to human Fc{gamma}RI but introduces only a single silent base change (bolded nucleotide) into the amplified murine Fc{gamma}RI sequence which was cloned into the XbaI and SmaI sites of a pFastBac (Life Technologies, Melbourne, Australia) derivative (24), which expresses a c-myc and hexahistidine tag on the protein C terminus. Production of recombinant virus followed the manufacturer’s protocol and protein was purified as described (24). The recombinant human IgG1 Ab used was mAb b12, which recognizes the CD4 binding site of HIV-1 gp120 (25). The LL234,235AA mutant of b12 was prepared by oligonucleotide-directed mutagenesis (26) in an effort to reduce Fc{gamma}RI and Fc{gamma}RII binding. A similar mutant of a humanized anti-CD3 mAb has been shown to display a strongly reduced Fc-mediated activation of T cells in vivo (27). The recombinant Abs were expressed in CHO cells and purified by protein A affinity chromatography as described (25). rsFcRn was made as described (28). Human myeloma IgG2 was from Sigma (St. Lois, MO). Recombinant protein A was from Calbiochem (Castle Hill, Australia).

Surface plasmon resonance measurements

IgG binding was measured using a BIAcore 2000 and CM5 biosensor chips (BIAcore, Uppsala, Sweden). Proteins were coupled using the manufacturer’s carbodiimide chemistry protocol. Assays were typically performed at flow rates of 10 µl/min using 20 mM HEPES, 150 mM NaCl, and 3.4 mM EDTA (pH 7.4), but experiments with rsFcRn used 20 mM PIPES, 150 mM NaCl, and 3.4 mM EDTA (pH 6.5). Immobilized protein A was regenerated with 0.2 M acetic acid and 3 M guanidinium HCl.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mutation of the lower hinge of human IgG1 abrogates Fc{gamma}RIIa binding

The importance of the lower hinge region of IgG was assessed by measuring the binding of H134 low-responder rsFc{gamma}RIIa to normal and LL234,235AA mutant IgG1 using a biosensor. Injection of rsFc{gamma}RIIa at 0.9 µM gave a binding response of ~350 resonance units (RU) on the immobilized wild-type IgG1 (Fig. 1GoA), whereas the binding was ~50-fold less to the LL234,235AA mutant IgG1 (Fig. 1GoB). The rapid kinetics of rsFc{gamma}RIIa binding meant the maximum response from these injections was the equilibrium binding response and this was fitted to a single binding site model (Fig. 1GoC, Table IGo). Analysis of three experiments with the normal IgG1 gave a KD of 1.6 ± 0.1 µM comparable with values in the micromolar range obtained previously (22). Because equivalent amounts of normal and mutant IgG were coupled, the number of potential binding sites were calculated according to that of the normal IgG channel (Table IGo). The data were then fitted to a single site model yielding a KD of 80 µM, which is a 50-fold weaker affinity than the normal IgG. This limited binding may reflect the weak influence of other interactions outside the lower hinge in the human IgG1:H134-Fc{gamma}RIIa binding reaction.



View larger version (30K):
[in this window]
[in a new window]
 
FIGURE 1. Residues in the lower hinge of human IgG1 (LL234,235) are essential for rsFc{gamma}RIIa binding. A, Baculovirus produced H134 low-responder allotype rsFc{gamma}RIIa was injected at six concentrations from 0.4 to 8.5 µM (10 µl, 10 µl/min) on a biosensor CM5 chip with channels coupled with recombinant wild-type human IgG1. Binding sensograms were produced by subtraction of the signal from a carbodiimide/ethanolamine-treated blank channel. A duplicate set of injections is shown. B, The same injections were made over a separate channel coupled with LL234,235AA mutant IgG. C, Mid-injection peak data from three experiments were fitted to a single binding site model for receptor binding to normal IgG ({circ}) and mutant IgG ({square}).

 

View this table:
[in this window]
[in a new window]
 
Table I. Equilibrium analysis of rsFc{gamma}RIIa binding to recombinant human IgG11

 
Protein A fails to exclude rsFc{gamma}RIIa from binding to human IgG1

rsFc{gamma}RIIa binding to the CH2-CH3 interface of human IgG1 was tested in competition experiments using Staphylococcal protein A. This competition approach was preferred to mutagenesis, where the definition of a binding site may only resolve to a small number of essential binding site residues. Human IgG1 (20 µg/ml, 20 µl) was captured (~7000 RU) by immobilized protein A (Fig. 2GoA). Both the CH2-CH3 interfaces of the captured IgG were occupied by protein A because injection of protein A (50 µg/ml, 10 µl) resulted in no additional binding to the layer. Injection of rsFc{gamma}RIIa at a concentration of 8 µM gave ~1000 RU of bound receptor, demonstrating that rsFc{gamma}RIIa can bind unimpeded by the occupation of the CH2-CH3 interface. The injection of rsFc{gamma}RIIa at different concentrations from 8 to 0.5 µM allowed the equilibrium binding response to be measured on the captured IgG. The loss of captured IgG from the layer was small enough to be considered negligible. These data were fitted to a single binding site model (Fig. 2GoB, Table IGo) and yielded a KD = 1.2 µM. The orientated capture of proteins onto biosensor surfaces may provide an accurate measure of protein interaction affinity and stoichiometry. Random immobilization of a protein through chemical linking to the surface can especially yield reduced values for stoichiometry due to functional inactivation of a proportion of molecules, linked to the surface in unfavorable orientations, or through active site residues. The value for Bmax (1142 RU, Table IGo) gives a near unit stoichiometry of 0.91 rsFc{gamma}RIIa molecules binding each captured IgG, showing that this experiment is free from immobilization artifacts and that the rsFc{gamma}RIIa and protein A sites are independent.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 2. Staphylococcal protein A bound to recombinant human IgG1 does not compete rsFc{gamma}RIIa binding. A, Recombinant human IgG1 was injected at 20 µg/ml (20 µl, 10 µl/min) on a biosensor chip coupled with 2525 RU of protein A and sensograms produced by the subtraction of the signal from a carbodiimide/ethanolamine-coupled blank channel. At completion of the injection of the IgG recombinant protein A (50 µg/ml, 10 µl) was injected onto the layer but resulted in no additional binding to the surface. rsFc{gamma}RIIa (H134 allotype) was then injected (10 µl) at concentrations of 8, 5, 3, 2, 1, and 0.5 µM. B, The response for bound receptor (•) was plotted against concentration of rsFc{gamma}RIIa and fitted to a single binding site model. This analysis gave values for Bmax = 1142 RU and KD = 1.2 ± 0.1 µM. C, The binding of rsFc{gamma}RIIa at six concentrations from 0.4 to 8.5 µM to immobilized normal recombinant human IgG was measured. Then the CH2-CH3 interface of the immobilized IgG was blocked by binding protein A at near saturating levels (50 µg/ml, 50 µl, injected at 1600 s). The protein A remained complexed to the IgG while a second series of injections of rsFc{gamma}RIIa were made. The results of equilibrium binding analysis are shown in Table IGo.

 
The independence of the protein A and rsFc{gamma}RIIa binding site was also tested with IgG directly immobilized to the biosensor. In such experiments inactivation of some IgG molecules occurs because stoichiometries for protein A and rsFc{gamma}RIIa binding to the layer were 0.4 and 0.6, respectively. If sites are close to each other then inactivation on account of immobilization is likely to be similar for both sites. The IgG CH2-CH3 interface of active molecules was blocked by binding protein A at near saturating levels which, because the dissociation of the complex was very slow, remained bound almost undiminished throughout the experiment (Fig. 2GoC). Saturation of the immobilized IgG with protein A was determined by using a concentration of protein A (50 µg/ml) above which higher concentrations of protein A achieved little additional binding to the layer (data not shown). rsFc{gamma}RIIa was injected at different concentrations, and binding to the complexed IgG:protein A was measured. Single binding site analysis of three such experiments gave a KD = 2.1 ± 0.1 µM for the binding to the IgG1 loaded with protein A while a of KD = 2.0 ± 0.1 µM was obtained for rsFc{gamma}RIIa binding to IgG1 alone (Table IGo). There was no difference in the affinities of rsFc{gamma}RIIa binding to IgG and to the IgG:protein A complex. Thus protein A bound to IgG does not affect interactions at the Fc{gamma}RIIa binding site. There was a small reduction (16%) in the number of Fc{gamma}RIIa binding sites obtained in the presence of protein A. However, with the Fc regions saturated with protein A, the small loss in binding sites observed was incompatible with protein A and rsFc{gamma}RIIa competitively binding to the same site. Because protein A is multivalent, some cross-linking of IgG on the dextran layer might restrict access of rsFc{gamma}RIIa to the layer, nonspecifically reducing the number of rsFc{gamma}RIIa binding sites.

Murine FcRn fails to exclude human rsFc{gamma}RIIa from binding to human IgG1

Like protein A the neonatal Fc receptor also binds to the CH2-CH3 interface. rsFcRn is similar in size to the recombinant protein A (45 kDa), but nevertheless may place different steric constraints on the binding of other molecules to the Fc. Murine rsFcRn was reacted with IgG followed by the binding of rsFc{gamma}RIIa (Fig. 3Go.). Unlike protein A, the rsFcRn dissociated comparatively rapidly from the IgG, but rsFc{gamma}RIIa binding to IgG could be measured during the dissociation of the rsFcRn from the IgG layer. FcRn failed to compete with rsFc{gamma}RIIa for binding to the IgG1 Fc (Fig. 3Go, thin lines). It is interesting that the rsFcRn binding activity of the LL234,235AA mutant IgG1 was consistently about 75% that of the normal IgG1 (Fig. 3Go, dotted lines). Matched amounts of IgG were coupled to each channel. This indicates either the proportion of inactive immobilized molecules is higher for the mutant than the normal IgG or that mutation at the lower hinge modulates FcRn interaction at the CH2-CH3 interface.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 3. RsFcRn bound to human IgG1 or IgG2 does not compete rsFc{gamma}RIIa binding. Three experiments measured rsFcR binding at pH 6.5 to recombinant human IgG1 (thin line), LL234,235AA mutant IgG1 (dotted line), and myeloma IgG2 (thick line). First was injection of rsFc{gamma}RII (120 µg/ml, 20 µl), the second injection was rsFcRn (20 µg/ml, 20 µl), and in the third case rsFcRn injection was followed by the injection of rsFc{gamma}RII (120 µg/ml, 20 µl) during the FcRn dissociation phase. The lower binding of both receptors to the IgG2 channel compared with the immobilized IgG1 was partly because less (0.6 times) IgG2 was coupled.

 
Blocking the CH2-CH3 interface of human IgG2, which lacks the LLGG motif in the lower hinge, does not inhibit rsFc{gamma}RIIa binding

In human IgG1 the lower hinge sequence LLGG is important for the low-responder H134 allotype Fc{gamma}RIIa binding (Fig. 1Go). This sequence in human IgG2 is VAG and this IgG isotype also binds to H134 allotype Fc{gamma}RIIa, so consequently the interaction of these two IgG isotypes with receptor must be different. There is then a possibility that, unlike human IgG1, human IgG2 binding to H134-Fc{gamma}RIIa involves the CH2-CH3 interface. rsFcRn was bound to immobilized human IgG2 and the binding of rsFc{gamma}RIIa was measured during the FcRn dissociation phase. The binding of rsFc{gamma}RIIa (~350 RU) was unaffected by the IgG being complexed with rsFcRn (Fig. 3Go, thick lines). Thus FcRn fails to compete with rsFc{gamma}RIIa for binding to either the IgG1 or IgG2 Fc.

Protein A fails to exclude murine rsFc{gamma}RI from binding to IgG2a

Fc{gamma}RI will bind with highest affinity to IgG Abs containing a LLGG motif in the lower hinge, strongly suggesting that this region is part of the receptor binding site. Likewise, the lower hinge can participate in binding of Fc{gamma}RIIa. Both Fc{gamma}RI and Fc{gamma}RII bind to murine IgG2a. If both these receptors interact with the lower hinge and the proximal surface of the upper CH2 domain, then it follows that these two proteins should compete for binding. The binding of murine rsFc{gamma}RI and human rsFc{gamma}RIIa to immobilized murine IgG2a was investigated. RsFc{gamma}RI was bound to immobilized murine IgG2a, and then the binding of rsFc{gamma}RIIa was measured (Fig. 4GoA). The dissociation of bound rsFc{gamma}RI from the layer was rapid but nonetheless the binding of rsFc{gamma}RIIa was inhibited 55% (from 124 to 55 RU) from that measured in the absence of rsFc{gamma}RI. Thus the Fc{gamma}RIIa binding site is closely related to that of Fc{gamma}RI. Because the extracellular region of Fc{gamma}RI consists of three domains, it may be more sterically constrained in its binding of the Fc than the smaller rsFc{gamma}RIIa which consists of two domains. As protein A and murine Fc{gamma}RI both have high affinity for murine IgG2a, competition between these proteins could be measured by the injection of the Fc{gamma}RI onto immobilized IgG2a followed by injection of protein A during the Fc{gamma}RI dissociation phase. This binding site mapping experiment showed that binding of protein A was not inhibited by the IgG being first occupied by rsFc{gamma}RI (Fig. 4GoB). Likewise, when the order of injections was reversed, the binding of Fc{gamma}RI was not inhibited by protein A.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 4. Murine rsFc{gamma}RI competes with human rsFc{gamma}RIIa for binding to murine IgG2a but fails to compete with protein A binding to murine IgG2a. A, Murine rsFc{gamma}RI was injected (10 µg/ml, 10 µl, 10 µl/min) on a biosensor channel coupled with murine IgG2a (2025 RU coupled) and binding sensograms were produced by subtraction of the signal from a carbodiimide/ethanolamine-treated blank channel. Following regeneration of the layer, rsFc{gamma}RIIa was injected (100 µg/ml, 10 µl) and rapidly reached equilibrium (124 RU bound) and then was allowed to dissociate. Next the injection of rsFc{gamma}RI (10 µg/ml, 10 µl) was repeated followed by the injection of rsFc{gamma}RIIa during the dissociation of the bound rsFc{gamma}RI (~55 RU of rsFc{gamma}RIIa bound). B, Murine rsFc{gamma}RI was injected (10 µg/ml, 10 µl, 10 µl/min) on a biosensor channel coupled with murine IgG2a (10300 RU coupled) and, while rsFc{gamma}RI was still dissociating from the layer (at ~380s), protein A (50 µg/ml, 10 µl) was injected. After regeneration of the sensor chip the order of injection was reversed with protein A being reacted with the layer first (~1150 s) followed by rsFc{gamma}RI (~1400 s).

 
Mapping Fc{gamma}RI and Fc{gamma}RIIa binding sites on the Fc

These competitive binding experiments show that Staphylococcal protein A and FcRn, whose contacts with the Fc CH2-CH3 interface are described by x-ray crystallography (29, 30), define a region of the Fc entirely separate from the Fc{gamma}RIIa and Fc{gamma}RI binding sites. A representation of the complex between both FcRn and fragment B of Staphylococcal protein A with a IgG2a Fc (31) is shown in Fig. 5Go. Although the interaction of fragment B of protein A (on the left, colored green) is limited to the CH2-CH3 interface, rsFcRn (including the ß2-microglobulin chain on the right, colored red) could be envisaged to mask not only the CH2-CH3 interface but also the lower CH2 region. The protein A used in this study is larger than fragment B and so would be expected to block a larger area of the Fc; the exact footprint of intact protein A on the IgG-Fc is however unknown. As neither protein inhibited Fc{gamma}R binding the CH2-CH3 interface, and probably the lower CH2 domain, plays no direct role in either Fc{gamma}RI or Fc{gamma}RIIa binding to IgG-Fc.



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 5. A representation of Staphylococcal protein A fragment B (on the left colored green) and rsFcRn (on the right) complexed to the Fc region of murine IgG2a (center). The Fc of human Fc{gamma}1 complexed with Staphylococcal protein A fragment B (Ref. 29 ; Brookhaven National Laboratory database entry 1Fc2), and that of Fc and rat FcRn (Ref. 30 ; entry 1FRT) were superimposed on the Fc region of the mouse IgG2a structure (Ref. 31 ; entry 1IGT) using Insight II (Molecular Simulations, San Diego, CA). Only fragment B, the IgG2a Fc and FcRn, were then displayed as ribbons using MOLSCRIPT. The side chains for residues L234 and L235 (EU numbering) in the IgG2a lower hinge region are displayed in CPK representation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The binding of Fc{gamma}RII to IgG has been reported to involve a number of sites in the Fc (7, 9, 10, 11). Specifically, we investigated the contribution of the lower hinge region and the CH2-CH3 interface of IgG to the binding of H134 low-responder allotype rsFc{gamma}RIIa. First, the importance of a site in the lower hinge region was confirmed in agreement with earlier studies (9, 10, 11). This study used purified recombinant receptors, and the measurement of binding affinities using a biosensor demonstrated the affinity of human H134-rsFc{gamma}RIIa for human IgG1 was reduced 50-fold by introducing a mutation in the human IgG1 lower hinge (LL234,235AA). It is concluded that the lower hinge of human IgG1 is crucial for human H134-Fc{gamma}RIIa binding. Second, competition binding experiments in which the CH2-CH3 interface of human IgG1 was blocked with Staphylococcal protein A and rsFcRn were performed. We failed to observe inhibition of rsFc{gamma}RIIa binding in these experiments, indicating that this region may not be involved in binding the Fc{gamma}RIIa isoform. Investigating additional receptor-ligand pairs, we found that binding of H134-Fc{gamma}RIIa to human IgG2 was not inhibited by rsFcRn, and binding of the high affinity receptor Fc{gamma}RI to mouse IgG2a was not inhibited by protein A, suggesting that our findings may be of a more general nature. The human rsFc{gamma}RIIa and murine rsFc{gamma}RI did compete for binding to IgG, as expected from previous reports which demonstrated that the hinge proximal region of IgG is common to the binding sites of both receptors (1, 2, 3, 6, 9, 10).

Recently, the structures of the ectodomains of human Fc{gamma}RIIb and Fc{gamma}RIIa have been solved and two different models proposed for the binding of these two receptor isoforms to IgG (21, 32). The interaction of Fc{gamma}RIIb and IgG has a 2:1 stoichiometry, and Fc{gamma}RIIb was modeled as interacting independently on each IgG heavy chain at the CH2-CH3 interface without contacting the lower hinge region (21). The rsFc{gamma}RIIa structure was solved as a crystallographic dimer. It was proposed that this receptor may bind IgG as a dimer because the three binding site loops of each of the monomers were juxtaposed to create a single ligand-binding patch. Interaction with IgG was suggested to occur at the lower hinge and the adjacent surface of the upper CH2 domain (32). It may be that binding of receptor as a monomer or a dimer would result in a different interaction with IgG.

The ectodomains of Fc{gamma}RIIb and H134-Fc{gamma}RIIa isoforms have 94% identity and differ by 5 aa in the ligand-binding second ectodomain. Two-amino acid differences occur in the C'E loop and one in each of the C' and E strands flanking this loop. The overall high homology between both Fc{gamma}RII isoforms may suggest that they have similar binding properties, although it cannot be excluded that the small differences in the C'E region could result in distinct binding properties. Indeed mutagenesis experiments using K562 cells expressing Fc{gamma}RIIa and Daudi cells expressing Fc{gamma}RIIb demonstrated the lower hinge region, particularly L234 and G237, contributed to the binding of both these receptor isoforms (9).

Some studies show protein A can inhibit the binding of IgG to cell surface Fc{gamma}Rs (18, 19). These early studies differ in their conclusions on the inhibitory effect of protein A on Fc{gamma}Rs. Sulica et al. (19) found no inhibition of monomeric IgG binding and, in addition, found that binding of IgG sensitized erythrocytes or Ag:IgG complexes to Fc{gamma}Rs was only inhibited when the protein A was added to the complexed IgG before binding to the Fc{gamma}R+ cells (19). Furthermore, inhibition of binding was observed with low protein A to IgG stoichiometries, indicating that the protein A was not directly blocking the interaction with the Fc{gamma}Rs (19). The observed inhibition may be explained by a reduced accessibility of Fcs, cross-linked by protein A, for binding to cell surface receptors. This indirect mode of inhibition may be minimized in the biosensor assays reported here, in which soluble receptors are free to use any orientation to achieve binding to immobilized IgG. Unlike the previous cell-based assays, this study, by using soluble receptors, measured the intrinsic receptor:IgG interactions without requiring complexes of IgG to avidly bind receptors. Thus differences in methodology are most likely to account for the difference between earlier reports and this report on the ability of protein A to inhibit binding to Fc{gamma}Rs.

This study is consistent with H134-Fc{gamma}RIIa binding human IgG1 or IgG2 at the lower hinge and upper part of the CH2 domain. Interaction of H134-Fc{gamma}RIIa with human IgG1 is dependent on leucines 234 and 235 in the lower hinge. In the interactions of Fc{gamma}RIIs and IgGs, the importance of the lower hinge site and other contacts in the upper part of the CH2 domain (e.g., in the region of Pro331 (17)) varies according to species origin and isotype of IgG and allotypes of Fc{gamma}RIIa. However the CH2-CH3 interface is excluded as a significant site of interaction of murine Fc{gamma}RI and human Fc{gamma}RIIa. This should aid strategies to make drugs to block these interactions and the design of recombinant Abs with altered effector function (33, 34).


    Acknowledgments
 
We thank Joanne Spratt and Halina Trist for expert technical assistance, and E. Sally Ward and Bertram Ober for rsFcRn. We also thank Gary Jamieson and Lisa Harris for helpful discussions and Bruce Loveland for reading the manuscript.


    Footnotes
 
1 M.S.P. is supported by a Heald Fellowship from the Arthritis Foundation of Australia and a Nancy E. Pengergast Fellowship from the Victorian Lupus Association. P.W.H.I.P. is supported by National Institutes of Health Grant A1 40377. P.M.H. is supported by the National Health and Medical Research Council. Back

2 Address correspondence and reprint requests to Dr. P. Mark Hogarth, Austin Research Institute, Kronheimer Building, Studley Road, Heidelberg, Victoria 3084, Australia. Back

3 Abbreviations used in this paper: FcRn, neonatal FcR; rs, recombinant soluble; RU, resonance units. Back

Received for publication August 23, 1999. Accepted for publication March 2, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Burton, D. R., J. M. Woof. 1992. Human antibody effector function. Adv. Immunol. 51:1.[Medline]
  2. Hulett, M. D., P. M. Hogarth. 1994. Molecular basis of Fc receptor function. Adv. Immunol. 57:1.[Medline]
  3. Jefferis, R., J. Lund, J. D. Pound. 1998. IgG-Fc-mediated effector functions: molecular definition of interaction sites for effector ligands and the role of glycosylation. Immunol. Rev. 163:59.[Medline]
  4. Van de Winkel, J. G. J., P. J. A. Chapel. 1993. Human IgG Fc receptor heterogeneity: molecular aspects and clinical applications. Immunol. Today 14:215.[Medline]
  5. Hulett, M. D, E. Witort, R. I. Brinkworth, I. F. McKenzie, P. M. Hogarth. 1994. Identification of the IgG binding site of the human low affinity receptor for IgG Fc{gamma}RII: enhancement and ablation of binding by site-directed mutagenesis. J. Biol. Chem. 269:15287.[Abstract/Free Full Text]
  6. Ward, E. S., V. Ghetie. 1995. The effector functions of immunoglobulins: implications for therapy. Ther. Immunol. 2:77.[Medline]
  7. Gergely, J., G. Sarmay. 1990. The two binding site models of human IgG binding Fc{gamma} receptors. FASEB J. 4:3274.
  8. Walker, M. R., J. Lund, K. M. Thompson, R. Jefferis. 1989. Aglycosylation of human IgG1 and IgG3 monoclonal antibodies can eliminate recognition by human cells expressing Fc{gamma}RI and/or Fc{gamma}RII receptors. Biochem. J. 259:1347.
  9. Lund, J., G. Winter, P. T. Jones, J. D. Pound, T. Tanaka, M. R. Walker, P. J. Artymiuk, Y. Arata, D. R. Burton, R. Jefferis. 1991. Human Fc{gamma}RI and Fc{gamma}RII interact with distinct but overlapping sites on human IgG. J. Immunol. 147:2657.[Abstract/Free Full Text]
  10. Sarmay, G., J. Lund, Z. Rozsnyay, J. Gergely, R. Jefferis. 1992. Mapping and comparison of the interaction sites on the Fc region of IgG responsible for triggering antibody dependent cellular cytotoxicity (ADCC) through different types of human Fc{gamma} receptor. Mol. Immunol. 29:633.[Medline]
  11. Lund, J., J. D. Pound, P. T. Jones, A. R. Duncan, T. Bentley, M. Goodall, B. A. Levine, R. Jefferis, G. Winter. 1992. Multiple binding sites on the CH2 domain of IgG for mouse Fc{gamma}RII. Mol. Immunol. 29:53.[Medline]
  12. Parren, P. W., P. A. Warmerdam, L. C. Boeije, J. Arts, N. A. Westerdaal, A. Vlug, P. J. Capel, L. A. Aarden, J. G. van de Winkel. 1992. On the interaction of IgG subclasses with the low affinity Fc{gamma}RIIa (CD32) on human monocytes, neutrophils, and platelets: analysis of a functional polymorphism to human IgG2. J. Clin. Invest. 90:1537.
  13. Warmerdam, P. A., J. G. van de Winkel, E. J. Gosselin, P. J. Capel. 1990. Molecular basis for a polymorphism of human Fc{gamma} receptor II (CD32). J. Exp. Med. 172:19.[Abstract/Free Full Text]
  14. Woof, J. M., L. J. Partridge, R. Jefferis, D. R. Burton. 1986. Localization of the monocyte-binding region on human immunoglobulin G. Mol. Immunol. 23:319.[Medline]
  15. Duncan, A. R., J. M. Woof, L. J. Partridge, D. R. Burton, G. Winter. 1988. Localization of the binding site for the human high-affinity Fc receptor on IgG. Nature 332:563.[Medline]
  16. Chappel, M. S., D. E. Isenman, M. Everett, Y. Y. Xu, K. J. Dorrington, M. H. Klein. 1991. Identification of the Fc{gamma} receptor class I binding site in human IgG through the use of recombinant IgG1/IgG2 hybrid and point-mutated antibodies. Proc. Natl. Acad. Sci. USA 88:9036.[Abstract/Free Full Text]
  17. Canfield, S. M., S. J. Morrison. 1991. The binding affinity of human IgG for its high affinity Fc receptor is determined by multiple amino acids in the CH2 domain and is modulated by the hinge region. J. Exp. Med. 173:1483.[Abstract/Free Full Text]
  18. Ades, E. W., D. J. Phillips, S. L. Shore, D. S. Gordon, M. G. LaVia, C. M. Black, C. B. Reimer. 1976. Analysis of mononuclear cell surfaces with fluoresceinated staphylococcal protein A complexed with IgG antibody of heat-aggregated gamma-globulin. J. Immunol. 117:2119.[Abstract/Free Full Text]
  19. Sulica, A., C. Medesan, M. Laky, D. Onica, J. Sjoquist, V. Ghetie. 1979. Effect of protein A of Staphylococcus aureus on the binding of monomeric and polymeric IgG to Fc receptor-bearing cells. Immunology 38:173.[Medline]
  20. Shopes, B., M. Weetall, D. Holowka, B. Baird. 1990. Recombinant human IgG1-murine IgE chimeric Ig: construction, expression, and binding to human Fc{gamma} receptors. J. Immunol. 145:3842.[Abstract]
  21. Sondermann, P., R. Huber, U. Jacob. 1999. Crystal structure of the soluble form of the human Fc{gamma}-receptor IIb: a new member of the immunoglobulin superfamily at 1.7 Å resolution. EMBO J. 18:1095.[Medline]
  22. Powell, M. S., P. A. Barton, D. Emmanouilidis, B. D. Wines, G. M. Neumann, G. A. Peitersz, K. F. Maxwell, T. P. Garrett, P. M. Hogarth. 1999. Biochemical analysis and crystallization of Fc{gamma}RIIa, the low affinity receptor for IgG. Immunol. Lett. 68:17.[Medline]
  23. Sears, D. W., N. Osman, B. Tate, I. F. McKenzie, P. M. Hogarth. 1990. Molecular cloning and expression of the mouse high affinity Fc receptor for IgG. J. Immunol. 144:371.[Abstract]
  24. Wines, B. D., M. D. Hulett, G. P. Jamieson, H. M. Trist, J. M. Spratt, P. M. Hogarth. 1999. Identification of residues in the first domain of human Fc{alpha} receptor essential for interaction with IgA. J. Immunol. 162:2146.[Abstract/Free Full Text]
  25. Burton, D. R., J. Pyati J, R. Koduri, S. J. Sharp, G. B. Thornton, P. W. Parren, L. S. Sawyer, R. M. Hendry, N. Dunlop, P. L. Nara. 1994. Efficient neutralization of primary isolates of HIV-1 by a recombinant human monoclonal antibody. Science 266:1024.[Abstract/Free Full Text]
  26. Kunkel, T. A., K. Bebenek, J. McClary. 1991. Efficient site-directed mutagenesis using uracil-containing DNA. Methods Enzymol. 204:125.[Medline]
  27. Woodle, E. S., J. A. Bluestone, R. A. Zivin, L. F. Jolliffe, J. Auger, D. Xu, J. R. Thistlethwaite. 1998. Humanized, nonmitogenic OKT3 antibody, huOKT3 {gamma}(Ala-Ala): initial clinical experience. Transplant. Proc. 30:1369.[Medline]
  28. Popov, S., J. G. Hubbard, J. Kim, B. Ober, V. Ghetie, E. S. Ward. 1996. The stoichiometry and affinity of the interaction of murine Fc fragments with the MHC class I-related receptor, FcRn. Mol. Immunol. 33:521.[Medline]
  29. Deisenhofer, J.. 1981. Crystallographic refinement and atomic models of a human Fc fragment and its complex with fragment B of protein A from Staphylococcus aureus at 2.9- and 2. 8-Å resolution. Biochemistry 20:2361.[Medline]
  30. Burmeister, W. P., A. H. Huber, P. J. Bjorkman. 1994. Crystal structure of the complex of rat neonatal Fc receptor with Fc. Nature 372:379.[Medline]
  31. Harris, L. J., S. B. Larson, K. W. Hasel, J. Day, A. Greenwood, A. McPherson. 1992. The three-dimensional structure of an intact monoclonal antibody for canine lymphoma. Nature 360:369.[Medline]
  32. Maxwell, K. F., M. S. Powell, M. D. Hulett, P. A. Barton, I. F. McKenzie, T. P. Garrett, P. M. Hogarth. 1999. Crystal structure of the human leukocyte Fc receptor, Fc{gamma}RIIa. Nat. Struct. Biol. 6:437.[Medline]
  33. Redpath, S., T. E. Michaelsen, I. Sandlie, M. R. Clark. 1998. The influence of the hinge region length in binding human IgG to human Fc{gamma} receptors. Hum. Immunol. 59:720.[Medline]
  34. Armour, K. L., M. R. Clark, A. G. Hadley, L. M. Williamson. 1999. Recombinant human IgG molecules lacking Fc{gamma} receptor I binding and monocyte triggering activities. Eur. J. Immunol. 29:2613.[Medline]



This article has been cited by other articles:


Home page
BloodHome page
P. Bruhns, B. Iannascoli, P. England, D. A. Mancardi, N. Fernandez, S. Jorieux, and M. Daeron
Specificity and affinity of human Fc{gamma} receptors and their polymorphic variants for human IgG subclasses
Blood, April 16, 2009; 113(16): 3716 - 3725.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
W. Mi, S. Wanjie, S.-T. Lo, Z. Gan, B. Pickl-Herk, R. J. Ober, and E. S. Ward
Targeting the Neonatal Fc Receptor for Antigen Delivery Using Engineered Fc Fragments
J. Immunol., December 1, 2008; 181(11): 7550 - 7561.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Baudino, F. Nimmerjahn, Y. Shinohara, J.-I. Furukawa, F. Petry, J. S. Verbeek, S.-I. Nishimura, J. V. Ravetch, and S. Izui
Impact of a Three Amino Acid Deletion in the CH2 Domain of Murine IgG1 on Fc-Associated Effector Functions
J. Immunol., September 15, 2008; 181(6): 4107 - 4112.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
S.-W. Qiao, K. Kobayashi, F.-E. Johansen, L. M. Sollid, J. T. Andersen, E. Milford, D. C. Roopenian, W. I. Lencer, and R. S. Blumberg
Dependence of antibody-mediated presentation of antigen on FcRn
PNAS, July 8, 2008; 105(27): 9337 - 9342.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. J. Lewis, M. Meehan, P. Owen, and J. M. Woof
A Common Theme in Interaction of Bacterial Immunoglobulin-binding Proteins with Immunoglobulins Illustrated in the Equine System
J. Biol. Chem., June 20, 2008; 283(25): 17615 - 17623.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
G. Vidarsson, A. M. Stemerding, N. M. Stapleton, S. E. Spliethoff, H. Janssen, F. E. Rebers, M. de Haas, and J. G. van de Winkel
FcRn: an IgG receptor on phagocytes with a novel role in phagocytosis
Blood, November 15, 2006; 108(10): 3573 - 3579.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
N. Mohamed, J. Li, C. S. Ferreira, S. F. Little, A. M. Friedlander, G. L. Spitalny, and L. S. Casey
Enhancement of Anthrax Lethal Toxin Cytotoxicity: a Subset of Monoclonal Antibodies against Protective Antigen Increases Lethal Toxin-Mediated Killing of Murine Macrophages
Infect. Immun., June 1, 2004; 72(6): 3276 - 3283.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Maillard, J.-P. Lavergne, S. Siberil, G. Faure, F. Roohvand, S. Petres, J. L. Teillaud, and A. Budkowska
Fc{gamma} Receptor-like Activity of Hepatitis C Virus Core Protein
J. Biol. Chem., January 23, 2004; 279(4): 2430 - 2437.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. Zocher, P. A. Baeuerle, T. Dreier, and A. Iglesias
Specific depletion of autoreactive B lymphocytes by a recombinant fusion protein in vitro and in vivo
Int. Immunol., July 1, 2003; 15(7): 789 - 796.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Hezareh, A. J. Hessell, R. C. Jensen, J. G. J. van de Winkel, and P. W. H. I. Parren
Effector Function Activities of a Panel of Mutants of a Broadly Neutralizing Antibody against Human Immunodeficiency Virus Type 1
J. Virol., December 15, 2001; 75(24): 12161 - 12168.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. J. Pleass, T. Areschoug, G. Lindahl, and J. M. Woof
Streptococcal IgA-binding Proteins Bind in the Calpha 2-Calpha 3 Interdomain Region and Inhibit Binding of IgA to Human CD89
J. Biol. Chem., March 9, 2001; 276(11): 8197 - 8204.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. L. Shields, A. K. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, et al.
High Resolution Mapping of the Binding Site on Human IgG1 for Fcgamma RI, Fcgamma RII, Fcgamma RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the Fcgamma R
J. Biol. Chem., February 23, 2001; 276(9): 6591 - 6604.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Maenaka, P. A. van der Merwe, D. I. Stuart, E. Y. Jones, and P. Sondermann
The Human Low Affinity Fcgamma Receptors IIa, IIb, and III Bind IgG with Fast Kinetics and Distinct Thermodynamic Properties
J. Biol. Chem., November 21, 2001; 276(48): 44898 - 44904.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wines, B. D.
Right arrow Articles by Hogarth, P. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS