| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
RI and FcRIIa Bind to a Region in the Fc Distinct from That Recognized by Neonatal FcR and Protein A1
*
The Helen M. Schutt Laboratory for Immunology, Austin Research Institute, Austin Repatriation Medical Centre, Heidelberg, Victoria, Australia; and
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RIIb). The FcRI and FcRII binding sites
have previously been mapped to the lower hinge and the adjacent surface
of the CH2 domain although contributions of the CH2-CH3 interface to
binding have been suggested. This study addresses the question whether
the CH2-CH3 interface plays a role in the interaction of IgG with
FcRI and FcRIIa. We demonstrate that recombinant soluble murine
FcRI and human FcRIIa did not compete with protein A and FcRn for
binding to IgG, and that the CH2-CH3 interface therefore appears not to
be involved in FcRI and FcRIIa binding. The importance of the
lower hinge was confirmed by introducing mutations in the proposed
binding site (LL234,235AA) which abrogated binding of recombinant
soluble FcRIIa to human IgG1. We conclude that the lower hinge and
the adjacent region of the CH2 domain of IgG Fc is critical for the
interaction between FcRIIa and human IgG, whereas contributions of
the CH2-CH3 interface appear to be
insignificant. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RII which
triggers cellular responses following binding to the Fc portion of IgG
Abs. FcRII occurs in three isoforms, FcRIIa, FcRIIb, and
FcRIIc, which perform different functions in the immune system.
These receptors bind with similar low affinity to the IgG-Fc, and the
ectodomains of these receptors are highly homologous (reviewed in Refs.
1, 2, 3, 4). The ligand interaction site on FcRIIa consists
of the BC, C'E, and FG loops in the second EC domain (2, 5).
Multiple sites on IgG have been proposed to interact with FcRs
(Refs. 6 and 7 ; reviewed in Refs.
1, 2, 3). Reduced binding of aglycosylated IgG to FcRII
indicated the CH2 domain participated directly or indirectly in binding
(Ref. 8 ; reviewed in Ref. 3). Studies using
recombinant mutant IgGs found that at least two sites in the Fc portion
of IgG contribute to the binding of FcRII. The first is the lower
hinge where mutation of amino acid residues L, L, G, G (234–237, EU
numbering) diminished binding to FcRII (9, 10, 11). The
mutation of either L234 or G237 resulted in the greatest diminution of
binding to FcRIIa and FcRIIb (9). The existence of a
second site(s) in the Fc that interacts with FcRII is indicated by
the specificity of interactions between IgG isotypes and human
FcRIIa allotypes. This specificity includes the H134 (low-responder)
allotype of FcRIIa which binds to human IgG2 but not to murine IgG1
(12) and the R134 allotype which binds to murine IgG1 but
poorly to human IgG2 (13). The lower hinge sequence
corresponding to the LLGG motif is only a single valine in murine IgG1
and VAG in human IgG2. The contribution of the lower hinge region is
therefore of lesser importance for FcRII binding in these particular
interactions. Further evidence for residues outside the lower hinge
contributing to binding comes from the mutation of E318 of murine
IgG2b, which abrogates binding to murine FcRII
(11).
Investigation of FcRI binding also indicated that at least two
distinct regions of IgG were important in interaction with this
receptor. The first site consists of the same residues, 234–237, in
the lower hinge of IgG identified as important for FcRII binding
(1, 2, 3, 6, 7, 9, 10, 14, 15, 16, 17). Although the importance of
this site is common to both these receptors, the interaction is not
identical since, for example, while L235 is of some importance in
binding either FcRIIa or FcRIIb, it is crucial in IgG3 binding to
FcRI. (9). The second site consists of a loop and
strands in the upper CH2 domain adjacent to the lower hinge region.
This was evidenced by P331A mutant human IgG1 having 10-fold reduced
affinity for FcRI (17). The upper CH2 domain, near the
lower hinge, may also be part of the FcRII binding site because the
lower hinge contributes to the binding of both FcRI and FcRII. In
fact the lower hinge, P331 and E318, together may comprise part of a
generic contiguous FcR binding surface (6).
A number of reports indicate the CH2-CH3 interface of IgG also
participates in binding FcRs. Experiments with the bacterial FcR
Staphylococcal protein A, which binds at the CH2-CH3
interface, indicated that both the cytophilic receptor (high affinity,
FcRI) and opsonic receptors (low affinity receptors) were inhibited
by protein A (18). Another study reported that the low
affinity receptors alone could be inhibited by protein A
(19). In a study where domains were exchanged between
human IgG1 and murine IgE it was concluded that both the CH2 and CH3
domains were important for binding to FcRIIa (20).
These data may indicate either a direct role for the CH3 in binding or
an indirect role, where the autologous CH3 domain is necessary for the
structural integrity of the adjoining CH2 domain (16, 20).
Recently, FcRIIb has been proposed to bind principally to the
CH2-CH3 interface (21).
To investigate further the role of the CH2-CH3 interface, we performed
competition studies using recombinant soluble neonatal FcR
(rsFcRn)3 or protein A to block
this site. In these experiments no significant role for the CH2-CH3
interface, as defined by FcRn and protein A inhibition, was found in
the binding of human rsFcRIIa or murine rsFcRI. The principal
role in FcRIIa binding of the lower hinge at the top to the CH2
domain was confirmed by mutagenesis of residues 234 and 235 in
human IgG1.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Low-responder human rsFcRIIa (H134 allotype) was produced as
described previously (22). Murine rsFcRI was produced
by PCR of cDNA (23) using the 5' primer HT33,
TTTCCCTCTAGAATGATTCTTACCAGC and a 3' primer NBW4,
CTAGTACTTCTCGACAAGCCCGGGTTGAAGCTCCAACTCAGGGCTGCG. This
primer was designed for a different purpose to human FcRI but
introduces only a single silent base change (bolded nucleotide) into
the amplified murine FcRI sequence which was cloned into the
XbaI and SmaI sites of a pFastBac (Life
Technologies, Melbourne, Australia) derivative (24), which
expresses a c-myc and hexahistidine tag on the protein C
terminus. Production of recombinant virus followed the manufacturer’s
protocol and protein was purified as described (24). The
recombinant human IgG1 Ab used was mAb b12, which recognizes the CD4
binding site of HIV-1 gp120 (25). The LL234,235AA mutant
of b12 was prepared by oligonucleotide-directed mutagenesis
(26) in an effort to reduce FcRI and FcRII binding.
A similar mutant of a humanized anti-CD3 mAb has been shown to
display a strongly reduced Fc-mediated activation of T cells in vivo
(27). The recombinant Abs were expressed in CHO cells and
purified by protein A affinity chromatography as described
(25). rsFcRn was made as described (28).
Human myeloma IgG2 was from Sigma (St. Lois, MO). Recombinant protein A
was from Calbiochem (Castle Hill, Australia).
Surface plasmon resonance measurements
IgG binding was measured using a BIAcore 2000 and CM5 biosensor chips (BIAcore, Uppsala, Sweden). Proteins were coupled using the manufacturer’s carbodiimide chemistry protocol. Assays were typically performed at flow rates of 10 µl/min using 20 mM HEPES, 150 mM NaCl, and 3.4 mM EDTA (pH 7.4), but experiments with rsFcRn used 20 mM PIPES, 150 mM NaCl, and 3.4 mM EDTA (pH 6.5). Immobilized protein A was regenerated with 0.2 M acetic acid and 3 M guanidinium HCl.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RIIa
binding
The importance of the lower hinge region of IgG was assessed by
measuring the binding of H134 low-responder rsFcRIIa to normal and
LL234,235AA mutant IgG1 using a biosensor. Injection of rsFcRIIa at
0.9 µM gave a binding response of 
350 resonance units (RU) on the
immobilized wild-type IgG1 (Fig. 1
A), whereas the binding was
50-fold less to the LL234,235AA mutant IgG1 (Fig. 1B).
The rapid kinetics of rsFcRIIa binding meant the maximum response
from these injections was the equilibrium binding response and this was
fitted to a single binding site model (Fig. 1C, Table I). Analysis of three experiments with
the normal IgG1 gave a KD of 1.6
± 0.1 µM comparable with values in the micromolar range obtained
previously (22). Because equivalent amounts of normal and
mutant IgG were coupled, the number of potential binding sites were
calculated according to that of the normal IgG channel (Table I). The
data were then fitted to a single site model yielding a
KD of 80 µM, which is a 50-fold
weaker affinity than the normal IgG. This limited binding may reflect
the weak influence of other interactions outside the lower hinge in the
human IgG1:H134-FcRIIa binding reaction.
|
|
RIIa from binding to human IgG1
rsFcRIIa binding to the CH2-CH3 interface of human IgG1 was
tested in competition experiments using Staphylococcal
protein A. This competition approach was preferred to mutagenesis,
where the definition of a binding site may only resolve to a small
number of essential binding site residues. Human IgG1 (20 µg/ml, 20
µl) was captured (7000 RU) by immobilized protein A (Fig. 2A). Both the CH2-CH3
interfaces of the captured IgG were occupied by protein A because
injection of protein A (50 µg/ml, 10 µl) resulted in no additional
binding to the layer. Injection of rsFcRIIa at a concentration of 8
µM gave 1000 RU of bound receptor, demonstrating that rsFcRIIa
can bind unimpeded by the occupation of the CH2-CH3 interface. The
injection of rsFcRIIa at different concentrations from 8 to 0.5 µM
allowed the equilibrium binding response to be measured on the captured
IgG. The loss of captured IgG from the layer was small enough to be
considered negligible. These data were fitted to a single binding site
model (Fig. 2B, Table I
) and yielded a
KD = 1.2 µM. The orientated capture
of proteins onto biosensor surfaces may provide an accurate measure of
protein interaction affinity and stoichiometry. Random immobilization
of a protein through chemical linking to the surface can especially
yield reduced values for stoichiometry due to functional inactivation
of a proportion of molecules, linked to the surface in unfavorable
orientations, or through active site residues. The value for
Bmax (1142 RU, Table I) gives a near
unit stoichiometry of 0.91 rsFcRIIa molecules binding each captured
IgG, showing that this experiment is free from immobilization artifacts
and that the rsFcRIIa and protein A sites are independent.
|
RIIa binding site was also
tested with IgG directly immobilized to the biosensor. In such
experiments inactivation of some IgG molecules occurs because
stoichiometries for protein A and rsFcRIIa binding to the layer were
0.4 and 0.6, respectively. If sites are close to each other then
inactivation on account of immobilization is likely to be similar for
both sites. The IgG CH2-CH3 interface of active molecules was blocked
by binding protein A at near saturating levels which, because the
dissociation of the complex was very slow, remained bound almost
undiminished throughout the experiment (Fig. 2C). Saturation
of the immobilized IgG with protein A was determined by using a
concentration of protein A (50 µg/ml) above which higher
concentrations of protein A achieved little additional binding to the
layer (data not shown). rsFcRIIa was injected at different
concentrations, and binding to the complexed IgG:protein A was
measured. Single binding site analysis of three such experiments gave a
KD = 2.1 ± 0.1 µM for the
binding to the IgG1 loaded with protein A while a of
KD = 2.0 ± 0.1 µM was obtained
for rsFcRIIa binding to IgG1 alone (Table I). There was no
difference in the affinities of rsFcRIIa binding to IgG and to the
IgG:protein A complex. Thus protein A bound to IgG does not affect
interactions at the FcRIIa binding site. There was a small reduction
(16%) in the number of FcRIIa binding sites obtained in the
presence of protein A. However, with the Fc regions saturated with
protein A, the small loss in binding sites observed was incompatible
with protein A and rsFcRIIa competitively binding to the same site.
Because protein A is multivalent, some cross-linking of IgG on the
dextran layer might restrict access of rsFcRIIa to the layer,
nonspecifically reducing the number of rsFcRIIa binding sites.
Murine FcRn fails to exclude human rsFcRIIa from binding to
human IgG1
Like protein A the neonatal Fc receptor also binds to the CH2-CH3
interface. rsFcRn is similar in size to the recombinant
protein A (45 kDa), but nevertheless may place different steric
constraints on the binding of other molecules to the Fc. Murine rsFcRn
was reacted with IgG followed by the binding of rsFcRIIa (Fig. 3.). Unlike protein A, the rsFcRn
dissociated comparatively rapidly from the IgG, but rsFcRIIa binding
to IgG could be measured during the dissociation of the rsFcRn from the
IgG layer. FcRn failed to compete with rsFcRIIa for binding to the
IgG1 Fc (Fig. 3, thin lines). It is interesting that the rsFcRn binding
activity of the LL234,235AA mutant IgG1 was consistently
about 75% that of the normal IgG1 (Fig. 3, dotted lines). Matched
amounts of IgG were coupled to each channel. This indicates either the
proportion of inactive immobilized molecules is higher for the mutant
than the normal IgG or that mutation at the lower hinge modulates FcRn
interaction at the CH2-CH3 interface.
|
RIIa binding
In human IgG1 the lower hinge sequence LLGG is important for the
low-responder H134 allotype FcRIIa binding (Fig. 1). This sequence
in human IgG2 is VAG and this IgG isotype also binds to H134 allotype
FcRIIa, so consequently the interaction of these two IgG isotypes
with receptor must be different. There is then a possibility that,
unlike human IgG1, human IgG2 binding to H134-FcRIIa involves the
CH2-CH3 interface. rsFcRn was bound to immobilized human IgG2 and the
binding of rsFcRIIa was measured during the FcRn dissociation phase.
The binding of rsFcRIIa (350 RU) was unaffected by the IgG being
complexed with rsFcRn (Fig. 3, thick lines). Thus FcRn fails to compete
with rsFcRIIa for binding to either the IgG1 or IgG2 Fc.
Protein A fails to exclude murine rsFcRI from binding to IgG2a
FcRI will bind with highest affinity to IgG Abs containing a
LLGG motif in the lower hinge, strongly suggesting that this region is
part of the receptor binding site. Likewise, the lower hinge can
participate in binding of FcRIIa. Both FcRI and FcRII bind to
murine IgG2a. If both these receptors interact with the lower hinge and
the proximal surface of the upper CH2 domain, then it follows that
these two proteins should compete for binding. The binding of murine
rsFcRI and human rsFcRIIa to immobilized murine IgG2a was
investigated. RsFcRI was bound to immobilized murine IgG2a, and then
the binding of rsFcRIIa was measured (Fig. 4A). The dissociation of bound
rsFcRI from the layer was rapid but nonetheless the binding of
rsFcRIIa was inhibited 55% (from 124 to 55 RU) from that measured
in the absence of rsFcRI. Thus the FcRIIa binding site is closely
related to that of FcRI. Because the extracellular region of FcRI
consists of three domains, it may be more sterically constrained in its
binding of the Fc than the smaller rsFcRIIa which consists of two
domains. As protein A and murine FcRI both have high affinity for
murine IgG2a, competition between these proteins could be measured by
the injection of the FcRI onto immobilized IgG2a followed by
injection of protein A during the FcRI dissociation phase. This
binding site mapping experiment showed that binding of protein A was
not inhibited by the IgG being first occupied by rsFcRI (Fig. 4B). Likewise, when the order of injections was reversed,
the binding of FcRI was not inhibited by protein A.
|
RI and FcRIIa binding sites on the Fc
These competitive binding experiments show that
Staphylococcal protein A and FcRn, whose contacts with the
Fc CH2-CH3 interface are described by x-ray crystallography (29, 30), define a region of the Fc entirely separate from the
FcRIIa and FcRI binding sites. A representation of the complex
between both FcRn and fragment B of Staphylococcal protein A
with a IgG2a Fc (31) is shown in Fig. 5. Although the interaction of fragment B
of protein A (on the left, colored green) is limited to the
CH2-CH3 interface, rsFcRn (including the
ß2-microglobulin chain on the right,
colored red) could be envisaged to mask not only the CH2-CH3 interface
but also the lower CH2 region. The protein A used in this
study is larger than fragment B and so would be expected to block a
larger area of the Fc; the exact footprint of intact protein A on the
IgG-Fc is however unknown. As neither protein inhibited
FcR binding the CH2-CH3 interface, and probably the lower CH2
domain, plays no direct role in either FcRI or FcRIIa binding to
IgG-Fc.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RII to IgG has been reported to involve a
number of sites in the Fc (7, 9, 10, 11). Specifically, we
investigated the contribution of the lower hinge region and the CH2-CH3
interface of IgG to the binding of H134 low-responder allotype
rsFcRIIa. First, the importance of a site in the lower hinge region
was confirmed in agreement with earlier studies (9, 10, 11).
This study used purified recombinant receptors, and the measurement of
binding affinities using a biosensor demonstrated the affinity of human
H134-rsFcRIIa for human IgG1 was reduced 50-fold by introducing a
mutation in the human IgG1 lower hinge (LL234,235AA). It is concluded
that the lower hinge of human IgG1 is crucial for human H134-FcRIIa
binding. Second, competition binding experiments in which the CH2-CH3
interface of human IgG1 was blocked with Staphylococcal
protein A and rsFcRn were performed. We failed to observe inhibition of
rsFcRIIa binding in these experiments, indicating that this region
may not be involved in binding the FcRIIa isoform. Investigating
additional receptor-ligand pairs, we found that binding of
H134-FcRIIa to human IgG2 was not inhibited by rsFcRn, and binding
of the high affinity receptor FcRI to mouse IgG2a was not inhibited
by protein A, suggesting that our findings may be of a more general
nature. The human rsFcRIIa and murine rsFcRI did compete for
binding to IgG, as expected from previous reports which demonstrated
that the hinge proximal region of IgG is common to the binding sites of
both receptors (1, 2, 3, 6, 9, 10).
Recently, the structures of the ectodomains of human FcRIIb and
FcRIIa have been solved and two different models proposed for the
binding of these two receptor isoforms to IgG (21, 32).
The interaction of FcRIIb and IgG has a 2:1 stoichiometry, and
FcRIIb was modeled as interacting independently on each IgG heavy
chain at the CH2-CH3 interface without contacting the lower hinge
region (21). The rsFcRIIa structure was solved as a
crystallographic dimer. It was proposed that this receptor may bind IgG
as a dimer because the three binding site loops of each of the monomers
were juxtaposed to create a single ligand-binding patch. Interaction
with IgG was suggested to occur at the lower hinge and the adjacent
surface of the upper CH2 domain (32). It may be that
binding of receptor as a monomer or a dimer would result in a different
interaction with IgG.
The ectodomains of FcRIIb and H134-FcRIIa isoforms have 94%
identity and differ by 5 aa in the ligand-binding second ectodomain.
Two-amino acid differences occur in the C'E loop and one in each of the
C' and E strands flanking this loop. The overall high homology between
both FcRII isoforms may suggest that they have similar binding
properties, although it cannot be excluded that the small differences
in the C'E region could result in distinct binding properties. Indeed
mutagenesis experiments using K562 cells expressing FcRIIa and Daudi
cells expressing FcRIIb demonstrated the lower hinge region,
particularly L234 and G237, contributed to the binding of both these
receptor isoforms (9).
Some studies show protein A can inhibit the binding of IgG to cell
surface FcRs (18, 19). These early studies differ in
their conclusions on the inhibitory effect of protein A on FcRs.
Sulica et al. (19) found no inhibition of monomeric IgG
binding and, in addition, found that binding of IgG sensitized
erythrocytes or Ag:IgG complexes to FcRs was only inhibited when the
protein A was added to the complexed IgG before binding to the
FcR+ cells (19). Furthermore,
inhibition of binding was observed with low protein A to IgG
stoichiometries, indicating that the protein A was not directly
blocking the interaction with the FcRs (19). The
observed inhibition may be explained by a reduced accessibility of Fcs,
cross-linked by protein A, for binding to cell surface receptors. This
indirect mode of inhibition may be minimized in the biosensor assays
reported here, in which soluble receptors are free to use any
orientation to achieve binding to immobilized IgG. Unlike the previous
cell-based assays, this study, by using soluble receptors, measured the
intrinsic receptor:IgG interactions without requiring complexes of IgG
to avidly bind receptors. Thus differences in methodology are most
likely to account for the difference between earlier reports and this
report on the ability of protein A to inhibit binding to FcRs.
This study is consistent with H134-FcRIIa binding human IgG1 or IgG2
at the lower hinge and upper part of the CH2 domain. Interaction of
H134-FcRIIa with human IgG1 is dependent on leucines 234 and 235 in
the lower hinge. In the interactions of FcRIIs and IgGs, the
importance of the lower hinge site and other contacts in the upper part
of the CH2 domain (e.g., in the region of Pro331
(17)) varies according to species origin and isotype of
IgG and allotypes of FcRIIa. However the CH2-CH3 interface is
excluded as a significant site of interaction of murine FcRI and
human FcRIIa. This should aid strategies to make drugs to block
these interactions and the design of recombinant Abs with altered
effector function (33, 34).
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. P. Mark Hogarth, Austin Research Institute, Kronheimer Building, Studley Road, Heidelberg, Victoria 3084, Australia.
3 Abbreviations used in this paper: FcRn, neonatal FcR; rs, recombinant soluble; RU, resonance units.
Received for publication August 23, 1999. Accepted for publication March 2, 2000.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RII: enhancement and ablation of binding by site-directed mutagenesis. J. Biol. Chem. 269:15287. receptors. FASEB J. 4:3274.
RI and/or FcRII receptors. Biochem. J. 259:1347.
RI and FcRII interact with distinct but overlapping sites on human IgG. J. Immunol. 147:2657. receptor. Mol. Immunol. 29:633.[Medline]
RII. Mol. Immunol. 29:53.[Medline]
RIIa (CD32) on human monocytes, neutrophils, and platelets: analysis of a functional polymorphism to human IgG2. J. Clin. Invest. 90:1537.
receptor II (CD32). J. Exp. Med. 172:19. receptor class I binding site in human IgG through the use of recombinant IgG1/IgG2 hybrid and point-mutated antibodies. Proc. Natl. Acad. Sci. USA 88:9036. receptors. J. Immunol. 145:3842.[Abstract]
-receptor IIb: a new member of the immunoglobulin superfamily at 1.7 Å resolution. EMBO J. 18:1095.[Medline]
RIIa, the low affinity receptor for IgG. Immunol. Lett. 68:17.[Medline]
receptor essential for interaction with IgA. J. Immunol. 162:2146.(Ala-Ala): initial clinical experience. Transplant. Proc. 30:1369.[Medline]
RIIa. Nat. Struct. Biol. 6:437.[Medline]
receptors. Hum. Immunol. 59:720.[Medline]
receptor I binding and monocyte triggering activities. Eur. J. Immunol. 29:2613.[Medline]
This article has been cited by other articles:
|
|
 |
|
  M. I. Vega, S. Huerta-Yepez, M. Martinez-Paniagua, B. Martinez-Miguel, R. Hernandez-Pando, C. R. Gonzalez-Bonilla, P. Chinn, N. Hanna, K. Hariharan, A. R. Jazirehi, et al. Rituximab-Mediated Cell Signaling and Chemo/Immuno-sensitization of Drug-Resistant B-NHL Is Independent of Its Fc Functions Clin. Cancer Res., November 1, 2009; 15(21): 6582 - 6594. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Brezski, O. Vafa, D. Petrone, S. H. Tam, G. Powers, M. H. Ryan, J. L. Luongo, A. Oberholtzer, D. M. Knight, and R. E. Jordan Tumor-associated and microbial proteases compromise host IgG effector functions by a single cleavage proximal to the hinge PNAS, October 20, 2009; 106(42): 17864 - 17869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Li, Z. Yi, B. Wang, and R. Tisch Suppression of Ongoing T Cell-Mediated Autoimmunity by Peptide-MHC Class II Dimer Vaccination J. Immunol., October 1, 2009; 183(7): 4809 - 4816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Bruhns, B. Iannascoli, P. England, D. A. Mancardi, N. Fernandez, S. Jorieux, and M. Daeron Specificity and affinity of human Fc{gamma} receptors and their polymorphic variants for human IgG subclasses Blood, April 16, 2009; 113(16): 3716 - 3725. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Mi, S. Wanjie, S.-T. Lo, Z. Gan, B. Pickl-Herk, R. J. Ober, and E. S. Ward Targeting the Neonatal Fc Receptor for Antigen Delivery Using Engineered Fc Fragments J. Immunol., December 1, 2008; 181(11): 7550 - 7561. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Baudino, F. Nimmerjahn, Y. Shinohara, J.-I. Furukawa, F. Petry, J. S. Verbeek, S.-I. Nishimura, J. V. Ravetch, and S. Izui Impact of a Three Amino Acid Deletion in the CH2 Domain of Murine IgG1 on Fc-Associated Effector Functions J. Immunol., September 15, 2008; 181(6): 4107 - 4112. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-W. Qiao, K. Kobayashi, F.-E. Johansen, L. M. Sollid, J. T. Andersen, E. Milford, D. C. Roopenian, W. I. Lencer, and R. S. Blumberg Dependence of antibody-mediated presentation of antigen on FcRn PNAS, July 8, 2008; 105(27): 9337 - 9342. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Lewis, M. Meehan, P. Owen, and J. M. Woof A Common Theme in Interaction of Bacterial Immunoglobulin-binding Proteins with Immunoglobulins Illustrated in the Equine System J. Biol. Chem., June 20, 2008; 283(25): 17615 - 17623. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Vidarsson, A. M. Stemerding, N. M. Stapleton, S. E. Spliethoff, H. Janssen, F. E. Rebers, M. de Haas, and J. G. van de Winkel FcRn: an IgG receptor on phagocytes with a novel role in phagocytosis Blood, November 15, 2006; 108(10): 3573 - 3579. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Mohamed, J. Li, C. S. Ferreira, S. F. Little, A. M. Friedlander, G. L. Spitalny, and L. S. Casey Enhancement of Anthrax Lethal Toxin Cytotoxicity: a Subset of Monoclonal Antibodies against Protective Antigen Increases Lethal Toxin-Mediated Killing of Murine Macrophages Infect. Immun., June 1, 2004; 72(6): 3276 - 3283. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Maillard, J.-P. Lavergne, S. Siberil, G. Faure, F. Roohvand, S. Petres, J. L. Teillaud, and A. Budkowska Fc{gamma} Receptor-like Activity of Hepatitis C Virus Core Protein J. Biol. Chem., January 23, 2004; 279(4): 2430 - 2437. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Zocher, P. A. Baeuerle, T. Dreier, and A. Iglesias Specific depletion of autoreactive B lymphocytes by a recombinant fusion protein in vitro and in vivo Int. Immunol., July 1, 2003; 15(7): 789 - 796. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hezareh, A. J. Hessell, R. C. Jensen, J. G. J. van de Winkel, and P. W. H. I. Parren Effector Function Activities of a Panel of Mutants of a Broadly Neutralizing Antibody against Human Immunodeficiency Virus Type 1 J. Virol., December 15, 2001; 75(24): 12161 - 12168. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. J. Pleass, T. Areschoug, G. Lindahl, and J. M. Woof Streptococcal IgA-binding Proteins Bind in the Calpha 2-Calpha 3 Interdomain Region and Inhibit Binding of IgA to Human CD89 J. Biol. Chem., March 9, 2001; 276(11): 8197 - 8204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. L. Shields, A. K. Namenuk, K. Hong, Y. G. Meng, J. Rae, J. Briggs, D. Xie, J. Lai, A. Stadlen, B. Li, et al. High Resolution Mapping of the Binding Site on Human IgG1 for Fcgamma RI, Fcgamma RII, Fcgamma RIII, and FcRn and Design of IgG1 Variants with Improved Binding to the Fcgamma R J. Biol. Chem., February 23, 2001; 276(9): 6591 - 6604. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Maenaka, P. A. van der Merwe, D. I. Stuart, E. Y. Jones, and P. Sondermann The Human Low Affinity Fcgamma Receptors IIa, IIb, and III Bind IgG with Fast Kinetics and Distinct Thermodynamic Properties J. Biol. Chem., November 21, 2001; 276(48): 44898 - 44904. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) and mutant IgG (
).
