The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oaks, M. K.
Right arrow Articles by Hallett, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oaks, M. K.
Right arrow Articles by Hallett, K. M.
The Journal of Immunology, 2000, 164: 5015-5018.
Copyright © 2000 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: A Soluble Form of CTLA-4 in Patients with Autoimmune Thyroid Disease

Martin K. Oaks1 and Karen M. Hallett

Transplant Research Laboratory and Endocrine-Diabetes Center, St. Luke’s Medical Center, and Department of Laboratory Medicine and Pathology, University of Wisconsin Medical School, Milwaukee Clinical Campus, Milwaukee, WI 53215


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have recently identified a novel transcript of the CTLA-4 gene that may represent a native soluble form of CTLA-4 (sCTLA-4). To determine whether sCTLA-4 was expressed in humans, we applied a sensitive enzyme immunoassay on serum from patients with autoimmune thyroid disease (ATD). Eleven of 20 patients with ATD had circulating levels of sCTLA-4 ranging from 28 to 78 ng/ml, whereas only 1 of 30 apparently healthy volunteers had a level greater than 4 ng/ml. sCTLA-4 immunoreactivity was inhibited by its binding to B7.1, suggesting that sCTLA-4 is a functional receptor. Immunoprecipitation analysis of serum from patients with ATD revealed a polypeptide consistent with the predicted size of sCTLA-4. We conclude that a native soluble form of CTLA-4 is derived from an alternate transcript of the CTLA-4 gene, and its level in plasma is elevated among a population of patients with ATD.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cytotoxic T lymphocyte associated gene-4 (CTLA-4) was initially described as a classical type I glycoprotein on the surface of activated T cells (1). CTLA-4 is a member of the Ig gene superfamily and along with its homologue, CD28, is a B7 binding protein (2, 3). The emerging notion of the function of CTLA-4 is that it represents a negative regulator of T cell activation. That is, ligation of CTLA-4 on the T cell surface initiates a series of biochemical events that attenuates an ongoing immune response (4). The most compelling data that supports such a role for CTLA-4 comes from experiments in which the CTLA-4 gene is rendered inactive via construction of CTLA-4 knockout mice (5, 6). Such mice demonstrate profound polyclonal lymphoproliferative disorders that infiltrate most major organ systems and die a few weeks after birth. The majority of animals have increased levels of IgG, which illustrates the role of CTLA-4 on humoral immune responses as well. A role for CTLA-4 in autoimmune disease is suggested by the observations that blockade of B7:CTLA-4 interaction via administration of anti-CTLA-4 mAbs exacerbates animal models of autoimmune disease such as experimental autoimmune encephalomyelitis (7) and diabetes (8).

It has long been known that Graves’ disease and insulin-dependent diabetes mellitus have a substantial genetic basis as suggested by the relatively high rate of concordance in monozygotic twins and the clustering of disease within certain families. The human leukocyte Ag genes residing on chromosome 6 are known to represent a genetic component of these autoimmune endocrine disorders, but other genetic factors remain to be elucidated. A search for genetic markers that segregate with Graves’ disease revealed an association with CTLA-4 polymorphisms (9). Such an association was further substantiated in other ethnic populations as well as other endocrine autoimmune disease (10, 11, 12, 13, 14, 15, 16, 17). Thus, it would appear that CTLA-4 is closely linked to a susceptibility gene for autoimmune thyroid disease (ATD)2 or is itself the susceptibility gene. To date, however, there are no available data that implicate alteration of CTLA-4 structure, function, or expression in any autoimmune disorder.

In 1997, we submitted the nucleic acid sequences of alternate transcripts of CTLA-4 in man, mouse, and rat that lacked transmembrane encoding regions to the GeneBank Sequence Database (accession nos. U90273, U90270, and U90271, respectively). Recently, Magistrelli et al. (18) described the same transcript and detected immunoreactive material in human serum that is consistent with the presence of a native soluble form of CTLA-4 (sCTLA-4). Initial experiments designed to identify the sCTLA-4 polypeptide by ELISA and Western blotting in normal human serum were unsuccessful in our laboratory. Because of the well-known association between CTLA-4 polymorphisms and ATD, we speculated that a reasonable starting point in the search for expression of the native sCTLA-4 would be in patients with Graves’ disease and Hashimoto’s thyroiditis. To that end, we developed an immunoassay for circulating CTLA-4 in human serum, and show in this communication that a soluble form of CTLA-4 is present in patients with ATD.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients

All patients in this study had a recent diagnosis of Graves’ disease (n = 17) or Hashimoto’s thyroiditis (n = 3) based upon clinical presentation and laboratory findings. The patients ranged in age from 19 to 47 years, and 16 were female and 4 were male. Serum was obtained at the time of diagnosis, and none of the patients studied had remarkable co-morbidity. All patients were studied before any treatment for ATD. Control sera were from normal healthy laboratory volunteers of similar age and sex mix relative to the patient population. This protocol was reviewed and conducted under the oversight of our local Institutional Review Board and documented informed consent was obtained.

Enzyme immunoassays (EIA)

A sandwich EIA was used for detection of CTLA-4 in human serum. For this purpose, wells of a 96-well microtiter plate were coated with anti-CTLA4 mAb (clone BNI3; PharMingen, San Diego, CA). After blocking, 100 µl of a 1:3 dilution of the test samples were applied to the wells, and the plates were incubated for 60 min at room temperature and then washed to remove unbound material. Next, a biotinylated anti-CTLA4 mAb (clone AS-33, Antibody Solutions, Palo Alto, CA) was added, and the reactions were incubated for 1 h. Reactions were developed using a streptavidin-peroxidase complex (Zymed, South San Francisco, CA) and 3,3',5,5'-tetramethyl-benzidine substrate. Optical density (OD) was read at 450 nm. A standard curve was generated with the use of a dilution series of a commercially available CTLA4-Ig fusion protein (Ancell, Bayport, MN). Intrassay coefficient of variation (CV) was 3% (n = 16), and the interassay CV was 11% (n = 20). Cross-reactivity of the Abs used in these studies was determined with the use of a CD28-Ig fusion protein prepared in this laboratory and was <0.1%. This fusion protein was chosen for cross-reactivity studies because of the relatively high degree of amino acid sequence similarity (27%) between the V domains of the CTLA-4 and CD28 polypeptides (19). Each sample was run in triplicate and was corrected for background by subtraction of OD obtained when the sample was incubated in wells coated with an isotype-matched mAb of irrelevant specificity (anti-rat CD4). Inhibition experiments were performed by the addition of 200 ng of a B7.1-Ig fusion protein (described below) to 100 µl of test serum for 1 h before immunoassay.

A B7.1-Ig fusion protein was generated by cloning the extracellular domains of the cDNA into the signal-pIG vector (Novagen, Madison, WI). For this purpose, we used RT-PCR of Raji cell (American Type Culture Collection, Manassas, VA) RNA using the following sense (s) and anti-sense (as) primers: B7.1s = AAGCTTGGTCTTTCTCACTTCTGTTCAG; B7.1as = GGATCCGCATCAGGAAAATGCTCTTGC.

CHO cells were transfected with the use of Fugene-6 (Boehringer Mannheim, Indianapolis, IN) and selected with G418. Cell culture supernatants were collected in serum free medium and tested in a sandwich ELISA for human B7.1 and IgG1 epitopes. Positive culture supernatants were pooled and purified by protein A chromatography. The fusion protein was reactive with CTLA4-Ig as determined by an ELISA binding assay (data not shown). SDS-PAGE analysis of the fusion protein showed major products of ~150 kDa under nonreducing conditions and a product of 74 kDa when analyzed under reducing conditions.

Polyclonal Abs

Rabbit anti-human CTLA-4 Abs were generated by standard methods in New Zealand White rabbits immunized with a keyhole limpet hemocyanin-conjugated peptide. Antiserum 8K was raised to the carboxyl-terminal sequence of the predicted sCTLA-4 protein (KPSYNRGLCENAPNRARM). This is a novel sequence predicted from the alternate transcript that arises from a frame-shift mutation that occurs during RNA splicing.3 This amino acid sequence shares no significant similarity with proteins cataloged on the available protein databases. The peptide was synthesized and conjugated by Research Genetics (Huntsville, AL).

Immunoprecipitation

Immunoprecipitation was used to detect sCTLA-4 in serum. For this purpose, 2–3 ml of serum was incubated overnight with 3 µg of a cocktail of anti-CTLA-4 mAbs in an equal volume of PBS. The cocktail consisted of 1 µg each clone BNI3, AS33P, and AS32P (both from Antibody Solutions, Palo Alto, CA). Precipitates were collected by the addition of 50 µl of goat anti-mouse magnetic beads (Dynal, Great Neck, NY), and were separated by 10–20% gradient PAGE. The separated components were electroblotted onto nitrocellulose membranes. The blots were reacted with the 8K antiserum for 1 h at room temperature, washed, and then reacted with reporter Ab (HRP-conjugated anti-rabbit IgG) The blots were then developed with the use of a commercially available chemiluminescence detection kit (Santa Cruz Biotechnology, Santa Cruz, CA) according to the manufacturers instructions.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine whether a circulating form of CTLA-4 was present in human serum, we devised a sensitive EIA using available mAbs to CTLA-4. The assay was optimized using commercially available CTLA4-Ig as a standard and then applied to testing of human serum samples. Fig. 1Go shows combined data from the EIA on patients with ATD and normal apparently healthy volunteers. Circulating CTLA-4 was virtually undetectable in healthy volunteers as defined by the limit of sensitivity of 4 ng/ml for this assay. A single serum sample among 30 from healthy controls had detectable CTLA-4. By contrast, 11 of 20 patients with ATD had detectable circulating CTLA-4 levels in the range of 28–78 ng/ml. Of the 11 patients with detectable sCTLA-4, 8 had Graves’ disease (8 of 17 studied) and the remaining 3 had Hashimoto’s thyroiditis (3 of 3 studied). There was no obvious relationship between the sex and age of the patient and levels of sCTLA-4. sCTLA-4 was detectable using several commercially available mAbs to CTLA-4 as capture Abs (data not shown), arguing against the possibility that autoantibodies or anti-idiotypic Abs were responsible for these effects.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 1. A soluble form of CTLA-4 is found in serum of patients with ATD. •, Data from patients with ATD; {diamond}, data from healthy lab personnel; {blacktriangleup}, representative data from a experiment to test whether B7-Ig was capable of inhibiting CTLA-4 immunoreactivity. The sample is from a patient with ATD and was tested without the addition of B7-Ig (top triangle) or with the addition of 200 ng B7.1-Ig fusion protein (lower triangle). Each data point represents the mean of triplicate determinations.

 
To determine whether CTLA-4 immunoreactivity in serum consisted of an intact and functional molecule as opposed to degraded or shed CTLA-4 polypeptides, we attempted to block the CTLA-4 immunoassay by preincubating positive sera with B7-Ig fusion proteins. Data from a representative experiment is shown in Fig. 1Go. In this case, a sample containing 28 ng/ml sCTLA-4 was completely neutralized in the presence of 200 ng B7.1-Ig fusion protein. Neutralization of immunoreactivity was obtained on three independent serum samples and ranged from 33 to 95% inhibition. Negligible inhibition (<5%) was observed when a control fusion protein (Muc18-Ig) was tested in these experiments. These data show that the CTLA-4 immunoreactive material present in human serum represents an intact functional receptor for the B7.1 ligands.

The primary limitation of the EIA for circulating CTLA-4 described here and that used by others (18) is that they are based on the use of Abs reactive with epitopes within the B7-binding region of the molecule. As a result, they cannot distinguish native soluble CTLA-4 receptors derived from the transcript lacking the transmembrane domain from those that might be present in serum due to proteolytic digestion or shedding of the CTLA-4 integral membrane protein. To determine whether the immunoreactive material in serum of ATD patients was derived from the gene product of the alternate transcript, we designed immunoprecipitation experiments using a pool of commercially available mAbs as a precipitin and a polyclonal Ab raised against a novel epitope within the carboxyl terminus of sCTLA-4 that is generated by a frame shift mutation that occurs during RNA splicing. Fig. 2Go shows a representative experiment. This combination of Abs predominantly identifies a polypeptide species ~23 kDa, which is consistent with the predicted size based on the amino acid sequence and predicted N-linked glycosylation pattern of sCTLA-4. Western blotting of serum proteins from several patients with ATD also showed a predominant species of about 23 kDa when tested directly against the 8K antiserum (data not shown). This species was not evident when probed with a pre-immune serum from the same animal used for immunization, even when run 50-fold concentrated than immune sera.



View larger version (93K):
[in this window]
[in a new window]
 
FIGURE 2. Immunoprecipitation of sCTLA-4 from ATD serum. Arrow marks ~23-kDa species. NsCTLA-4 indicates an ATD patient sample; RsCTLA-4 is the immunoprecipitate of recombinant sCTLA-4 produced in a CHO cell expression system. The upper band represents mouse Ig carried over in the precipitation.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We3 and others (18) have recently described an alternate transcript of the CTLA-4 gene that encodes a protein that lacks a transmembrane region and likely represents a native soluble form of CTLA-4. The work presented in this report documents the finding of CTLA-4 immunoreactive material in serum of patients with ATD including Graves’ disease and Hashimoto’s thyroiditis. Because the immunoreactive material contains two epitopes, one of which is unique to the putative sCTLA-4 protein, we propose that sCTLA-4 is a novel polypeptide product of the CTLA-4 gene. The fact that CTLA-4 immunoreactivity can be blocked by one of its known ligands (namely, B7.1) supports the notion that sCTLA-4 encodes a functional receptor. Like other soluble receptors (20, 21, 22, 23, 24, 25), sCTLA-4 may have important immunoregulatory functions. The effect of sCTLA-4 binding to B7 molecules might depend on the activation status of the cells involved. For example, on resting cells, sCTLA-4 may block B7-CD28 interactions, thereby interfering with T cell costimulation. On the other hand, inhibition of B7-CTLA-4 interactions on activated T cells (conditions under which the transmembrane form of the molecule is selectively expressed) may prevent down-regulation of T cell responses. The functional activity of sCTLA-4 adds an additional level of complexity to the current description of the role of CTLA-4 in immunoregulation. For example, what are the relative roles of sCTLA-4 versus the transmembrane form of the molecule in the immune dysfunction observed in CTLA-4 knockout mice? CTLA-4 knockouts develop a profound polyclonal lymphoproliferative disorder that has commonly been attributed to inhibition of the attenuating effect of CTLA-4 on activated cells; however, because these animals contain deletions within the exon 2 which includes the B7-binding domains, they would lack both the soluble as well as the transmembrane forms of CTLA-4.

Our data differs from that reported by Magistrelli et al. (18) in that they report detection of circulating CTLA-4 in 14 of 64 healthy subjects (18). By contrast, we observed a value of >4 ng/ml in only one sample of 30 healthy individuals. It is possible that these differences are due to technical variables such as the different mAbs used for detection. Alternatively, they may be attributed to differences in the ethnic background of the populations tested or to the relatively undefined immunological status of the two control groups, for example, recent infection, allergy, etc.

We believe our findings to be provocative because they may also provide a link between the genetic susceptibility to ATD and differences in the expression of the various forms of the CTLA-4 molecule. Population genetics data clearly suggest a role for the CTLA-4 gene region in the susceptibility to ATD; however, a specific change in CTLA-4 structure or function has not been described. Two polymorphisms within the CTLA-4 gene have been studied with respect to population genetic associations with endocrine autoimmune disease. One of them represents a single nucleotide polymorphism that results in an amino acid substitution (Thr/Ala) within the signal sequence of the CTLA-4 polypeptide (19). The Ala allele has been reported to have statistically significant higher frequency among patients with Graves’ disease (17) as well as insulin dependent diabetes mellitus (10, 11, 12). No relationship between this dimorphism and CTLA-4 structure, function, or expression has been described. A small number of patients from this study (n = 5) who were positive for sCTLA-4 were typed for the Thr/Ala polymorphism, but this analysis revealed no exclusive association with a specific genotype (data not shown). A larger population needs to be studied to fully examine the relationship, if any, between CTLA-4 polymorphisms and circulating levels of sCTLA-4.

A second polymorphism with population genetic associations with autoimmune endocrine disease is a dinucleotide repeat (AT)n within exon 3 of the human CTLA-4 gene (9, 26). The dinucleotide repeat is within a noncoding region of the gene, but is potentially important because it might effect mRNA stability. Long runs of A and T are found in the 3' untranslated regions of a variety of transcripts that are transiently expressed including mRNAs for cytokines, lymphokines, and protooncogenes (27). It is possible that polymorphisms within this repeat unit effect stability or splicing of one or more of the alternate CTLA-4 transcripts, resulting in changes in expression observed in this study. This study does not, of course, provide support for such a concept, and it is certainly possible that the polymorphisms described to date merely serve as markers for variation within the CTLA-4 gene, the CD28 gene (which is closely linked to CTLA-4 (19)), or unknown genes in linkage disequilibrium with CTLA-4. Nevertheless, our findings of increased levels of sCTLA-4 in patients with ATD may reveal important information regarding CTLA-4 function as well as the pathogenesis of autoimmune disease. An interesting question that our data raises is whether elevated levels of sCTLA-4 represent a constitutive effect of a CTLA-4 susceptibility gene per se or rather are due to a physiologic response to the activation status of T cells with reactivity to thyroid autoantigens. To that end, we are currently examining the relationship between sCTLA-4 levels and disease onset in ATD.


    Acknowledgments
 
We thank Dr. John Kenny of Antibody Solutions, Inc. for the generous gift of the AS-33 Ab, and Dr. James Findling and the physicians and staff of the Endocrine Diabetes Center at St. Luke’s Medical Center for assistance in obtaining blood samples.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Martin K. Oaks, Transplant Research Laboratory, St. Luke’s Medical Center, 2900 West Oklahoma Avenue, Milwaukee, WI 53215. Back

2 Abbreviations used in this paper: ATD, autoimmune thyroid disease; sCTLA-4, soluble CTLA-4; EIA, enzyme immunoassay. Back

3 M. K. Oaks, K. M. Hallett, R. T. Penwell, E. C. Stauber, S. J. Warren, and A. J. Tector. A native soluble form of CTLA-4. Submitted for publication. Back

Received for publication February 2, 2000. Accepted for publication March 17, 2000.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Brunet, J. F., F. Denizot, M. F. Luciani, M. Roux-Dosseto, M. Suzan, M. G. Mattei, P. Golstein. 1987. A new member of the immunoglobulin superfamily: CTLA-4. Nature 328:267.[Medline]
  2. Linsley, P. S., W. Brady, L. Grosmaire, A. Aruffo, N. K. Damle, J. A. Ledbetter. 1991. Binding of the B cell activation antigen B7 to CD28 costimulates T cell proliferation and interleukin 2 mRNA accumulation. J. Exp. Med. 173:721.[Abstract/Free Full Text]
  3. Linsley, P. S., W. Brady, M. Urnes, L. S. Grosmaire, N. K. Damle, J. A. Ledbetter. 1991. CTLA-4 is a second receptor for the B cell activation antigen B7. J. Exp. Med. 174:561.[Abstract/Free Full Text]
  4. Thompson, C. B., J. P. Allison. 1997. The emerging role of CTLA-4 as an immune attenuator. Immunity 7:445.[Medline]
  5. Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K. P. Lee, C. B. Thompson, H. Griesser, T. W. Mak. 1995. Lymphoproliferative disorders with early lethality in mice deficient in CTLA-4. Science 270:985.[Abstract/Free Full Text]
  6. Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone, A. H. Sharpe. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3:541.[Medline]
  7. Karandikar, N. J., C. L. Vanderlugt, T. L. Walunas, S. D. Miller, J. A. Bluestone. 1996. CTLA-4: a negative regulator of autoimmune disease. J. Exp. Med. 184:783.[Abstract/Free Full Text]
  8. Luhder, F., P. Hoglund, J. P. Allison, C. Benoist, D. Mathis. 1998. Cytotoxic T lymphocyte-associated antigen 4 (CTLA-4) regulates the unfolding of autoimmune disease. J. Exp. Med. 187:427.[Abstract/Free Full Text]
  9. Yanagawa, T., Y. Hidaka, V. Guimaraes, M. Soliman, L. J. DeGroot. 1995. CTLA-4 gene polymorphism associated with Graves’ disease in a Caucasian population. J. Clin. Endocrinol. Metab. 80:41.[Abstract]
  10. Nistico. L., R., L. E. Buzzetti, B. Pritchard, C. Van der Auwera, E. Giovannini, M. T. Bosi, M. S. Larrad, C. C. Rios, C. S. Chow, C. S. Cockram, et al 1996. The CTLA-4 gene region of chromosome 2q33 is linked to and associated with type 1 diabetes. Hum. Mol. Genet. 5:1075.[Abstract/Free Full Text]
  11. Donner, H., H. Rau, P. G. Walfish, J. Braun, T. Siegmund, R. Finke, J. Herwig, K. H. Usadel, K. Badenhoop. 1997. CTLA4 alanine-17 confers genetic susceptibility to Graves’ disease and to type 1 diabetes mellitus. J. Clin. Endocrinol. Metab. 82:143.[Abstract/Free Full Text]
  12. Marron, M. P., L. J. Raffel, H. Garchon, C. O. Jacob, M. Serrano-Rios, M. T. Martinez Larrad, W. P. Teng, Y. Park, Z. X. Zhang, D. R. Goldstein, et al 1997. Insulin-dependent diabetes mellitus (IDDM) is associated with CTLA4 polymorphisms in multiple ethnic groups. Hum. Mol. Genet. 6:1275.[Abstract/Free Full Text]
  13. Kosta, K., P. F. Watson, A. P. Weetman. 1997. A CTLA-4 gene polymorphism is associated with both Graves’ disease and autoimmune hypothyroidism. Clin. Endocrinol. 46:551.[Medline]
  14. Kemp, E. H., R. A. Ajjan, E. S. Husebye, P. Peterson, R. Uibo, H. Imrie, S. H. Pearce, P. F. Watson, A. P. Weetman. 1998. A cytotoxic T lymphocyte antigen-4 (CTLA-4) gene polymorphism is associated with autoimmune Addisons’ disease in English patients. Clin. Endocrinol. 49:609.[Medline]
  15. Van Der Auwera, B. J., C. L. Vandewalle, F. C. Schuit, F. Winnock, I. H. De Leeuw, S. Van Imschoot, G. Lamberigts, F. K. Gorus. 1997. CTLA-4 gene polymorphism confers susceptibility to insulin-dependent diabetes mellitus (IDDM) independently from age and from other genetic or immune disease markers: the Belgian diabetes registry. Clin. Exp. Immunol. 110:98.[Medline]
  16. Awata, T., S. Kurihara, M. Iitaka, S. Takei, I. Inoue, C. Ishii, K. Negishi, T. Izumida, Y. Yoshida, R. Hagura, et al 1998. Association of CTLA-4 gene A-G polymorphism (IDDM12 locus) with acute-onset and insulin depleted IDDM as well as autoimmune thyroid disease (Graves’ disease and Hashimoto’s thyroiditis) in the Japanese population. Diabetes 47:128.[Medline]
  17. Heward, J. M., A. Allahabadia, M. Armitage, A. Hattersley, P. M. Dodson, K. Macleod, J. Carr-Smith, J. Daykin, A. Daly, M. C. Sheppard, et al 1999. The development of Graves’ disease and the CTLA-4 gene on chromosome 2q33. J. Clin. Endocrinol. Metab. 84:2398.[Abstract/Free Full Text]
  18. Magistrelli, G., P. Jeannin, N. Herbault, A. B. de Colgnac, J. F. Gauchat, J. Y. Bonnefoy, Y. Delneste. 1999. A soluble form of CTLA-4 generated by alternative splicing is expressed by nonstimulated human T cells. Eur. J. Immunol. 29:3596.[Medline]
  19. Harper, K., C. Balzano, E. Rouvier, M. G. Mattei, M. F. Luciani, P. Golstein. 1991. CTLA-4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location. J. Immunol. 147:1037.[Abstract]
  20. Schall, T. J., M. Lewis, K. J. Koller, A. Lee, G. C. Rice, G. H. Wong, T. Gatanaga, G. A. Granger, R. Lentz, H. Raab. 1991. Molecular cloning and expression of a receptor for human tumor necrosis factor. Cell 61:361.
  21. Josimovic-Alasevic, O., T. Herrmann, T. Diamenstein. 1998. Demonstration of two distinct forms of released low-affinity type interleukin 2 receptors. Eur. J. Immunol. 18:1855.
  22. Mosley, B., M. P. Beckmann, C. J. March, R. L. Idzerda, S. D. Gimpel, T. VandenBos, D. Friend, A. Alpert, D. Anderson, J. Jackson, et al 1989. The murine interleukin-4 receptor: molecular cloning and characterization of secreted and membrane bound forms. Cell 59:335.[Medline]
  23. Goodwin, R. G., D. Friend, S. F. Ziegler, R. Jerzy, B. A. Falk, S. Gimpel, D. Cosman, S. K. Dower, C. J. March, A. E. Namen, et al 1990. Cloning of the human and murine interleukin-7 receptors: demonstration of a soluble form and homology to a new receptor superfamily. Cell 60:941.[Medline]
  24. Cheng, J., T. Zhou, C. Liu, J. P. Shapiro, M. J. Brauer, M. C. Kiefer, P. J. Barr, J. D. Mountz. 1994. Protection from Fas-mediated apoptosis by a soluble from of the Fas molecule. Science 263:1759.[Abstract/Free Full Text]
  25. Fernandez-Botran, R.. 1991. Soluble cytokine receptors: their role in immunoregulation. FASEB J. 5:2567.[Abstract]
  26. Polymeropoulos, M. H., H. Xiao, D. S. Rath, C. R. Merril. 1991. Dinucleotide repeat polymorphism at the human CTLA4 gene. Nucleic Acids Res. 19:4018.[Free Full Text]
  27. Shaw, G., R. Kamen. 1986. A conserved AU sequence from the 3' untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Cell 46:659.[Medline]



This article has been cited by other articles:


Home page
Eur J EndocrinolHome page
J. Daroszewski, E. Pawlak, L. Karabon, I. Frydecka, A. Jonkisz, M. Slowik, and M. Bolanowski
Soluble CTLA-4 receptor an immunological marker of Graves' disease and severity of ophthalmopathy is associated with CTLA-4 Jo31 and CT60 gene polymorphisms
Eur. J. Endocrinol., November 1, 2009; 161(5): 787 - 793.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
R. Simone, R. Brizzolara, A. Chiappori, F. Milintenda-Floriani, C. Natale, L. Greco, M. Schiavo, M. Bagnasco, G. Pesce, and D. Saverino
A functional soluble form of CTLA-4 is present in the serum of celiac patients and correlates with mucosal injury
Int. Immunol., September 1, 2009; 21(9): 1037 - 1045.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. K. Decker, D. Xing, S. Li, S. N. Robinson, H. Yang, D. Steiner, K. V. Komanduri, and E. J. Shpall
Th-1 polarization is regulated by dendritic-cell comparison of MHC class I and class II antigens
Blood, April 30, 2009; 113(18): 4213 - 4223.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
E. H. Garin, L. N. Diaz, W. Mu, C. Wasserfall, C. Araya, M. Segal, and R. J. Johnson
Urinary CD80 Excretion Increases in Idiopathic Minimal-Change Disease
J. Am. Soc. Nephrol., February 1, 2009; 20(2): 260 - 266.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Perez-Garcia, R. De la Camara, J. Roman-Gomez, A. Jimenez-Velasco, M. Encuentra, J. B. Nieto, J. de la Rubia, A. Urbano-Ispizua, S. Brunet, A. Iriondo, et al.
CTLA-4 polymorphisms and clinical outcome after allogeneic stem cell transplantation from HLA-identical sibling donors.
Blood, July 1, 2007; 110(1): 461 - 467.
[Abstract] [Full Text] [PDF]


Home page
GutHome page
O Tapirdamaz, V Pravica, H J Metselaar, B Hansen, L Moons, J B J van Meurs, I V Hutchinson, J Shaw, K Agarwal, D H Adams, et al.
Polymorphisms in the T cell regulatory gene cytotoxic T lymphocyte antigen 4 influence the rate of acute rejection after liver transplantation
Gut, June 1, 2006; 55(6): 863 - 868.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Geng, G.-M. Zhang, D. Li, H. Zhang, Y. Yuan, H.-G. Zhu, H. Xiao, L.-F. Han, and Z.-H. Feng
Soluble Form of T Cell Ig Mucin 3 Is an Inhibitory Molecule in T Cell-Mediated Immune Response
J. Immunol., February 1, 2006; 176(3): 1411 - 1420.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
D. Homann, W. Dummer, T. Wolfe, E. Rodrigo, A. N. Theofilopoulos, M. B. A. Oldstone, and M. G. von Herrath
Lack of Intrinsic CTLA-4 Expression Has Minimal Effect on Regulation of Antiviral T-Cell Immunity
J. Virol., January 1, 2006; 80(1): 270 - 280.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
C. K. Wong, L. C. W. Lit, L. S. Tam, E. K. Li, and C. W. K. Lam
Aberrant production of soluble costimulatory molecules CTLA-4, CD28, CD80 and CD86 in patients with systemic lupus erythematosus
Rheumatology, August 1, 2005; 44(8): 989 - 994.
[Abstract] [Full Text] [PDF]


Home page
Br Med BullHome page
M. J. Simmonds and S. C. L. Gough
Genetic insights into disease mechanisms of autoimmunity
Br. Med. Bull., February 8, 2005; 71(1): 93 - 113.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
J. L. Riley and C. H. June
The CD28 family: a T-cell rheostat for therapeutic control of T-cell activation
Blood, January 1, 2005; 105(1): 13 - 21.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
S. Sato, M. Fujimoto, M. Hasegawa, K. Komura, K. Yanaba, I. Hayakawa, T. Matsushita, and K. Takehara
Serum soluble CTLA-4 levels are increased in diffuse cutaneous systemic sclerosis
Rheumatology, October 1, 2004; 43(10): 1261 - 1266.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. S. Wicker, G. Chamberlain, K. Hunter, D. Rainbow, S. Howlett, P. Tiffen, J. Clark, A. Gonzalez-Munoz, A. M. Cumiskey, R. L. Rosa, et al.
Fine Mapping, Gene Content, Comparative Sequencing, and Expression Analyses Support Ctla4 and Nramp1 as Candidates for Idd5.1 and Idd5.2 in the Nonobese Diabetic Mouse
J. Immunol., July 1, 2004; 173(1): 164 - 173.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Oaks, M. K.
Right arrow Articles by Hallett, K. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Oaks, M. K.
Right arrow Articles by Hallett, K. M.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS