|
|
||||||||
-Dependent Delay of In Vivo Tumor Progression by Fas Overexpression on Murine Renal Cancer Cells1 ,2





*
Laboratory of Experimental Immunology, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD; and
Intramural Research Support Program, Science Applications International Corp.- Frederick,
Pediatric Oncology Branch, Division of Clinical Sciences, National Cancer Institute, Bethesda, MD
| Abstract |
|---|
|
|
|---|
and TNF. Transfected Renca cells overexpressing Fas
were efficiently killed in vitro upon exposure to anti-Fas Ab
(Jo2). When Fas-overexpressing Renca cells were injected into syngenic
BALB/c mice, there was a consistent and significant delay in tumor
progression, reduced metastasis, and prolonged survival that was not
observed for Renca cells that overexpressed a truncated nonfunctional
Fas receptor. The delay of in vivo tumor growth induced by Fas
overexpression was not observed in IFN-
-/- mice,
indicating that IFN-
is required for the delay of in vivo tumor
growth. However, there was a significant increase of infiltrated T
cells and in vivo apoptosis in Fas-overexpressing Renca tumors, and
Fas-overexpressing Renca cells were also efficiently killed in vitro by
T cells. In addition, a strong therapeutic effect was observed on
Fas-overexpressing tumor cells by in vivo administration of
anti-Fas Ab, confirming that overexpressed Fas provides a
functional target in vivo for Fas-specific ligands. Therefore, our
findings demonstrate that Fas overexpression on solid tumor cells can
delay tumor growth and provides a rationale for therapeutic
manipulation of Fas expression as a means of inducing tumor regression
in vivo. | Introduction |
|---|
|
|
|---|
and/or TNF (8, 9, 10). Expression of FasL is usually limited
to activated T cells, NK cells, and cells in immunologically privileged
sites such as testis and eye (11, 12). Some tumors also
express FasL and it has been proposed that this provides a mechanism by
which neoplastic cells may eliminate Fas-expressing leukocytes that
enter the tumor microenvironment (13, 14, 15). The expression
and function of Fas have been extensively studied on hematopoietic
tumor cells (16, 17, 18, 19, 20). However, in spite of the ubiquitous
expression of Fas on various solid tumors, its role as a possible
therapeutic target has not been well characterized. Therefore, to
evaluate the potential role of this pathway in the endogenous host
response against solid tumors and the potential therapeutic utility of
manipulation of Fas expression on tumor cells, we investigated the
biological effects of Fas overexpression on the killing and growth of
murine renal carcinoma cells both in vitro and in vivo. | Materials and Methods |
|---|
|
|
|---|
BALB/c mice were obtained from the Animal Production Area of the
National Cancer Institute-Frederick Cancer Research and Development
Center (NCI-FCRDC). BALB/c IFN-
-/- and IL-12
p40-/- mice were generously provided by Dr.
Dyana Dalton (Genentech, South San Francisco, CA) and Dr. Jeanne Magram
(Hoffman-LaRoche, Nutley, NJ), respectively. These mice were maintained
in our own pathogen-free breeding colony (NCI-FCRDC) and used between 8
and 10 wk of age. The Renca renal adenocarcinoma of BALB/c origin
(21) was used as the tumor model, and Renca cells were
maintained in RPMI 1640 medium supplemented with 10% FBS, 2 mM
L-glutamine, 1x nonessential amino acids, and 1 mM sodium
pyruvate.
Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication No. 86-23, 1985).
Cytokines and reagents
Mouse recombinant IFN-
(sp. act., 4.7 x
106 U/mg) was generously provided by Genentech.
TNF (sp. act., 1.2 x 107 U/mg),
anti-mouse Fas (Jo2) mAb, and the hamster IgG isotype control were
purchased from PharMingen (San Diego, CA).
In vitro proliferation assays
In vitro proliferation assays examined the growth rate of parental and Fas-transfected Renca cells by counting the number of cells after plating 105 cells/10-cm tissue culture dish for 4 days as well as by [3H]thymidine incorporation assay after plating 103 cells in a 96-well plate.
Flow cytometric analysis
The expression of Fas on Renca tumor cells was analyzed using flow cytometry. Cells (5 x 105) were stained with PE-labeled anti-mouse Fas Ab (Jo2) or PE-labeled hamster IgG isotype control Ab at 4°C for 20 min. After washing, cells were analyzed on a FACScan (Becton Dickinson, Mountain View, CA) flow cytometer using Cellquest software.
Construction of recombinant DNA and stable transfection
For construction of a recombinant Fas expression vector, the 1039-bp full-length coding region of the mouse Fas and 610-bp dominant-negative Fas lacking the intracellular signaling domain were amplified by PCR from a cDNA plasmid vector (8) using the forward primer Fas-5A: GCTGTTTTCCCTTGCTGCAGAC and reverse primer Fas-3A: CTCCTCTCTTCATGGCTGGAAC or Fas-3B: CTACCAGCACTTTCTTTTCCGGTA, respectively. PCR-amplified products were ligated into the Unidirectional Eukaryotic TA Cloning Expression Vector (Invitrogen, San Diego, CA). The integrity of the insert was confirmed by sequencing. The expression vectors coding full-length Fas or dominant-negative (DN) Fas were transfected into Renca tumor cells using Lipofectamine (Life Technologies, Gaithersburg, MD) according to the manufacturers instructions. Briefly, Renca cells (1 x 105) were plated in a 6-well plate in 2 ml of complete medium and incubated at 37°C in a 5% CO2 incubator until the cells were 5080% confluent. The cells were transfected with 2 µg of recombinant expression vector DNA and 5 µl of Lipofectamine for 6 h, passaged, and cultured continuously in the presence of 800 µg/ml Geneticin from days 3 to 14. Geneticin-resistant Renca clones were selected by limiting dilution, and flow cytometry was used to select clones that exhibited high levels of Fas expression. Renca cells transfected with empty vector alone were also selected under high concentrations of Geneticin (1000 µg/ml) as a control cell line. All of these cell lines were screened for the presence of Mycoplasma and found to be negative.
Cytotoxicity assays
Target cells (1 x 104 cells) were labeled with 111Im oxine ([111Im]Ox), as described previously (22), and incubated in a volume of 200 µl of complete medium in wells of a 96-well flat-bottom plate with various concentrations of anti-Fas Ab (Jo2) in the presence of P815 (1 x 105 cells) to promote Ab cross-linking (23). However, in T cell-mediated cytotoxicity assays, labeled tumor target cells were incubated with mouse lymph node cells as effector cells in the presence of an Ab to CD3 (PharMingen) at 1 µg/ml to promote cross-linking of the TCR. After an 18-h incubation, supernatants were harvested and counted in a gamma spectrophotometer (Wallac model 1480; Wallac, Gaithersburg, MD). Specific killing (percent cytotoxicity) was calculated as [(experimental release - spontaneous release) ÷ (maximal release - spontaneous release)] x 100. All groups were run in triplicate.
In vivo tumor model
To investigate in vivo growth characteristics, the respective parental or Fas-transfected Renca tumor cell lines (1 x 105 cells) were injected s.c. in the right flank of syngenic BALB/c mice. Tumor growth (mm2) and survival (percent) were monitored. The size of the tumors (mm2) was measured twice a week, and tumor size was calculated by multiplying vertical length by horizontal length. For assessment of metastatic capabilities, tumor cells (1 x 105 cells) were either injected intrarenally (for subsequent evaluation of spontaneous pulmonary metastases) or intrasplenically (for formation of induced hepatic metastases) as described previously (21). Metastases were quantified at day 14 after tumor injection. To test in vivo therapeutic effects of anti-Fas Ab, Renca tumor cells (1 x 105 cells) were injected s.c. into syngeneic BALB/c (five mice per group). At day 7 after tumor injection, anti-Fas Ab (Jo2; 2.5 µg/mice) or isotype control Ab (2.5 µg/mice) were injected peritumorally on days 7, 9, 11, 14, 16, 18, 21, 23, and 25. Tumor growth and survival were monitored.
Immunohistochemistry and in situ apoptosis
Tumors were resected after mice were euthanized utilizing CO2 asphyxiation and/or cervical dislocation. Specimens for routine histologic examination were fixed in Formalin and embedded in paraffin. Sections were then cut at 5-µm thickness and used for immunohistochemical evaluation of local T cell infiltration. Tissue sections were warmed in a 60°C oven for 10 min, deparaffinized, and hydrated with deionized water. Sections were then digested with 0.5% protease VIII for 3 min at 37°C. Slides were then rinsed in deionized water, and endogenous peroxidase activity was quenched by incubation in room temperature 3% hydrogen peroxide for 10 min, followed by rinsing with 0.5% Tween 20/PBS. Nonspecific binding of reagents was blocked by incubation of sections for 20 min in a solution consisting of 1% BSA and 1.5% normal goat serum. Sections were then incubated with rabbit anti-human CD3 (Dako, Carpinteria, CA) primary Ab or an irrelevant isotype control Ab. Sections were subsequently incubated for 30 min with a biotinylated goat anti-rabbit IgG secondary Ab (Vector Laboratories, Burlingame, CA), and the avidin/biotin complex elite reagent (Vector Laboratories) for 30 min. diaminobenzidine (Sigma, St. Louis, MO) was then applied for 4 min as a substrate for the peroxidase reaction. Slides were then counterstained with hematoxylin, dehydrated, and coverslipped with Permount for light microscopic evaluation. Apoptotic cells were detected utilizing the in situ end-labeling technique (ApopTag; Oncor, Gaithersburg, MD) performed on Formalin-fixed paraffin-embedded 5-µm-thickness tissue sections.
Statistical analysis
The comparison of mean values between groups was analyzed using GraphPad InStat software (GraphPad, San Diego, CA). Statistical analysis of survival data was performed by the Kaplan-Meier method and logarithm-rank statistic was used to test differences between groups. All p values < 0.05 were considered to be significant.
| Results |
|---|
|
|
|---|
and TNF
To examine the expression of Fas on Renca cells, we measured its
expression in the presence or absence of IFN-
and TNF pretreatment.
Constitutive expression of the Fas receptor was low on untreated Renca
cells, and its expression was up-regulated by either IFN-
or TNF
(Fig. 1
A). The combination of
IFN-
and TNF induced a strong synergistic up-regulation of Fas
expression in vitro as measured by a 10-fold shift in mean fluorescence
intensity (MFI) compared with the medium control (Fig. 1
B).
This up-regulation of Fas expression was clearly detectable by 3 h
and continued to increase through 24 h of culture.
|
As shown in Fig. 1
C, parental Renca cells were
inherently resistant to Fas-mediated killing. However, after treatment
with IFN-
and TNF, Renca exhibited increased expression of Fas (Fig. 1
B) and correspondingly became sensitive to Fas-mediated
killing (Fig. 1
C). To determine whether the level of Fas
expression on Renca is correlated with sensitivity to Fas-mediated
killing in vitro and assess the need for an intact Fas-signaling
pathway to mediate this sensitivity, full-length Fas and inactive
DN-Fas were overexpressed in Renca cells by stable transfection.
Several positive clones expressing high cell surface Fas (R1-10 and
R1-17) or DN-Fas (R2-25 and R2-47) were selected by flow cytometry
(Fig. 2
, A and B)
and used for assessment of Fas-mediated cytotoxicity by
[111Im]Ox release. Renca Fas transfectants were
efficiently killed after exposure to anti-Fas Ab (Jo2) in vitro,
without previous exposure to IFN-
and TNF, whereas parental Renca
cells and DN-Fas transfectants remained resistant to Fas-mediated
killing (Fig. 2
C). The d11S cells expressing functional FasL
on the cell surface (23) also induced efficient
killing of Renca Fas transfectants as well as Renca cells treated with
IFN-
and TNF, whereas parental Renca and DN-Fas transfectants were
resistant (data not shown). Therefore, enhanced expression of
functional Fas either by cytokine induction or molecular overexpression
results in increased susceptibility to Fas-mediated killing in
vitro.
|
and TNF. As expected,
high-level constitutive expression of Fas mRNA in Renca Fas
transfectants and some increase in Fas mRNA in Renca cells treated with
IFN-
and TNF, respectively, was observed (data not shown). However,
expression of other apoptosis-related genes (e.g., Flice,
FasL, FADD, FAF, RIP,
TRAIL, Bcl-2 family) was not changed by either
Jo2 Ab treatment or IFN-
and TNF treatment (data not shown). This
suggests that transcriptional modulation of these
apoptosis-associated genes is not required for the induction of
Fas-mediated killing of Renca cells that overexpress Fas after
treatment with IFN-
and TNF, or as a consequence of
transfection. Overexpression of Fas, but not truncated Fas, on Renca cells suppresses in vivo tumor growth
To determine whether overexpression of Fas affects the
proliferation rate of Renca, in vitro assays were performed to compare
the growth rates of Fas transfectants with parental Renca cells by
directly counting cells for several days or by measuring
[3H]thymidine incorporation (Fig. 3
). No difference was observed between
parental Renca and Renca Fas transfectants, demonstrating that the
inherent proliferation rate of the Renca cells was not affected by Fas
overexpression. To examine the effects of Fas overexpression on in vivo
tumor growth, Renca tumor cells were injected s.c. into syngeneic
BALB/c mice and tumor progression was monitored. Overexpression of Fas
on Renca cells (R1-10 and R1-17) significantly delayed tumor
progression (Fig. 4
A) and
extended the mean survival times from 34 days for the parental cells to
44 days (p < 0.0001) for the
Fas-overexpressing cells (Fig. 5
). As
shown in Fig. 4
B, the delay in tumor progression is a
Fas-specific effect since the vector control clone of Renca
(Renca-VC) and DN-Fas transfectants (R2-24, R2-47) that overexpress a
truncated, nonfunctional Fas, did not exhibit any delay in tumor
growth. Overexpression of Fas on Renca cells also resulted in
significantly (p < 0.002) fewer liver
metastases at day 14 after intrasplenic injection of Fas transfectant
R1-10 cells (mean, 111) than produced by the parental Renca cells
(mean, >300; Fig. 6
A).
Similarly, the mean number of lung metastases spontaneously formed at
day 14 after intrarenal injection of R1-10 Renca cells (mean, 25) was
significantly (p < 0.05) less than the number
formed by parental Renca cells (mean, 57; Fig. 6
B).
|
|
|
|
is essential for delay of in vivo tumor growth
by Fas overexpression
It has been recently reported that, in some cases, tumor growth in
vivo is partially constrained by IFN-
-dependent endogenous host
responses (24). We speculated that such effects by IFN-
might be critical for the slower in vivo growth of Fas-overexpressing
Renca cells. Therefore, the growth of parental Renca cells and
Fas-overexpressing Renca tumor cells was monitored in mouse strains
deficient in IFN-
or IL-12 p40. As shown in Fig. 7
, the slower in vivo tumor growth of
Fas-overexpressing cells that occurs in normal BALB/c mice was not
observed in IFN-
-/- mice, whereas the slower
growth of Fas-overexpressing Renca cells observed in wild-type BALB/c
mice was also observed in IL-12 p40-/- mice.
These results indicate that endogenous production of IFN-
contributes substantially to the in vivo delay in progression of
Fas-overexpressing tumors.
|
To investigate the mechanism for Fas-mediated delay of in vivo
tumor progression, anti-CD3 immunohistochemistry and an analysis of
in situ apoptosis were performed from in vivo tumor tissues. As shown
in Fig. 8
, there was a significant
increase in both infiltrated CD3+ T cells
(p < 0.001) and in vivo apoptosis
(p < 0.001) in Fas-overexpressing Renca
(R1-17) tumors. In contrast, there was no increase of T cells or
apoptosis in DN-Fas-overexpressing tumors (R2-47) as compared with
parental Renca tumor cells. To determine whether IFN-
was
contributing to recruitment or postrecruitment events in this model, T
cell was examined in wild-type mice and
IFN-
-/- mice. As shown in Fig. 9
, IFN-
-deficient T cells were able to
infiltrate into the tumor sites in IFN-
-/-
mice to a similar degree as in wild-type mice
(p = 0.22), indicating that the
IFN-
-dependent delay in in vivo Fas-overexpressing tumor progression
is not simply due to a gross defect in the ability of T cells to
infiltrate into tumor sites. Based on increased infiltrated T cells and
in vivo apoptosis in Fas-overexpressing tumor-bearing mice, we
hypothesized that overexpressed Fas on Renca tumor cells can be a
target of FasL-expressing effector cells in vivo. Therefore, we tested
whether Fas-overexpressing Renca tumor cells can be killed by
anti-CD3-activated T cells. As shown in Fig. 10
, Fas-overexpressing Renca cells were
efficiently killed by T cells, whereas parental Renca and
DN-Fas-overexpressing cells were very resistant to T
cell-mediated killing. However, subsequent studies demonstrated that
anti-CD3-activated T cells also could kill Fas-overexpressing Renca
cells (data not shown), suggesting that the lack of tumor growth in
IFN-
-/- mice is not due to some
inherent defect in cytotoxic function by these cells. Rather, it
suggests that IFN-
is important for the local activation of newly
recruited T cells and/or for some indirect antitumor activity such as
macrophage-mediated killing or induction of IFN-
-dependent
antiangiogenic activity.
|
|
|
We demonstrated that overexpression of Fas on Renca tumor cells
results in delay of in vivo tumor progression by the endogenous host
response (Fig. 4
). To confirm that overexpression of functional Fas on
these cells can actually serve as a specific target for
Fas-mediated tumor regression, established Renca tumors were
treated in vivo with either isotype control Ab or anti-Fas Ab
(Jo2). The expected delay of in vivo tumor progression by Fas
overexpression was not changed by isotype control Ab treatment on
Fas-overexpressing tumor cells (Fig. 11
). However, administration of
anti-Fas Ab to mice bearing Fas-overexpressing tumors resulted in
complete tumor regression in four of five mice after anti-Fas Ab
treatment, whereas all mice bearing parental and DN-Fas-overexpressing
tumors died of progressive tumor growth. These data demonstrate that
overexpression of Fas on tumor cells can preferentially render these
cells sensitive to Fas-mediated biological therapy.
|
| Discussion |
|---|
|
|
|---|
The expression of Fas on Renca cells was up-regulated either by IFN-
or TNF, and a combination of IFN-
and TNF showed strong synergism
for Fas expression (Fig. 1
, A and B). It has been
previously demonstrated that IFN-
and TNF can be major inducers of
Fas expression (8, 9, 10). We also observed a strong
synergistic effect of IFN-
and TNF for Fas up-regulation in a
variety of mouse solid tumor cell lines such as 3LL, B16, Colon 26, and
M109 (data not shown). In the murine Fas promoter, two transcription
factors, NF-
B and NF-IL-6, have been recently identified
for Fas gene transcription (26). It seems
likely that the synergistic effects of IFN-
and TNF for Fas
induction may be mediated by synergistic activation of
NF-
B and NF-IL-6. The strong correlation between
induction of cell surface Fas expression and Fas mRNA expression by
cytokine(s) activation (data not shown) suggests that Fas cell surface
expression is regulated at the transcriptional level of Fas
gene expression.
Renca cells were resistant to Fas-mediated apoptosis in vitro without
cytokine activation. However, treatment of Renca with IFN-
and TNF
synergistically up-regulated the expression of Fas and subsequently
induced Fas-mediated apoptosis (Fig. 1
C). We also noted that
several other mouse solid tumor cell lines became sensitive to
Fas-mediated apoptosis after up-regulation of Fas expression by IFN-
and TNF (data not shown). Overexpression of Fas by stable transfection
also induced susceptibility to Fas-mediated apoptosis of Renca cells
without cytokine treatment (Fig. 2
), indicating that Renca cells have
intact Fas-mediated cell death machinery in place although Renca is
inherently resistant to Fas-mediated apoptosis without cytokine
activation. Moreover, according to data generated using the RiboQuant
RNase protection assays for Renca Fas transfectants treated with
agonist anti-Fas Ab (Jo2), expression of apoptosis-related genes
(e.g., Caspase-8, FasL, FADD,
FAF, RIP, TRAIL, Bcl-2
family) was not changed during the Fas-mediated apoptosis process (data
not shown), suggesting that the transmission of the Fas-mediated death
signal in Renca cells occurs without new transcriptional induction of
known apoptosis-related genes. Fas-mediated apoptosis may also occur in
the absence of de novo RNA or protein synthesis as demonstrated in
TNF-induced apoptosis (27). Therefore, it is most likely
that the level of cell surface Fas expression is the critical parameter
for Fas-mediated apoptosis for some solid tumors as opposed to some
regulatory events downstream of Fas receptor ligation.
It has been previously demonstrated that Fas expressed on Renca cells is an effective target for Renca tumor cell killing by anti-Fas Ab (Jo2) cross-linking or activated T cells (23), and FasL gene therapy inhibited Renca tumor growth in vivo by inducing cell death (28). Our results suggest that the delay of in vivo tumor growth with reduced metastasis by Fas overexpression on Renca cells is likely mediated by the interaction of Fas with FasL, which is usually expressed on activated T cells (primarily CD8+), and NK cells. Therefore, the infiltration of CD8+ T cells and/or NK cells into tumor sites and subsequent activation of the infiltrated cells for more FasL expression or the local production of soluble FasL may be critical for the induction of Fas-mediated killing of Fas-expressing tumor cells, and such effects may well be enhanced when levels of cell surface Fas are increased on the tumor. This suggestion is supported by studies that confirmed by immunohistochemistry a significant increase of T cells and apoptosis in Fas-overexpressing tumors, when compared with parental Renca and DN-Fas-overexpressing tumors. In addition, Fas-overexpressing Renca cells were efficiently killed in vitro by T cells. These data demonstrate that overexpressed Fas on tumor cells can be a target of T cells in vivo. However, the mechanism for increase of infiltrated T cells and in vivo apoptosis in Fas-overexpressing tumor sites remains to be elucidated. It is also possible that induction of apoptosis may contribute to further recruitment of T cells into tumor sites through the release of cell debris, phagocytosis, and subsequent production of inflammatory or chemotactic mediators in the tumor microenvironment.
As shown in this report, delay of in vivo tumor progression with
reduced metastasis as a consequence of Fas overexpression suggests that
endogenous immune responses can limit tumor growth via Fas-dependent
mechanisms. In particular, overexpression of functional Fas, but not
nonfunctional Fas, on Renca resulted in a delay of in vivo tumor growth
in normal BALB/c mice (Fig. 4
), but this growth delay was not evident
in IFN-
-/- mice (Fig. 7
), indicating that
endogenous IFN-
gene expression is required for the delay of in vivo
tumor growth. This result is consistent with a previous study
(24) demonstrating that endogenously produced IFN-
is
crucial for the tumor surveillance system. The role of IFN-
cannot
be simply explained by differences in requirement for IFN-
as a
growth factor since the in vitro growth of various transfectants is
unaltered by the presence of IFN-
(data not shown). It has been
reported that IFN-
up-regulates not only Fas but also FasL
expression (29, 30), and in vivo neutralization of IFN-
protein significantly reduced expression of FasL on
CD4+ and CD8+ T cells
(30). Therefore, it is possible that up-regulation of host
FasL expression is also defective in IFN-
-/-
mice, thereby further contributing to the lack of a delay of in vivo
tumor growth in IFN-
-/- mice.
To determine the role of IFN-
in delay of in vivo tumor progression
by Fas overexpression, T cell infiltration was examined in wild-type
mice and IFN-
-/- mice. As shown in Fig. 9
, T
cells were also able to infiltrate into tumor sites in
IFN-
-deficient mice to a similar extent as in wild-type mice
(p = 0.22), indicating that the
IFN-
-dependent delay in in vivo Fas-overexpressing tumor growth is
not likely due to a defect in the ability of T cells to infiltrate into
tumor sites. Therefore, this result suggests that IFN-
may play some
role at the postrecruitment phase in this model. However, since T cells
isolated from IFN-
-deficient mice could be activated by anti-CD3
to show a similar level of lytic activity against Fas-overexpressing
Renca tumor cells as wild-type T cells (data not shown), it is likely
that the role of IFN-
in the delay of progression by
Fas-overexpressing tumor cells may be at the T cell activation stage or
be indirect. There are several possibilities for this type of mechanism
including a local requirement for IFN-
to activate recruited T cells
or some contribution via activation of tumor-associated macrophages by
IFN-
(31), or the local induction of IFN-
-dependent
antiangiogenic (32) or apoptotic factors.
Finally, it is important to note that Renca cells transfected with an inactive, truncated Fas (DN-Fas), as well as Renca cells transfected with control vectors, do not exhibit the reduced rate of in vivo tumor growth shown by Renca cells transfected with functional Fas. Furthermore, in vivo administration of anti-Fas Ab demonstrated an additional strong anti-tumor therapeutic effect on Fas-overexpressing tumor cells, suggesting that endogenous and exogenous manipulation of Fas-FasL interactions can be used as a means of inducing tumor regression in vivo. These results support the conclusion that the decreased in vivo growth of Fas transfectants is specifically related to Fas expression and is not due to some anomaly of the transfection process. These results also suggest that the strategies directed at preferential induction of death receptors on tumor cells and appropriate delivery of ligands for the Fas death receptor may contribute to, or enhance, some forms of biological therapy of cancer.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. government. The publisher or recipient acknowledges right of the U.S. government to retain a nonexclusive, royalty-free license in and to any copying covering the article. ![]()
3 Address correspondence and reprint requests to Dr. Robert H. Wiltrout, Experimental Therapeutics Section, Laboratory of Experimental Immunology, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Building 560, Room 31-93, Frederick, MD 21702-1201. E-mail address: ![]()
4 Abbreviations used in this paper: FasL, Fas ligand; DN, dominant-negative; MFI, mean fluorescence intensity. ![]()
Received for publication December 22, 1998. Accepted for publication October 18, 1999.
| References |
|---|
|
|
|---|
-dependent tumor surveillance system in immunocompetent mice. Proc. Natl. Acad. Sci. USA 95:7556.
induces cell growth inhibition by Fas-mediated apoptosis: requirement of STAT1 protein for up-regulation of Fas and FasL expression. Cancer Res. 58:2832.
production. J. Immunol. 161:2848.
to induce the C-X-C chemokines Mig and interferon-inducible protein-10 in mouse macrophages. J. Biol. Chem. 273:35088.This article has been cited by other articles:
![]() |
A. Shanker, A. D. Brooks, K. M. Jacobsen, J. W. Wine, R. H. Wiltrout, H. Yagita, and T. J. Sayers Antigen Presented by Tumors In vivo Determines the Nature of CD8+ T-Cell Cytotoxicity Cancer Res., August 15, 2009; 69(16): 6615 - 6623. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. M. Greeneltch, M. Schneider, S. M. Steinberg, D. J. Liewehr, T. J. Stewart, K. Liu, and S. I. Abrams Host Immunosurveillance Controls Tumor Growth via IFN Regulatory Factor-8 Dependent Mechanisms Cancer Res., November 1, 2007; 67(21): 10406 - 10416. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. V. Koshkina, C. Khanna, A. Mendoza, H. Guan, L. DeLauter, and E. S. Kleinerman Fas-Negative Osteosarcoma Tumor Cells Are Selected during Metastasis to the Lungs: The Role of the Fas Pathway in the Metastatic Process of Osteosarcoma Mol. Cancer Res., October 1, 2007; 5(10): 991 - 999. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhu, M. Waguespack, S. A. Barker, and S. Li Doxorubicin Directs the Accumulation of Interleukin-12 Induced IFN{gamma} into Tumors for Enhancing STAT1 Dependent Antitumor Effect Clin. Cancer Res., July 15, 2007; 13(14): 4252 - 4260. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Torrero, X. Xia, W. Henk, S. Yu, and S. Li Stat1 deficiency in the host enhances interleukin-12-mediated tumor regression. Cancer Res., April 15, 2006; 66(8): 4461 - 4467. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, S. A. Caldwell, K. M. Greeneltch, D. Yang, and S. I. Abrams CTL Adoptive Immunotherapy Concurrently Mediates Tumor Regression and Tumor Escape J. Immunol., March 15, 2006; 176(6): 3374 - 3382. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, S. A. Caldwell, and S. I. Abrams Immune Selection and Emergence of Aggressive Tumor Variants as Negative Consequences of Fas-Mediated Cytotoxicity and Altered IFN-{gamma}-Regulated Gene Expression Cancer Res., May 15, 2005; 65(10): 4376 - 4388. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu, S. A. Caldwell, and S. I. Abrams Cooperative Disengagement of Fas and Intercellular Adhesion Molecule-1 Function in Neoplastic Cells Confers Enhanced Colonization Efficiency Cancer Res., February 1, 2005; 65(3): 1045 - 1054. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Papageorgiou, L. Lashinger, R. Millikan, H. B. Grossman, W. Benedict, C. P. N. Dinney, and D. J. McConkey Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Interferon-Induced Apoptosis in Human Bladder Cancer Cells Cancer Res., December 15, 2004; 64(24): 8973 - 8979. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Puliaev, P. Nguyen, F. D. Finkelman, and C. S. Via Differential Requirement for IFN-{gamma} in CTL Maturation in Acute Murine Graft-versus-Host Disease J. Immunol., July 15, 2004; 173(2): 910 - 919. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chakraborty, S. I. Abrams, C. N. Coleman, K. Camphausen, J. Schlom, and J. W. Hodge External Beam Radiation of Tumors Alters Phenotype of Tumor Cells to Render Them Susceptible to Vaccine-Mediated T-Cell Killing Cancer Res., June 15, 2004; 64(12): 4328 - 4337. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Sheard, S. Uldrijan, and B. Vojtesek Role of p53 in Regulating Constitutive and X-Radiation-Inducible CD95 Expression and Function in Carcinoma Cells Cancer Res., November 1, 2003; 63(21): 7176 - 7184. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Caldwell, M. H. Ryan, E. McDuffie, and S. I. Abrams The Fas/Fas Ligand Pathway Is Important for Optimal Tumor Regression in a Mouse Model of CTL Adoptive Immunotherapy of Experimental CMS4 Lung Metastases J. Immunol., September 1, 2003; 171(5): 2402 - 2412. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Liu and S. I. Abrams Coordinate Regulation of IFN Consensus Sequence-Binding Protein and Caspase-1 in the Sensitization of Human Colon Carcinoma Cells to Fas-Mediated Apoptosis by IFN-{gamma} J. Immunol., June 15, 2003; 170(12): 6329 - 6337. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Seki, Y. Hayakawa, A. D. Brooks, J. Wine, R. H. Wiltrout, H. Yagita, J. E. Tanner, M. J. Smyth, and T. J. Sayers Tumor Necrosis Factor-related Apoptosis-inducing Ligand-mediated Apoptosis Is an Important Endogenous Mechanism for Resistance to Liver Metastases in Murine Renal Cancer Cancer Res., January 1, 2003; 63(1): 207 - 213. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Seki, A. D. Brooks, C. R. D. Carter, T. C. Back, E. M. Parsoneault, M. J. Smyth, R. H. Wiltrout, and T. J. Sayers Tumor-Specific CTL Kill Murine Renal Cancer Cells Using Both Perforin and Fas Ligand-Mediated Lysis In Vitro, But Cause Tumor Regression In Vivo in the Absence of Perforin J. Immunol., April 1, 2002; 168(7): 3484 - 3492. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Helmich and R. W. Dutton The Role of Adoptively Transferred CD8 T Cells and Host Cells in the Control of the Growth of the EG7 Thymoma: Factors That Determine the Relative Effectiveness and Homing Properties of Tc1 and Tc2 Effectors J. Immunol., June 1, 2001; 166(11): 6500 - 6508. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. A. Lafleur, S.-F. Jia, L. L. Worth, Z. Zhou, L. B. Owen-Schaub, and E. S. Kleinerman Interleukin (IL)-12 and IL-12 Gene Transfer Up-Regulate Fas Expression in Human Osteosarcoma and Breast Cancer Cells Cancer Res., May 1, 2001; 61(10): 4066 - 4071. [Abstract] [Full Text] |
||||
![]() |
S. E. A. Street, E. Cretney, and M. J. Smyth Perforin and interferon-{gamma} activities independently control tumor initiation, growth, and metastasis Blood, January 1, 2001; 97(1): 192 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Sayers, A. D. Brooks, N. Seki, M. J. Smyth, H. Yagita, B. R. Blazar, and A. M. Malyguine T cell lysis of murine renal cancer: multiple signaling pathways for cell death via Fas J. Leukoc. Biol., July 1, 2000; 68(1): 81 - 86. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |