The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, J.-K.
Right arrow Articles by Wiltrout, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, J.-K.
Right arrow Articles by Wiltrout, R. H.
The Journal of Immunology, 2000, 164: 231-239.
Copyright © 2000 by The American Association of Immunologists

IFN-{gamma}-Dependent Delay of In Vivo Tumor Progression by Fas Overexpression on Murine Renal Cancer Cells1 ,2

Jong-Keuk Lee*, Thomas J. Sayers{dagger}, Alan D. Brooks{dagger}, Timothy C. Back{dagger}, Howard A. Young*, Kristin L. Komschlies{dagger}, Jon M. Wigginton{ddagger} and Robert H. Wiltrout3,*

* Laboratory of Experimental Immunology, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, MD; and {dagger} Intramural Research Support Program, Science Applications International Corp.- Frederick, {ddagger} Pediatric Oncology Branch, Division of Clinical Sciences, National Cancer Institute, Bethesda, MD


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The role of Fas in the regulation of solid tumor growth was investigated. Murine renal carcinoma (Renca) cells were constitutively resistant to Fas-mediated killing in vitro, but exhibited increased expression of Fas and sensitivity to Fas-mediated killing after exposure to IFN-{gamma} and TNF. Transfected Renca cells overexpressing Fas were efficiently killed in vitro upon exposure to anti-Fas Ab (Jo2). When Fas-overexpressing Renca cells were injected into syngenic BALB/c mice, there was a consistent and significant delay in tumor progression, reduced metastasis, and prolonged survival that was not observed for Renca cells that overexpressed a truncated nonfunctional Fas receptor. The delay of in vivo tumor growth induced by Fas overexpression was not observed in IFN-{gamma}-/- mice, indicating that IFN-{gamma} is required for the delay of in vivo tumor growth. However, there was a significant increase of infiltrated T cells and in vivo apoptosis in Fas-overexpressing Renca tumors, and Fas-overexpressing Renca cells were also efficiently killed in vitro by T cells. In addition, a strong therapeutic effect was observed on Fas-overexpressing tumor cells by in vivo administration of anti-Fas Ab, confirming that overexpressed Fas provides a functional target in vivo for Fas-specific ligands. Therefore, our findings demonstrate that Fas overexpression on solid tumor cells can delay tumor growth and provides a rationale for therapeutic manipulation of Fas expression as a means of inducing tumor regression in vivo.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas (CD95), a member of the TNF receptor family, is a death receptor which induces apoptosis upon ligation with agonist anti-Fas Ab or the natural Fas ligand (FasL)4 (1). Fas-mediated apoptosis plays important roles in the immune system, including the apoptotic selection process during T cell development, clonal deletion of autoreactive T cells in the periphery, activation-induced suicide of T cells, and as an effector mechanism of CTL (1, 2). Inactivation of the Fas/FasL system causes lymphoproliferative disorders and accelerates autoimmune diseases that have been well characterized in mice carrying homozygous lpr (Fas) and gld (FasL) mutations (2, 3, 4, 5), whereas overactivity of the Fas/FasL system causes tissue destruction as demonstrated in thyroid diseases, fulminant hepatitis and chronic liver diseases, multiple sclerosis, and neutrophil-mediated tissue destruction (2, 6, 7). Fas is expressed on a variety of cell types, including activated lymphocytes and some solid tumors, and the expression of Fas is up-regulated by exposure to either IFN-{gamma} and/or TNF (8, 9, 10). Expression of FasL is usually limited to activated T cells, NK cells, and cells in immunologically privileged sites such as testis and eye (11, 12). Some tumors also express FasL and it has been proposed that this provides a mechanism by which neoplastic cells may eliminate Fas-expressing leukocytes that enter the tumor microenvironment (13, 14, 15). The expression and function of Fas have been extensively studied on hematopoietic tumor cells (16, 17, 18, 19, 20). However, in spite of the ubiquitous expression of Fas on various solid tumors, its role as a possible therapeutic target has not been well characterized. Therefore, to evaluate the potential role of this pathway in the endogenous host response against solid tumors and the potential therapeutic utility of manipulation of Fas expression on tumor cells, we investigated the biological effects of Fas overexpression on the killing and growth of murine renal carcinoma cells both in vitro and in vivo.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice and tumor cells

BALB/c mice were obtained from the Animal Production Area of the National Cancer Institute-Frederick Cancer Research and Development Center (NCI-FCRDC). BALB/c IFN-{gamma}-/- and IL-12 p40-/- mice were generously provided by Dr. Dyana Dalton (Genentech, South San Francisco, CA) and Dr. Jeanne Magram (Hoffman-LaRoche, Nutley, NJ), respectively. These mice were maintained in our own pathogen-free breeding colony (NCI-FCRDC) and used between 8 and 10 wk of age. The Renca renal adenocarcinoma of BALB/c origin (21) was used as the tumor model, and Renca cells were maintained in RPMI 1640 medium supplemented with 10% FBS, 2 mM L-glutamine, 1x nonessential amino acids, and 1 mM sodium pyruvate.

Animal care was provided in accordance with the procedures outlined in the Guide for the Care and Use of Laboratory Animals (National Institutes of Health Publication No. 86-23, 1985).

Cytokines and reagents

Mouse recombinant IFN-{gamma} (sp. act., 4.7 x 106 U/mg) was generously provided by Genentech. TNF (sp. act., 1.2 x 107 U/mg), anti-mouse Fas (Jo2) mAb, and the hamster IgG isotype control were purchased from PharMingen (San Diego, CA).

In vitro proliferation assays

In vitro proliferation assays examined the growth rate of parental and Fas-transfected Renca cells by counting the number of cells after plating 105 cells/10-cm tissue culture dish for 4 days as well as by [3H]thymidine incorporation assay after plating 103 cells in a 96-well plate.

Flow cytometric analysis

The expression of Fas on Renca tumor cells was analyzed using flow cytometry. Cells (5 x 105) were stained with PE-labeled anti-mouse Fas Ab (Jo2) or PE-labeled hamster IgG isotype control Ab at 4°C for 20 min. After washing, cells were analyzed on a FACScan (Becton Dickinson, Mountain View, CA) flow cytometer using Cellquest software.

Construction of recombinant DNA and stable transfection

For construction of a recombinant Fas expression vector, the 1039-bp full-length coding region of the mouse Fas and 610-bp dominant-negative Fas lacking the intracellular signaling domain were amplified by PCR from a cDNA plasmid vector (8) using the forward primer Fas-5A: GCTGTTTTCCCTTGCTGCAGAC and reverse primer Fas-3A: CTCCTCTCTTCATGGCTGGAAC or Fas-3B: CTACCAGCACTTTCTTTTCCGGTA, respectively. PCR-amplified products were ligated into the Unidirectional Eukaryotic TA Cloning Expression Vector (Invitrogen, San Diego, CA). The integrity of the insert was confirmed by sequencing. The expression vectors coding full-length Fas or dominant-negative (DN) Fas were transfected into Renca tumor cells using Lipofectamine (Life Technologies, Gaithersburg, MD) according to the manufacturer’s instructions. Briefly, Renca cells (1 x 105) were plated in a 6-well plate in 2 ml of complete medium and incubated at 37°C in a 5% CO2 incubator until the cells were 50–80% confluent. The cells were transfected with 2 µg of recombinant expression vector DNA and 5 µl of Lipofectamine for 6 h, passaged, and cultured continuously in the presence of 800 µg/ml Geneticin from days 3 to 14. Geneticin-resistant Renca clones were selected by limiting dilution, and flow cytometry was used to select clones that exhibited high levels of Fas expression. Renca cells transfected with empty vector alone were also selected under high concentrations of Geneticin (1000 µg/ml) as a control cell line. All of these cell lines were screened for the presence of Mycoplasma and found to be negative.

Cytotoxicity assays

Target cells (1 x 104 cells) were labeled with 111Im oxine ([111Im]Ox), as described previously (22), and incubated in a volume of 200 µl of complete medium in wells of a 96-well flat-bottom plate with various concentrations of anti-Fas Ab (Jo2) in the presence of P815 (1 x 105 cells) to promote Ab cross-linking (23). However, in T cell-mediated cytotoxicity assays, labeled tumor target cells were incubated with mouse lymph node cells as effector cells in the presence of an Ab to CD3 (PharMingen) at 1 µg/ml to promote cross-linking of the TCR. After an 18-h incubation, supernatants were harvested and counted in a gamma spectrophotometer (Wallac model 1480; Wallac, Gaithersburg, MD). Specific killing (percent cytotoxicity) was calculated as [(experimental release - spontaneous release) ÷ (maximal release - spontaneous release)] x 100. All groups were run in triplicate.

In vivo tumor model

To investigate in vivo growth characteristics, the respective parental or Fas-transfected Renca tumor cell lines (1 x 105 cells) were injected s.c. in the right flank of syngenic BALB/c mice. Tumor growth (mm2) and survival (percent) were monitored. The size of the tumors (mm2) was measured twice a week, and tumor size was calculated by multiplying vertical length by horizontal length. For assessment of metastatic capabilities, tumor cells (1 x 105 cells) were either injected intrarenally (for subsequent evaluation of spontaneous pulmonary metastases) or intrasplenically (for formation of induced hepatic metastases) as described previously (21). Metastases were quantified at day 14 after tumor injection. To test in vivo therapeutic effects of anti-Fas Ab, Renca tumor cells (1 x 105 cells) were injected s.c. into syngeneic BALB/c (five mice per group). At day 7 after tumor injection, anti-Fas Ab (Jo2; 2.5 µg/mice) or isotype control Ab (2.5 µg/mice) were injected peritumorally on days 7, 9, 11, 14, 16, 18, 21, 23, and 25. Tumor growth and survival were monitored.

Immunohistochemistry and in situ apoptosis

Tumors were resected after mice were euthanized utilizing CO2 asphyxiation and/or cervical dislocation. Specimens for routine histologic examination were fixed in Formalin and embedded in paraffin. Sections were then cut at 5-µm thickness and used for immunohistochemical evaluation of local T cell infiltration. Tissue sections were warmed in a 60°C oven for 10 min, deparaffinized, and hydrated with deionized water. Sections were then digested with 0.5% protease VIII for 3 min at 37°C. Slides were then rinsed in deionized water, and endogenous peroxidase activity was quenched by incubation in room temperature 3% hydrogen peroxide for 10 min, followed by rinsing with 0.5% Tween 20/PBS. Nonspecific binding of reagents was blocked by incubation of sections for 20 min in a solution consisting of 1% BSA and 1.5% normal goat serum. Sections were then incubated with rabbit anti-human CD3 (Dako, Carpinteria, CA) primary Ab or an irrelevant isotype control Ab. Sections were subsequently incubated for 30 min with a biotinylated goat anti-rabbit IgG secondary Ab (Vector Laboratories, Burlingame, CA), and the avidin/biotin complex elite reagent (Vector Laboratories) for 30 min. diaminobenzidine (Sigma, St. Louis, MO) was then applied for 4 min as a substrate for the peroxidase reaction. Slides were then counterstained with hematoxylin, dehydrated, and coverslipped with Permount for light microscopic evaluation. Apoptotic cells were detected utilizing the in situ end-labeling technique (ApopTag; Oncor, Gaithersburg, MD) performed on Formalin-fixed paraffin-embedded 5-µm-thickness tissue sections.

Statistical analysis

The comparison of mean values between groups was analyzed using GraphPad InStat software (GraphPad, San Diego, CA). Statistical analysis of survival data was performed by the Kaplan-Meier method and logarithm-rank statistic was used to test differences between groups. All p values < 0.05 were considered to be significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Fas expression on Renca cells is synergistically up-regulated by IFN-{gamma} and TNF

To examine the expression of Fas on Renca cells, we measured its expression in the presence or absence of IFN-{gamma} and TNF pretreatment. Constitutive expression of the Fas receptor was low on untreated Renca cells, and its expression was up-regulated by either IFN-{gamma} or TNF (Fig. 1GoA). The combination of IFN-{gamma} and TNF induced a strong synergistic up-regulation of Fas expression in vitro as measured by a 10-fold shift in mean fluorescence intensity (MFI) compared with the medium control (Fig. 1GoB). This up-regulation of Fas expression was clearly detectable by 3 h and continued to increase through 24 h of culture.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of Fas and Fas-mediated cytotoxicity on Renca cells by IFN-{gamma} and TNF. Renca cells were pretreated at 37°C for 12 h with medium alone, IFN-{gamma} (100 U/ml), TNF (100 U/ml), or a combination of IFN-{gamma} (100 U/ml) and TNF (100 U/ml). The expression of Fas on Renca cells (A and B) and Fas-mediated cytotoxicity assay (C) were measured as detailed in Materials and Methods. The dotted lines, solid lines, and shaded curves represent immunostaining with the isotype control Ab, anti-Fas Ab (Jo2) on cells in medium, and anti-Fas Ab (Jo2) on cells treated with cytokine, respectively. A time course assessment of Fas induction by cytokine treatment of Renca cells was performed via flow cytometry after incubation of cells for 0, 3, 6, 12, or 24 h (B). Fas expression was presented as MFI ratio (the ratio between MFI of specific and medium control staining).

 
Overexpression of physiologically active Fas on Renca confers susceptibility to Fas-mediated killing in vitro

As shown in Fig. 1GoC, parental Renca cells were inherently resistant to Fas-mediated killing. However, after treatment with IFN-{gamma} and TNF, Renca exhibited increased expression of Fas (Fig. 1GoB) and correspondingly became sensitive to Fas-mediated killing (Fig. 1GoC). To determine whether the level of Fas expression on Renca is correlated with sensitivity to Fas-mediated killing in vitro and assess the need for an intact Fas-signaling pathway to mediate this sensitivity, full-length Fas and inactive DN-Fas were overexpressed in Renca cells by stable transfection. Several positive clones expressing high cell surface Fas (R1-10 and R1-17) or DN-Fas (R2-25 and R2-47) were selected by flow cytometry (Fig. 2Go, A and B) and used for assessment of Fas-mediated cytotoxicity by [111Im]Ox release. Renca Fas transfectants were efficiently killed after exposure to anti-Fas Ab (Jo2) in vitro, without previous exposure to IFN-{gamma} and TNF, whereas parental Renca cells and DN-Fas transfectants remained resistant to Fas-mediated killing (Fig. 2GoC). The d11S cells expressing functional FasL on the cell surface (23) also induced efficient killing of Renca Fas transfectants as well as Renca cells treated with IFN-{gamma} and TNF, whereas parental Renca and DN-Fas transfectants were resistant (data not shown). Therefore, enhanced expression of functional Fas either by cytokine induction or molecular overexpression results in increased susceptibility to Fas-mediated killing in vitro.



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Expression of Fas and Fas-mediated cytotoxicity on Renca Fas transfectants. The expression of Fas on Fas transfectants (R1-10 and R1-17, A) and DN-Fas transfectants (R2-25 and R2-47, B) was measured by flow cytometry. The dotted lines, solid lines, and shaded curves represent immunostaining with the isotype control Ab, anti-Fas Ab (Jo2) on the parental cells, and Fas transfectants, respectively. Susceptibility to Fas-mediated cytotoxicity of Renca transfectants (C) was measured with anti-Fas Ab (Jo2) with P815 as detailed in Materials and Methods. Data points represent means ± SE of triplicate samples.

 
To determine whether Fas-mediated killing requires new transcriptional induction of known apoptosis-associated genes, RiboQuant (PharMingen, San Diego, CA) RNase protection assays were performed using parental Renca and Renca Fas transfectants (R1-17) treated with agonist anti-Fas Ab (Jo2) as well as IFN-{gamma} and TNF. As expected, high-level constitutive expression of Fas mRNA in Renca Fas transfectants and some increase in Fas mRNA in Renca cells treated with IFN-{gamma} and TNF, respectively, was observed (data not shown). However, expression of other apoptosis-related genes (e.g., Flice, FasL, FADD, FAF, RIP, TRAIL, Bcl-2 family) was not changed by either Jo2 Ab treatment or IFN-{gamma} and TNF treatment (data not shown). This suggests that transcriptional modulation of these apoptosis-associated genes is not required for the induction of Fas-mediated killing of Renca cells that overexpress Fas after treatment with IFN-{gamma} and TNF, or as a consequence of transfection.

Overexpression of Fas, but not truncated Fas, on Renca cells suppresses in vivo tumor growth

To determine whether overexpression of Fas affects the proliferation rate of Renca, in vitro assays were performed to compare the growth rates of Fas transfectants with parental Renca cells by directly counting cells for several days or by measuring [3H]thymidine incorporation (Fig. 3Go). No difference was observed between parental Renca and Renca Fas transfectants, demonstrating that the inherent proliferation rate of the Renca cells was not affected by Fas overexpression. To examine the effects of Fas overexpression on in vivo tumor growth, Renca tumor cells were injected s.c. into syngeneic BALB/c mice and tumor progression was monitored. Overexpression of Fas on Renca cells (R1-10 and R1-17) significantly delayed tumor progression (Fig. 4GoA) and extended the mean survival times from 34 days for the parental cells to 44 days (p < 0.0001) for the Fas-overexpressing cells (Fig. 5Go). As shown in Fig. 4GoB, the delay in tumor progression is a Fas-specific effect since the vector control clone of Renca (Renca-VC) and DN-Fas transfectants (R2-24, R2-47) that overexpress a truncated, nonfunctional Fas, did not exhibit any delay in tumor growth. Overexpression of Fas on Renca cells also resulted in significantly (p < 0.002) fewer liver metastases at day 14 after intrasplenic injection of Fas transfectant R1-10 cells (mean, 111) than produced by the parental Renca cells (mean, >300; Fig. 6GoA). Similarly, the mean number of lung metastases spontaneously formed at day 14 after intrarenal injection of R1-10 Renca cells (mean, 25) was significantly (p < 0.05) less than the number formed by parental Renca cells (mean, 57; Fig. 6GoB).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 3. In vitro growth curve of parental Renca and Renca Fas transfectants. In vitro proliferation assays were performed to examine the growth rate of parental Renca and Renca Fas transfectants by counting the number of cells (A) and by [3H]thymidine incorporation (B) as described in Materials and Methods. Data points represent means ± SE of triplicate samples.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 4. Delay of in vivo tumor progression by Fas overexpression on Renca cells. Renca tumor cells (1 x 105 cells) were injected in 0.2 ml of HBSS s.c. in syngeneic BALB/c mice (10 mice/group), and the tumor growth (A) was monitored as described in Materials and Methods. Renca tumor cells transfected with a DN-Fas expression vector (R2-25, R2-47) or vector alone (Renca-VC) were also monitored (seven mice per group) to compare with parental Renca and Fas-overexpressing Renca R1-17 cells (B). Data points represent the mean value for each group at the indicated time points. Tumor sizes in mice bearing parental Renca were compared with the other transfectants by Student’s t test at various time points, and p values are denoted as *, p < 0.05; *<226, >p < 0.01.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of Fas overexpression on survival of tumor-bearing mice. Parental Renca or Fas-overexpressing Renca (R1-10) tumor cells (1 x 105 cells) were injected s.c. in BALB/c mice. The combined results of four independent experiments were used for survival data analysis (n = 45 mice/group) as described in Materials and Methods. Logarithm-rank statistic, p < 0.0001.

 


View larger version (11K):
[in this window]
[in a new window]
 
FIGURE 6. Inhibition of tumor metastasis by Fas overexpression on Renca. Renca tumor cells (1 x 105 cells) were injected intrarenally in BALB/c mice (six mice per group) for spontaneous formation of lung metastases (A) or intrasplenically for direct induction of liver metastases (B), and the number of metastases were counted at day 14. Groups were compared by Student’s t test, and p values are shown. *, p < 0.05; **, p < 0.01. The number of metastases from individual mice is represented by open circles, whereas the mean number of metastases in each group is indicated by solid bars.

 
Endogenous IFN-{gamma} is essential for delay of in vivo tumor growth by Fas overexpression

It has been recently reported that, in some cases, tumor growth in vivo is partially constrained by IFN-{gamma}-dependent endogenous host responses (24). We speculated that such effects by IFN-{gamma} might be critical for the slower in vivo growth of Fas-overexpressing Renca cells. Therefore, the growth of parental Renca cells and Fas-overexpressing Renca tumor cells was monitored in mouse strains deficient in IFN-{gamma} or IL-12 p40. As shown in Fig. 7Go, the slower in vivo tumor growth of Fas-overexpressing cells that occurs in normal BALB/c mice was not observed in IFN-{gamma}-/- mice, whereas the slower growth of Fas-overexpressing Renca cells observed in wild-type BALB/c mice was also observed in IL-12 p40-/- mice. These results indicate that endogenous production of IFN-{gamma} contributes substantially to the in vivo delay in progression of Fas-overexpressing tumors.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 7. Delay of in vivo tumor progression by Fas overexpression is IFN-{gamma} dependent. Renca tumor cells (1 x 105 cells) were injected s.c. in IFN-{gamma}-/- mice (10 mice/group, A) or IL-12 p40-/- mice (10 mice/group, B). The tumor growth was monitored and quantified as described in Materials and Methods. Data points represent means of the groups (n = 10 mice/group). Tumor size of normal and cytokine-deficient mice were compared via Student’s t test at various time points, and p values are denoted as *, p < 0.05. p values between normal mice vs IFN-{gamma}-/- mice for R1-10 tumor cells at the following time points: day 11 (p = 0.019), day 15 (p = 0.071), day 18 (p = 0.021), and day 22 (p = 0.049).

 
Overexpressed Fas on tumor cells can be a target of T cells

To investigate the mechanism for Fas-mediated delay of in vivo tumor progression, anti-CD3 immunohistochemistry and an analysis of in situ apoptosis were performed from in vivo tumor tissues. As shown in Fig. 8Go, there was a significant increase in both infiltrated CD3+ T cells (p < 0.001) and in vivo apoptosis (p < 0.001) in Fas-overexpressing Renca (R1-17) tumors. In contrast, there was no increase of T cells or apoptosis in DN-Fas-overexpressing tumors (R2-47) as compared with parental Renca tumor cells. To determine whether IFN-{gamma} was contributing to recruitment or postrecruitment events in this model, T cell was examined in wild-type mice and IFN-{gamma}-/- mice. As shown in Fig. 9Go, IFN-{gamma}-deficient T cells were able to infiltrate into the tumor sites in IFN-{gamma}-/- mice to a similar degree as in wild-type mice (p = 0.22), indicating that the IFN-{gamma}-dependent delay in in vivo Fas-overexpressing tumor progression is not simply due to a gross defect in the ability of T cells to infiltrate into tumor sites. Based on increased infiltrated T cells and in vivo apoptosis in Fas-overexpressing tumor-bearing mice, we hypothesized that overexpressed Fas on Renca tumor cells can be a target of FasL-expressing effector cells in vivo. Therefore, we tested whether Fas-overexpressing Renca tumor cells can be killed by anti-CD3-activated T cells. As shown in Fig. 10Go, Fas-overexpressing Renca cells were efficiently killed by T cells, whereas parental Renca and DN-Fas-overexpressing cells were very resistant to T cell-mediated killing. However, subsequent studies demonstrated that anti-CD3-activated T cells also could kill Fas-overexpressing Renca cells (data not shown), suggesting that the lack of tumor growth in IFN-{gamma}-/- mice is not due to some inherent defect in cytotoxic function by these cells. Rather, it suggests that IFN-{gamma} is important for the local activation of newly recruited T cells and/or for some indirect antitumor activity such as macrophage-mediated killing or induction of IFN-{gamma}-dependent antiangiogenic activity.



View larger version (77K):
[in this window]
[in a new window]
 
FIGURE 8. Infiltration of T cells and in vivo apoptosis in Fas-overexpressing Renca tumor tissues. Renca tumor cells (1 x 105 cells) were injected s.c. in BALB/c mice. At day 14 after tumor injection, tumor tissues (three mice per group) were taken for anti-CD3 immunohistochemistry staining (A–G) or analysis of apoptosis (H) as outlined in Materials and Methods. The number of positive cells was counted per high-power (x40) field (HPF) under a light microscope. Data points represent means ± SE.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 9. Infiltration of T cells in wild-type mice and IFN-{gamma}-/- mice. Renca tumor cells (1 x 105 cells) were injected s.c. in BALB/c mice and IFN-{gamma}-/- mice. At day 14 after tumor injection, tumor tissues (three mice per group) were taken for anti-CD3 immunohistochemistry staining as outlined in Materials and Methods. The number of positive cells was counted per high-power (x40) field (HPF) under a light microscope. Data points represent means ± SE.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 10. Fas-dependent killing of Renca tumor cells by T cells. Resting mouse lymph node cells were used as effector cells against various Renca target cells in the presence of an Ab to CD3 at 1 µg/ml to promote cross-linking of the TCR. A20 cells expressing a high level of Fas on the cell surface were also included as a positive control in the cytotoxicity assay as described in Materials and Methods. Data points represent means ± SE of triplicate samples.

 
In vivo administration of anti-Fas Ab induces a high frequency of complete regression of Fas-overexpressing tumors

We demonstrated that overexpression of Fas on Renca tumor cells results in delay of in vivo tumor progression by the endogenous host response (Fig. 4Go). To confirm that overexpression of functional Fas on these cells can actually serve as a specific target for Fas-mediated tumor regression, established Renca tumors were treated in vivo with either isotype control Ab or anti-Fas Ab (Jo2). The expected delay of in vivo tumor progression by Fas overexpression was not changed by isotype control Ab treatment on Fas-overexpressing tumor cells (Fig. 11Go). However, administration of anti-Fas Ab to mice bearing Fas-overexpressing tumors resulted in complete tumor regression in four of five mice after anti-Fas Ab treatment, whereas all mice bearing parental and DN-Fas-overexpressing tumors died of progressive tumor growth. These data demonstrate that overexpression of Fas on tumor cells can preferentially render these cells sensitive to Fas-mediated biological therapy.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 11. Therapeutic effects on Fas-overexpressing Renca cells by in vivo administration of anti-Fas Ab. Renca tumor cells (1 x 105 cells) were injected s.c. into syngeneic BALB/c (five mice per group). At day 7 after tumor injection, anti-Fas Ab (Jo2, 2.5 µg/mice) or control Ab (2.5 µg/mice) was injected peritumorally on days 7, 9, 11, 14, 16, 18, 21, 23, and 25. The mice were then monitored for progressive tumor growth and moribund mice were immediately euthanized. The number of mice free of visible tumor at day 70 per total number injected also is shown.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The importance of apoptosis has been emphasized as a therapeutic mechanism for tumor cell destruction (16, 17, 25). However, the role of Fas on solid tumor cells remains to be elucidated with regard to its role as a target of endogenous immune-mediated effector mechanisms or its practical suitability as a mechanism for enhancing the effects of anticancer therapies. Therefore, we examined the constitutive and inducible expression of Fas and Fas-mediated apoptosis using the Renca renal adenocarcinoma cell line.

The expression of Fas on Renca cells was up-regulated either by IFN-{gamma} or TNF, and a combination of IFN-{gamma} and TNF showed strong synergism for Fas expression (Fig. 1Go, A and B). It has been previously demonstrated that IFN-{gamma} and TNF can be major inducers of Fas expression (8, 9, 10). We also observed a strong synergistic effect of IFN-{gamma} and TNF for Fas up-regulation in a variety of mouse solid tumor cell lines such as 3LL, B16, Colon 26, and M109 (data not shown). In the murine Fas promoter, two transcription factors, NF-{kappa}B and NF-IL-6, have been recently identified for Fas gene transcription (26). It seems likely that the synergistic effects of IFN-{gamma} and TNF for Fas induction may be mediated by synergistic activation of NF-{kappa}B and NF-IL-6. The strong correlation between induction of cell surface Fas expression and Fas mRNA expression by cytokine(s) activation (data not shown) suggests that Fas cell surface expression is regulated at the transcriptional level of Fas gene expression.

Renca cells were resistant to Fas-mediated apoptosis in vitro without cytokine activation. However, treatment of Renca with IFN-{gamma} and TNF synergistically up-regulated the expression of Fas and subsequently induced Fas-mediated apoptosis (Fig. 1GoC). We also noted that several other mouse solid tumor cell lines became sensitive to Fas-mediated apoptosis after up-regulation of Fas expression by IFN-{gamma} and TNF (data not shown). Overexpression of Fas by stable transfection also induced susceptibility to Fas-mediated apoptosis of Renca cells without cytokine treatment (Fig. 2Go), indicating that Renca cells have intact Fas-mediated cell death machinery in place although Renca is inherently resistant to Fas-mediated apoptosis without cytokine activation. Moreover, according to data generated using the RiboQuant RNase protection assays for Renca Fas transfectants treated with agonist anti-Fas Ab (Jo2), expression of apoptosis-related genes (e.g., Caspase-8, FasL, FADD, FAF, RIP, TRAIL, Bcl-2 family) was not changed during the Fas-mediated apoptosis process (data not shown), suggesting that the transmission of the Fas-mediated death signal in Renca cells occurs without new transcriptional induction of known apoptosis-related genes. Fas-mediated apoptosis may also occur in the absence of de novo RNA or protein synthesis as demonstrated in TNF-induced apoptosis (27). Therefore, it is most likely that the level of cell surface Fas expression is the critical parameter for Fas-mediated apoptosis for some solid tumors as opposed to some regulatory events downstream of Fas receptor ligation.

It has been previously demonstrated that Fas expressed on Renca cells is an effective target for Renca tumor cell killing by anti-Fas Ab (Jo2) cross-linking or activated T cells (23), and FasL gene therapy inhibited Renca tumor growth in vivo by inducing cell death (28). Our results suggest that the delay of in vivo tumor growth with reduced metastasis by Fas overexpression on Renca cells is likely mediated by the interaction of Fas with FasL, which is usually expressed on activated T cells (primarily CD8+), and NK cells. Therefore, the infiltration of CD8+ T cells and/or NK cells into tumor sites and subsequent activation of the infiltrated cells for more FasL expression or the local production of soluble FasL may be critical for the induction of Fas-mediated killing of Fas-expressing tumor cells, and such effects may well be enhanced when levels of cell surface Fas are increased on the tumor. This suggestion is supported by studies that confirmed by immunohistochemistry a significant increase of T cells and apoptosis in Fas-overexpressing tumors, when compared with parental Renca and DN-Fas-overexpressing tumors. In addition, Fas-overexpressing Renca cells were efficiently killed in vitro by T cells. These data demonstrate that overexpressed Fas on tumor cells can be a target of T cells in vivo. However, the mechanism for increase of infiltrated T cells and in vivo apoptosis in Fas-overexpressing tumor sites remains to be elucidated. It is also possible that induction of apoptosis may contribute to further recruitment of T cells into tumor sites through the release of cell debris, phagocytosis, and subsequent production of inflammatory or chemotactic mediators in the tumor microenvironment.

As shown in this report, delay of in vivo tumor progression with reduced metastasis as a consequence of Fas overexpression suggests that endogenous immune responses can limit tumor growth via Fas-dependent mechanisms. In particular, overexpression of functional Fas, but not nonfunctional Fas, on Renca resulted in a delay of in vivo tumor growth in normal BALB/c mice (Fig. 4Go), but this growth delay was not evident in IFN-{gamma}-/- mice (Fig. 7Go), indicating that endogenous IFN-{gamma} gene expression is required for the delay of in vivo tumor growth. This result is consistent with a previous study (24) demonstrating that endogenously produced IFN-{gamma} is crucial for the tumor surveillance system. The role of IFN-{gamma} cannot be simply explained by differences in requirement for IFN-{gamma} as a growth factor since the in vitro growth of various transfectants is unaltered by the presence of IFN-{gamma} (data not shown). It has been reported that IFN-{gamma} up-regulates not only Fas but also FasL expression (29, 30), and in vivo neutralization of IFN-{gamma} protein significantly reduced expression of FasL on CD4+ and CD8+ T cells (30). Therefore, it is possible that up-regulation of host FasL expression is also defective in IFN-{gamma}-/- mice, thereby further contributing to the lack of a delay of in vivo tumor growth in IFN-{gamma}-/- mice.

To determine the role of IFN-{gamma} in delay of in vivo tumor progression by Fas overexpression, T cell infiltration was examined in wild-type mice and IFN-{gamma}-/- mice. As shown in Fig. 9Go, T cells were also able to infiltrate into tumor sites in IFN-{gamma}-deficient mice to a similar extent as in wild-type mice (p = 0.22), indicating that the IFN-{gamma}-dependent delay in in vivo Fas-overexpressing tumor growth is not likely due to a defect in the ability of T cells to infiltrate into tumor sites. Therefore, this result suggests that IFN-{gamma} may play some role at the postrecruitment phase in this model. However, since T cells isolated from IFN-{gamma}-deficient mice could be activated by anti-CD3 to show a similar level of lytic activity against Fas-overexpressing Renca tumor cells as wild-type T cells (data not shown), it is likely that the role of IFN-{gamma} in the delay of progression by Fas-overexpressing tumor cells may be at the T cell activation stage or be indirect. There are several possibilities for this type of mechanism including a local requirement for IFN-{gamma} to activate recruited T cells or some contribution via activation of tumor-associated macrophages by IFN-{gamma} (31), or the local induction of IFN-{gamma}-dependent antiangiogenic (32) or apoptotic factors.

Finally, it is important to note that Renca cells transfected with an inactive, truncated Fas (DN-Fas), as well as Renca cells transfected with control vectors, do not exhibit the reduced rate of in vivo tumor growth shown by Renca cells transfected with functional Fas. Furthermore, in vivo administration of anti-Fas Ab demonstrated an additional strong anti-tumor therapeutic effect on Fas-overexpressing tumor cells, suggesting that endogenous and exogenous manipulation of Fas-FasL interactions can be used as a means of inducing tumor regression in vivo. These results support the conclusion that the decreased in vivo growth of Fas transfectants is specifically related to Fas expression and is not due to some anomaly of the transfection process. These results also suggest that the strategies directed at preferential induction of death receptors on tumor cells and appropriate delivery of ligands for the Fas death receptor may contribute to, or enhance, some forms of biological therapy of cancer.


    Acknowledgments
 
We thank Dr. John Ortaldo for his careful review of this manuscript, Dr. S. Nagata for providing the murine FasL cDNA, Charles Riggs for statistical analysis of survival data, and Eilene Gruys for helping with in vitro tumor cell proliferation experiments.


    Footnotes
 
1 This project has been funded in whole or in part with federal funds from the National Cancer Institute, National Institutes of Health, under Contract N01-CO-56000. Back

2 The content of this publication does not necessarily reflect the views or policies of the Department of Health and Human Services, nor does mention of trade names, commercial products, or organizations imply endorsement by the U.S. government. The publisher or recipient acknowledges right of the U.S. government to retain a nonexclusive, royalty-free license in and to any copying covering the article. Back

3 Address correspondence and reprint requests to Dr. Robert H. Wiltrout, Experimental Therapeutics Section, Laboratory of Experimental Immunology, Division of Basic Sciences, National Cancer Institute-Frederick Cancer Research and Development Center, Building 560, Room 31-93, Frederick, MD 21702-1201. E-mail address: Back

4 Abbreviations used in this paper: FasL, Fas ligand; DN, dominant-negative; MFI, mean fluorescence intensity. Back

Received for publication December 22, 1998. Accepted for publication October 18, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Nagata, S. Apoptosis by death factor.. 1997. Cell 88:355.[Medline]
  2. Nagata, S., P. Golstein. 1995. The Fas death factor. Science 267:1449.[Abstract/Free Full Text]
  3. Nagata, S., T. Suda. 1995. Fas and Fas ligand: lpr and gld mutations. Immunol. Today 16:39.[Medline]
  4. Cohen, P. L., R. A. Eisenberg. 1991. Lpr and gld: single gene models of systemic autoimmunity and lymphoproliferative disease. Annu. Rev. Immunol. 9:243.[Medline]
  5. Adachi, M., S. Suematsu, T. Kondo, J. Ogasawara, T. Tanaka, N. Yoshida, S. Nagata. 1995. Targeted mutation in the Fas gene causes hyperplasia in peripheral lymphoid organs and liver. Nat. Genet. 11:294.[Medline]
  6. Giorfano, C., G. Stassi, R. D. Maria, M. Todaro, P. Richiusa, G. Papoff, G. Ruberti, M. Bagnasco, R. Testi, A. Galluzzo. 1997. Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto’s thyroiditis. Science 275:960.[Abstract/Free Full Text]
  7. Ogasawara, J., F. R. Watanabe, M. Adachi, A. Matsuzawa, T. Kasugai, Y. Kitamura, N. Itoh, T. Suda, and S. Nagata. Lethal effect of the anti-Fas antibody in mice. Nature 364:806.
  8. Watanabe-Fukunaga, R., C. I. Brannan, N. Itoh, S. Yonehara, N. G. Copeland, N. A. Jenkins, S. Nagata. 1992. The cDNA structure, expression, and chromosomal assignment of the mouse Fas antigen. J. Immunol. 148:1274.[Abstract]
  9. Weller, M., K. Frei, P. Groscurth, P. H. Kran, Y. Yon, A. Fontana. 1994. Anti-Fas/APO-1 antibody-mediated apoptosis of cultured human glioma cells: induction and modulation of sensitivity by cytokines. J. Clin. Invest. 94:954.
  10. Fellenberg, J., H. Mau, C. Scheuerpflug, V. Ewerbeck, K.-M. Debatin. 1997. Modulation of resistance to anti-APO-1-induced apoptosis in osteosarcoma cells by cytokines. Int. J. Cancer 72:536.[Medline]
  11. Suda, T., T. Okazaki, Y. Naito, T. Yokota, N. Arai, S. Ozaki, K. Nakao, S. Nagata. 1995. Expression of the Fas ligand in cells of T cell lineage. J. Immunol. 154:3806.[Abstract]
  12. Ferguson, T. A., and T. S. Griffith. A vision of cell death: insights into immune privilege. Immunol. Rev. 156:167.
  13. Walker, P. R., P. Saas, P.-Y. Dietrich. 1997. Role of Fas ligand (CD95L) in immune escape: the tumor cell strikes back. J. Immunol. 158:4521.[Abstract]
  14. O’Connell, J., G. C. O’Sullivan, J. K. Collins, F. Shanahan. 1996. The Fas counterattack: Fas-mediated T cell killing by colon cancer cells expressing Fas ligand. J. Exp. Med. 184:1075.[Abstract/Free Full Text]
  15. Zeytun, A., M. Hassuneh, M. Nagarkatti, P. S. Nagarkatti. 1997. Fas-Fas ligand-based interactions between tumor cells and tumor-specific cytotoxic T lymphocytes: a lethal two-way street. Blood 90:1952.[Abstract/Free Full Text]
  16. Trauth, B. C., C. Klas, A. M. J. Peters, S. Matzku, P. Moller, W. Falk, K.-M. Debatin, P. H. Krammer. 1989. Monoclonal antibody-mediated tumor regression by induction of apoptosis. Science 245:301.[Abstract/Free Full Text]
  17. Yoshida, Y., N. Anzai, H. Kawabata. 1996. Apoptosis in normal and neoplastic hematopoiesis. Crit. Rev. Oncol. Hematol. 24:185.[Medline]
  18. Westendorf, J. J., J. M. Lammert, D. F. Jelinek. 1995. Expression and function of Fas (APO-1/CD95) in patient myeloma cells and myeloma cell lines. Blood 85:3566.[Abstract/Free Full Text]
  19. Dirks, W., S. Schone, C. Uphoff, H. Quentmeier, S. Pradella, H. G. Drexler. 1997. Expression and function of CD95 (Fas/APO-1) in leukaemia-lymphoma tumor lines. J. Haematol. 96:584.
  20. Karawajew, L., C. Wuchter, V. Ruppert, H. Drexler, H.-J. Gruss, B. Dorken, W.-D. Ludwig. 1997. Differential CD95 expression and function in T and B lineage acute lymphoblastic leukemia cells. Leukemia 11:1245.[Medline]
  21. Wigginton, J. M., K. L. Komschlies, T. C. Back, J. L. Franco, M. J. Brunda, R. H. Wiltrout. 1996. Administration of interleukin 12 with pulse interleukin 2 and the rapid and complete eradication of murine renal carcinoma. J. Natl. Cancer Inst. 88:38.[Abstract/Free Full Text]
  22. Wiltrout, R. H., D. Taramelli, H. T. Holden. 1981. Measurement of macrophage-mediated cytotoxicity against adherent and non-adherent target cells by release of 111Indium-oxine. J. Immunol. Methods 43:319.[Medline]
  23. Sayers, T. J., A. D. Brooks, J.-K. Lee, R. G. Fenton, K. L. Komschlies, J. M. Wigginton, R. Winkler-Pickett, R. H. Wiltrout. 1998. Molecular mechanisms of immune-mediated lysis of murine renal cancer: differential contribution of perforin-dependent versus Fas-mediated pathways in lysis by NK and T cells. J. Immunol. 161:3957.[Abstract/Free Full Text]
  24. Kaplan, D. H., V. Shankaran, A. S. Dighe, E. Stockert, M. Aguet, L. J. Old, R. D. Schreiber. 1998. Demonstration of an interferon {gamma}-dependent tumor surveillance system in immunocompetent mice. Proc. Natl. Acad. Sci. USA 95:7556.[Abstract/Free Full Text]
  25. Thompson, C. B.. 1995. Apoptosis in the pathogenesis and treatment of disease. Science 267:1456.[Abstract/Free Full Text]
  26. Kimura, K., K. Asami, M. Yamamoto. 1997. Structure of the promoter for the rat Fas antigen gene. Biochim. Biophys. Acta 1352:238.[Medline]
  27. Rubin, B. Y., L. J. Smith, G. R. Hellermann, R. M. Lunn, N. K. Richardson, S. L. Anderson. 1988. Correlation between the anticellular and DNA fragmenting activities of tumor necrosis factor. Cancer Res. 48:6006.[Abstract/Free Full Text]
  28. Arai, H., D. Gordon, E. G. Nabel, G. J. Nabel. 1997. Gene transfer of Fas ligand induces tumor regression in vivo. Proc. Natl. Acad. Sci. USA 94:13862.[Abstract/Free Full Text]
  29. Xu, X., X.-Y. Fu, J. Plate, A. S.-F. Chong. 1998. IFN-{gamma} induces cell growth inhibition by Fas-mediated apoptosis: requirement of STAT1 protein for up-regulation of Fas and FasL expression. Cancer Res. 58:2832.[Abstract/Free Full Text]
  30. Shustov, A., P. Nguyen, F. Finkelman, K. B. Elkon, C. S. Via. 1998. Differential expression of Fas and Fas ligand in acute and chronic graft-versus-host disease: up-regulation of Fas and Fas ligand requires CD8+ T cell activation and IFN-{gamma} production. J. Immunol. 161:2848.[Abstract/Free Full Text]
  31. Bartholeyns, J., M. Lopez. 1994. Immune control of neoplasia by adoptive transfer of macrophages: potentiality for antigen presentation and gene transfer. Anticancer Res. 14:2673.[Medline]
  32. Horton, M. R., C. M. McKee, C. Bao, F. Liao, J. M. Farber, J. Hodge-DuFour, E. Pure, B. L. Oliver, T. M. Wright, P.W. Noble. 1998. Hyaluronan fragments synergize with interferon-{gamma} to induce the C-X-C chemokines Mig and interferon-inducible protein-10 in mouse macrophages. J. Biol. Chem. 273:35088.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
Cancer Res.Home page
K. M. Greeneltch, M. Schneider, S. M. Steinberg, D. J. Liewehr, T. J. Stewart, K. Liu, and S. I. Abrams
Host Immunosurveillance Controls Tumor Growth via IFN Regulatory Factor-8 Dependent Mechanisms
Cancer Res., November 1, 2007; 67(21): 10406 - 10416.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
N. V. Koshkina, C. Khanna, A. Mendoza, H. Guan, L. DeLauter, and E. S. Kleinerman
Fas-Negative Osteosarcoma Tumor Cells Are Selected during Metastasis to the Lungs: The Role of the Fas Pathway in the Metastatic Process of Osteosarcoma
Mol. Cancer Res., October 1, 2007; 5(10): 991 - 999.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. Zhu, M. Waguespack, S. A. Barker, and S. Li
Doxorubicin Directs the Accumulation of Interleukin-12 Induced IFN{gamma} into Tumors for Enhancing STAT1 Dependent Antitumor Effect
Clin. Cancer Res., July 15, 2007; 13(14): 4252 - 4260.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. N. Torrero, X. Xia, W. Henk, S. Yu, and S. Li
Stat1 deficiency in the host enhances interleukin-12-mediated tumor regression.
Cancer Res., April 15, 2006; 66(8): 4461 - 4467.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Liu, S. A. Caldwell, K. M. Greeneltch, D. Yang, and S. I. Abrams
CTL Adoptive Immunotherapy Concurrently Mediates Tumor Regression and Tumor Escape
J. Immunol., March 15, 2006; 176(6): 3374 - 3382.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Liu, S. A. Caldwell, and S. I. Abrams
Immune Selection and Emergence of Aggressive Tumor Variants as Negative Consequences of Fas-Mediated Cytotoxicity and Altered IFN-{gamma}-Regulated Gene Expression
Cancer Res., May 15, 2005; 65(10): 4376 - 4388.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. Liu, S. A. Caldwell, and S. I. Abrams
Cooperative Disengagement of Fas and Intercellular Adhesion Molecule-1 Function in Neoplastic Cells Confers Enhanced Colonization Efficiency
Cancer Res., February 1, 2005; 65(3): 1045 - 1054.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
A. Papageorgiou, L. Lashinger, R. Millikan, H. B. Grossman, W. Benedict, C. P. N. Dinney, and D. J. McConkey
Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Interferon-Induced Apoptosis in Human Bladder Cancer Cells
Cancer Res., December 15, 2004; 64(24): 8973 - 8979.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Puliaev, P. Nguyen, F. D. Finkelman, and C. S. Via
Differential Requirement for IFN-{gamma} in CTL Maturation in Acute Murine Graft-versus-Host Disease
J. Immunol., July 15, 2004; 173(2): 910 - 919.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. Chakraborty, S. I. Abrams, C. N. Coleman, K. Camphausen, J. Schlom, and J. W. Hodge
External Beam Radiation of Tumors Alters Phenotype of Tumor Cells to Render Them Susceptible to Vaccine-Mediated T-Cell Killing
Cancer Res., June 15, 2004; 64(12): 4328 - 4337.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
M. A. Sheard, S. Uldrijan, and B. Vojtesek
Role of p53 in Regulating Constitutive and X-Radiation-Inducible CD95 Expression and Function in Carcinoma Cells
Cancer Res., November 1, 2003; 63(21): 7176 - 7184.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. A. Caldwell, M. H. Ryan, E. McDuffie, and S. I. Abrams
The Fas/Fas Ligand Pathway Is Important for Optimal Tumor Regression in a Mouse Model of CTL Adoptive Immunotherapy of Experimental CMS4 Lung Metastases
J. Immunol., September 1, 2003; 171(5): 2402 - 2412.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Liu and S. I. Abrams
Coordinate Regulation of IFN Consensus Sequence-Binding Protein and Caspase-1 in the Sensitization of Human Colon Carcinoma Cells to Fas-Mediated Apoptosis by IFN-{gamma}
J. Immunol., June 15, 2003; 170(12): 6329 - 6337.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
N. Seki, Y. Hayakawa, A. D. Brooks, J. Wine, R. H. Wiltrout, H. Yagita, J. E. Tanner, M. J. Smyth, and T. J. Sayers
Tumor Necrosis Factor-related Apoptosis-inducing Ligand-mediated Apoptosis Is an Important Endogenous Mechanism for Resistance to Liver Metastases in Murine Renal Cancer
Cancer Res., January 1, 2003; 63(1): 207 - 213.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Seki, A. D. Brooks, C. R. D. Carter, T. C. Back, E. M. Parsoneault, M. J. Smyth, R. H. Wiltrout, and T. J. Sayers
Tumor-Specific CTL Kill Murine Renal Cancer Cells Using Both Perforin and Fas Ligand-Mediated Lysis In Vitro, But Cause Tumor Regression In Vivo in the Absence of Perforin
J. Immunol., April 1, 2002; 168(7): 3484 - 3492.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. K. Helmich and R. W. Dutton
The Role of Adoptively Transferred CD8 T Cells and Host Cells in the Control of the Growth of the EG7 Thymoma: Factors That Determine the Relative Effectiveness and Homing Properties of Tc1 and Tc2 Effectors
J. Immunol., June 1, 2001; 166(11): 6500 - 6508.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. A. Lafleur, S.-F. Jia, L. L. Worth, Z. Zhou, L. B. Owen-Schaub, and E. S. Kleinerman
Interleukin (IL)-12 and IL-12 Gene Transfer Up-Regulate Fas Expression in Human Osteosarcoma and Breast Cancer Cells
Cancer Res., May 1, 2001; 61(10): 4066 - 4071.
[Abstract] [Full Text]


Home page
BloodHome page
S. E. A. Street, E. Cretney, and M. J. Smyth
Perforin and interferon-{gamma} activities independently control tumor initiation, growth, and metastasis
Blood, January 1, 2001; 97(1): 192 - 197.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
T. J. Sayers, A. D. Brooks, N. Seki, M. J. Smyth, H. Yagita, B. R. Blazar, and A. M. Malyguine
T cell lysis of murine renal cancer: multiple signaling pathways for cell death via Fas
J. Leukoc. Biol., July 1, 2000; 68(1): 81 - 86.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, J.-K.
Right arrow Articles by Wiltrout, R. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, J.-K.
Right arrow Articles by Wiltrout, R. H.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS