| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom;
Clinical Research Institute of Montreal, Montreal, Quebec, Canada; and
Institute of Cell Animal and Population Biology, University of Edinburgh, Ashworth Laboratories, Edinburgh, United Kingdom
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
was found. The expression of these messages was
accelerated by 2 days in the presence of IL-12. The relevance of these
observations to T cell differentiation was investigated: addition of
OVA peptide to splenic cells from DO.11.10 transgenic mice causes most
T cells to make IFN-
. Coactivation of B cells in these cultures
reduces the number of IFN--producing T cells and increases the
number synthesizing IL-4. Abs to IL-6 and IL-10 block the IL-4
enhancement. Dissection of the component APC demonstrated that
interaction of B cells with IL-12-producing dendritic cells is crucial
for B cell-mediated IL-4 enhancement: Thus, B cells preactivated in the
presence of dendritic cells from IL-12-/- mice show
little IL-4-inducing activity when used to activate T cells. This
immune regulation is initiated by IL-12 and therefore represents a
feedback loop to temper its own dominant effect (IFN-
induction). |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
. In contrast, many helminth infections cause
a predominantly Th2 response to develop, with T cells secreting IL-4,
IL-5, and IL-13, among other cytokines (1, 2, 3). It would be
disadvantageous, however, for a response to be completely polarized to
Th1 or Th2. This is particularly true of a Th1 response that, if
unchecked, would lead to damaging immunopathology (4); it
is the Th2 cytokines, such as IL-10, that down-regulate the Th1
response by shutting down IL-12 production (5, 6, 7). It is
also true that there are components of protective immunity to viruses
that require input from Th2 cells; for instance, high-level production
of neutralizing Abs both systemically and, in particular, at mucosal
surfaces (8). Similarly, IFN- is a crucial switch
factor for certain Ab isotypes (9). Thus, most immune
responses benefit from the development of a "balance" between Th1
and Th2 subsets. The programming of T cell differentiation into these subsets is influenced by a number of factors, including the local cytokine environment, concentration of Ag, the type of costimulation, and the genetic background of the animal (1, 2, 3). It is also clear that the type of APC plays a critical role: dendritic cells (DC)3 preferentially evoke a Th1 response as a result of IL-12 production by these cells (10, 11), whereas B cells engender development of the Th2 subset (12, 13, 14, 15). By analogy with DC, we surmised that the B cell mediator of Th2 development might be a cytokine. Indeed, B cells are known to make IL-6 and IL-10, both of which influence Th2 development (5, 7, 16, 17). Although B cells are reported to synthesize these and other cytokines, the data are anecdotal and mostly derived from B cell lymphomas or cell lines (18) and do not relate to the situation in vivo during the early part of an immune response. For this reason we embarked on a systematic survey of cytokine RNA expression in normal, resting, naive mouse B cells and in those stimulated via the B cell receptor and CD40 (to mimic the first two signals that impinge upon the cell during a T cell dependent immune response).
It is important in investigating this question to keep in mind the microenvironment of early B cell activation. The work of MacLennan (19) and Kelsoe (20) has shown that the first sites of B cell proliferation and hence, presumably T-B cell interaction, occur within T zones of secondary lymphoid organs. These foci also include interdigitating DC that are the initiators of T cell activation. It is now becoming clear that DC may also influence B cell activation and differentiation (21, 22, 23). For this reason, we investigated the effect DC and IL-12 (a major product of CD40- activated DC) on cytokine production by B cells and on ability of B cells to engender Th2 development in TCR transgenic (Tg) T cells (17). Our results show that the production of cytokines by B cells that inhibit Th1 development (IL-10) and induce Th2 development (IL-6) is considerably enhanced in the presence of IL-12. We find that IL-12 production by DC is necessary for the IL-4-inducing capacity of B cells when used as APCs to DO.11.10 TCR Tg T cells (H2Ad-restricted anti-OVA) (17). This suggests that as well as driving Th1 development, IL-12 initiates a negative feedback loop via B cells that shuts down its own synthesis and enhances IL-4 production.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CD40-/- mice were derived in Osaka, Japan as described previously (24) and were generously supplied to us by Dr. Hitoshi Kikutani (Research Institute for Microbial Diseases, University of Osaka, Osaka, Japan). CD40-/- mice were maintained by homozygous breeding and were a third generation backcross to C57BL/6. C57BL/6 mice (Harlan-Olac, Bicester, U.K.) were used as wild-type (+/+) controls. DO11.10 TCR Tg mice (H2Ad-restricted, OVA peptide 323–339-specific) (25) were kindly given to us by Dr. Hans Reiser (Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, London, U.K.) who also provided IL-12-/- mice (26). BALB/c mice (Harlan-Olac) were used as a source of APC in experiments with DO11.10 T cells. All mice were bred and maintained under standard laboratory conditions in the Biological Services Unit of the Imperial College School of Medicine, and were used in experiments at 8–16 wk of age.
Antibodies
The mAbs used were T24 (anti-Thy1), 145-2C11 (anti-CD3),
N418 (anti-CD11c), I45.2 (anti-CD44), 16A (anti-CD45RB),
S4B6 (anti-IL-2), 11B11 (anti-IL-4), AN18 (anti-IFN-),
R4-6A2 (anti-IFN-), M5114 (anti-MHC class II), 53-6.7.2
(anti-CD8), and 187.1 (anti-
); the sources of these commonly
used Abs are listed in Ref. 30 . The 37.N.51.1 mAb
(anti-CD28) was a kind gift of Dr. J. Allison (University of
California, Berkeley, CA), and FGK-45 (anti-CD40; Ref.
27) was given to us by Dr. A. Rolink (Basel Institute for
Immunology, Basel, Switzerland). We are grateful to Dr. A. O’Garra
(DNAX, Palo Alto, CA) for providing the Abs to IL-6 (20F3 and 32C11)
and IL-10 (SXC-1 and SXC-2). For use in FACS staining or
magnetic-activated cell sorting (MACS) purification, some Abs were
either fluoresceinated or biotinylated. PE-labeled streptavidin was
purchased from Southern Biotechnology Associates (Birmingham,
AL).
Cell preparations
Spleens were harvested from mice and cell suspensions made by
pressing the spleen between two squares of nylon gauze, followed by
passage through a 25-gauge needle. CD4+ T cells
were obtained from the spleens by magnetic depletion of MHC class
II+, IgM+, and
CD8+ cells (MACS; Miltenyi Biotech, Bergisch
Gladbach, Germany). Further purification of resting/naive
CD4+ T cells on the basis of levels of CD44
expression was also conducted by MACS depletion of
CD44high cells. B cells were purified from
spleens using CD43 microbeads followed by separation on a MACS column.
Mature mouse B cells are CD43-, whereas all
other hemopoietic cells are CD43+, and hence a
single passage through the MACS column yielded a B cell population that
was 98.5–99.5% pure. For preparation of high-density, resting B
cells, the CD43- cells were loaded onto Percoll
gradients as described previously (28) and the
1.079–1.085 g/ml interface harvested. DC were purified from spleens as
described previously (29). Briefly, this involved
dispersion of spleens using enzymes (collagenase and DNase), separation
on a Percoll gradient, and two adhesion steps (of 90 min and
overnight). Nonadherent DC were harvested. Contaminating B cells and T
cells were depleted with goat anti-rat IgG Dynabeads after
incubation with anti- (187.1) and anti-Thy1 (T24).
Stimulation cultures
Cell cultures were established in IMDM supplemented with 5%
FCS, 2 mM L-glutamine (Life Technologies, Rockville, MD),
50 mM 2-ME, and penicillin-streptomycin (50 mg/ml). The cultures were
maintained at 37°C in a humidified 5% CO2
atmosphere. For analysis of T cell activation, wild-type or
CD40-/--sorted splenic T cell cultures (2
x 105 to 5 x 105
cells/well) were plated in anti-CD3-coated microwells (0.1 µg/ml)
in the presence of anti-CD28. Stimulation of T cells for FACS
analysis was conducted in 48-well plates (Costar, Cambridge, MA) at
106 cells per well. B cells were stimulated by
addition of anti- (187.1; 5 µg/ml) with or without
anti-CD40 (FGK-45; 10 µg/ml). DO11.10 splenic and T cell cultures
were stimulated in the presence of OVA323–339 (0.1 µg/ml).
Stimulation of DC was by addition of anti-CD40 (10 µg/ml).
Blocking Abs to IL-6 (20F3 and 32C11) and to IL-10 (SXC-1 and SXC-2)
were used at 20 µg/ml. B cell-conditioned supernatant was obtained
from activated B cell cultures after 4 days. For restimulation of
splenic and T cell cultures, cells were cultured for 3–5 days, washed
twice, and recultured under exactly the same conditions for 2–3 days.
Cytokines were purchased from R&D Systems (Abingdon, U.K.) and were
used at the following concentrations in cultures: IL-6 at 15 ng/ml,
IL-10 at 15 ng/ml, and IL-12 at 20 ng/ml. B cell proliferation assays
were set up in flat-bottom 96-well plates; DNA synthesis was measured
over the period of 64–72 h by addition of
[3H]thymidine (1 µCi/well).
Measurement of cytokine release
The presence of cytokines in day 3 culture supernatant was
detected as follows. IL-4 production was measured using the CT4S cell
line in the presence of anti-IL-2 mAb as described previously
(30). [3H]Thymidine was added to
the CT4S cells at a time when the negative control wells exhibited
significant cell mortality (normally after 24–36 h); plates were
harvested for counting after 8 h. Proliferation of the CT4S cells
could be completely blocked in the presence of anti-IL-2 and
anti-IL-4. Supernatant from the X63-Ag8-mIL-4 cell line
(31) was used as a source of IL-4. IFN- secretion was
measured by ELISA using two anti-IFN- mAbs (R4–6A2 and AN18),
the second biotinylated to allow detection with streptavidin-alkaline
phosphatase (Southern Biotechnology Associates). Supernatants from
activated horse myoglobin-reactive Th1 clone (11.3.7; Ref.
32) or from the X63-Ag8-mIL-4 cell line containing known
amounts of IFN- and IL-4 were used as standards (quantified using
recombinant cytokines purchased from R&D Systems).
Detection of cytokine message
RNA was made from the same number of cells in comparable cultures. Cell pellets (106 cells) were vortex mixed in 0.5 ml RNAzol B (RNA isolation solvent; AMS Biotechnology, Oxon, U.K.) or equivalent for fewer cells. Chloroform/isoamylalcholol (0.1 vol, 24:1) was added and the tubes thoroughly vortex mixed and left on ice for 15 min. Samples were centrifuged at 15,000 rpm for 10 min, and the upper phase was transferred to a fresh tube to which an equal volume of isopropanol was added. These were stored at -80°C for at least 20 min. Samples were centrifuged for 25 min at 15,000 rpm and washed in 1 ml (or equivalent for fewer cells) 75% ethanol. Pellets were resuspended in 100 µl H2O (or equivalent for fewer cells). RNA was stored at -80°C. cDNA was made using a Promega reverse transcription kit (Promega, Madison, WI) containing all the reagents for synthesis of single-stranded cDNA.
As an internal control for the cytokine RT-PCR, we used the pMus3
construct contained in a pTZ plasmid kindly provided by Dr. David Shire
(Sanofi Recherche, Labège, France) (33). The primers
used for PCR amplification were:
ß2-microglobulin, 5'-TGACCGGCTTGTATGCTATC and
3'-CAGTGTGAGCCAGGATATAG; IL-12 p35, 5'-GATCATGAAGACATCACACGG and
3'- AGAATGATCTGCTGATGGTTG; IL-12 p40, 5'-CAGTACACCTGCCACAAAGGA and
3'-GTGTGACCTTCTCTGCAGACA; for IL-6, 5'- GTTCTCTGGGAAATCGTGGA and
3'- TGTACTCCAGGTAGCTATGG; IL-10, 5'- ATGCAGGACTTTAAGGGTTACTTG and
3'- TAGACACCTTGGTCTTGGAGCTTA; TNF-, 5'- TCTCATCAGTTCTATGGCCC and
3'-GGGAGTAGACAAGGTACAAC. RT-PCR as a template was used to amplify
cDNA encoding cytokines. Buffers required were supplied with the
Taq polymerase (Promega). Three microliters of cDNA was
added to 5 µl 10x Taq polymerase buffer, 5 µl 1 mM dNTP
(Promega), and 1 µl primer (300 ng/µl), and 36.5 µl
H2O added. This was overlayed with 3 drops of
mineral oil. The PCRs were performed in 0.5-ml tubes in a Touch Down
thermal cycler (Hybaid, Ashford, Middlelesex, U.K.). An initial
denaturation step of 5 min at 94°C was conducted before addition of
0.5 µl Taq polymerase. This was followed by 33 cycles of
60 s at 94°C, 60 s at annealing temperture (65°C for
IL-12 p40 and 60°C for all other cytokines), and 60 s at 72°C.
This was followed by a final elongation step of 10 min at 72°C. The
PCR product was separated on a 2.5% agarose gel containing ethidium
bromide and photographed.
Intracellular cytokine staining.
At the appropriate time points cultured cells were harvested and
washed. Before staining cells were stimulated with PMA (10 ng/ml;
Sigma-Aldrich, Poole, U.K.) and ionomycin (1 µg/ml; Sigma) in the
presence Golgi Stop according to the manufacturer’s protocol
(Cytofix/Cytoperm Plus cytostain kit; PharMingen, San Diego, CA) for
5 h such that cytokine accumulated in the cytoplasm. The cells
were stained with T24-FITC (anti-Thy1.2) and then fixed and
permeabilized according to the manufacturer’s protocol for the
cytostain kit. Cells were then stained with biotinylated
anti-IFN- (clone XMG1.2) and anti-IL-4-PE (clone 11B11)
(both from PharMingen) at a final concentration of 1/100. After
washing, the cells were stained with streptavidin-quantum red
(Sigma-Aldrich) at a final concentration of 1/200. For each sample,
10,000 gated cells were analyzed using a FACSCaliber (Becton Dickinson,
Mountain View, CA) and CellQuest software. Final percentages of
intracellular cytokine staining were recorded from T24
(anti-Thy1)-FITC gated populations. The statistical significance of
observed differences was analyzed using Student’s t
test.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Given our previous observations on the influence of B cells on the generation of Th2 cells (12), we investigated whether this capacity was related to their expression of CD40. CD44loCD4+ T cells from C57BL/6 mice were stimulated with anti-CD3 in the presence of DC or B cells from either wild-type or CD40-/- mice. The DC were grown from bone marrow in cultures containing GM-CSF (34), whereas B cells were prepared from the spleen. Because CD40 signals may augment the costimulatory capacity of B cells, we not only activated the B cells with anti-Ig to up-regulate B7 molecules, but also added anti-CD28 to these cultures.
Fig. 1
shows the results of this
experiment. In cocultures with DC, the anti-CD3-activated T cells
made no IL-4, however, they did produce significant amounts of IFN-,
even in the absence of CD40 on the DC. When activated
(CD40+) B cells were used as APC, IL-4 was
readily detectable, with a concomitant reduction in IFN- secretion.
However, B cells from CD40-/- mice did not have
the capacity to stimulate IL-4 production. It is important to point out
that the low concentration of anti-CD3 used in these cultures (0.1
µg/ml) is one at which, in our hands using anti-CD3 coated onto
plastic (together with anti-CD28) in the absence of any APC, never
gives rise to IL-4 (30); IL-4 can only be elicited at
anti-CD3 concentrations that are 100-fold higher. Thus
CD40+ B cells skew the response in the Th2
direction under conditions that would normally lead to Th1
development.
|
The potency of the IL-4-inducing effect suggested to us that, in a manner analogous to DC, IL-12, and Th1 cells, B cells might produce a mediator upon CD40 ligation that drives Th2 differentiation. Obvious candidates for this role would be cytokines, and so we conducted a systematic survey of cytokine mRNAs expressed in naive, resting B cells before and after stimuli that we expected them to receive during a T cell-dependent response, namely, anti-Ig and anti-CD40 (mimicking Ag and CD40 ligand). All previous data relating to cytokine expression by B cells has derived from ill-defined activated populations, cell lines, or tumors; in this study we felt it was important to address B cell cytokine production in the context, as far as possible, of a primary immune response.
We also took great pains to deplete our Percoll high-density, resting B
cells preparations of DC by passage over anti-CD11c MACS columns.
On day 3 the cultures were stained for MHC class II and CD11c for FACS
analysis and no DC were found (data not shown). In addition, the
absence of IL-12 p40 message was an indicator that the cultures were
free of contaminating DC (Fig. 2). The
quality of the RNA preparations was assessed by
ß2-microglobulin message. Cytokine message was
assessed at day 0 (prestimulation) and subsequently on days 2, 3, and 4
poststimulation (Fig. 2).
|
), and there appears to be no up-regulation
of either of these mRNAs following activation. Only three other
cytokines were detectable: IL-6, IL-10, and TNF-. All three were
inducible from undetectable baseline levels following anti-Ig +
anti-CD40 activation. The kinetics of RNA synthesis after
stimulation were different, with the IL-6 and IL-10 messages relatively
slow to appear (detectable routinely only by day 4), whereas the
TNF- message was present by day 2 or earlier. We also tested for
IL-2, IL-4, IL-5, IL-9, and IL-13 and no message was observed at any
time after activation (data not shown). IL-12 enhances B cell cytokine production
The first sites of B cell proliferation are the T zones of
secondary lymphoid tissues (19, 20). As far as we can
tell, these are the same location as for T cell activation, and so it
is likely that the first T-B cell interactions occur here in the locale
of DC. The DC are also activated during this process (via CD40) and, as
a consequence, secrete IL-12 (5, 35). Given these facts, B
cells may be exposed to IL-12 during their early activation. We
repeated the analysis of B cell cytokine message production after
activation with anti-Ig and anti-CD40, this time in the
presence of IL-12. As Fig. 3A
shows, IL-12 accelerates the appearance of IL-6 and IL-10 message in
these cultures from day 4 to day 2. The IL-12 "costimulus" had no
effect on the expression of TNF- message (data not shown).
|
B we show that the addition of IL-12 to the
cultures also has a potent effect on B cell proliferation, with a
3-fold enhancement of cell division over a 72-h period. This
augmentation of proliferation was observed only when the cells were
stimulated with anti-CD40; IL-12 did not costimulate with
anti-Ig. This might indicate a CD40-specific up-regulation of
IL-12R chains (ß1 or ß2). We believe the effect is a direct one on
B cells and does not work through an intermediate cell such as a T cell
or a DC, because we can detect no such cells in our B cell
preparations. It may be, however, that the IL-12-mediated augmentation
results from the autocrine production of cytokines such as IL-6, which
also costimulates with anti-CD40 (data not shown). In the light of
this effect on proliferation, it is important to point out that the
enhancement of cytokine message by IL-12, described above, is on a per
cell basis because mRNA was made from a fixed number of harvested cells
(106), as evidenced by the even band density in
the ß2-microgobulin amplification (Fig. 3A). IL-12 message is down-regulated in DC cultured with B cell-conditioned supernatant
Both IL-6 and IL-10 are implicated in Th2 development: IL-6 by a
direct effect on differentiating T cells (16) and IL-10 by
inhibiting Th1 differentiation as a result of a shutdown of IL-12
production (5, 7). To assess the feasibility of a B
cell-mediated feedback mechanism operating on DC IL-12 production, we
stimulated DC (with anti-CD40) in the presence and absence of B
cell-conditioned supernatant. The DC used in this experiment were
isolated from spleen suspensions to high purity (Fig. 4A). RT-PCR was conducted at
days 0, 1, 2, 3, 4, and 5 to determine the level of IL-12 message over
time. Fig. 4B shows that the IL-12 p35 message is not
detectable in DC cultured with the B cell supernatant, and the IL-12
p40 message is down-regulated after day 2. To see whether this
down-regulation of IL-12 message was mediated by IL-10 secreted by B
cells, we repeated the above stimulation of DC in B cell supernatant in
the presence of anti-IL-10 Abs (SXC-1 and SXC-2). The decrease in
IL-12 p40 and p35 message seen at 3 days of culture in B cell
supernatant was completely blocked by these Abs (Fig. 4C).
|
To assess whether the above data on B cell cytokine RNA expression
had relevance to the differentiation of Th2 cells, we turned to an
Ag-specific TCR Tg stimulation assay in vitro. Whole spleen populations
(i.e., Tg T cells + APC) from DO.11.10 mice were cultured with OVA
peptide for 3 days and then replated under the same conditions for
another 2 days of culture. Cells were then harvested, washed, and
stimulated with PMA and ionomycin for 5 h in the presence of
Golgi-Stop (PharMingen) and then stained for intracellular cytokines.
Under these basic conditions, >40% of the T cells made IFN- and
little more than 1% made IL-4 (Fig. 5).
If IL-6 is added to these 5-day restimulation cultures, there is a
small increase in IL-4 expression and the same is true whether IL-10 is
added; if both IL-10 and IL-6 are added together, the number of
IL-4-producing cells increases 7-fold (p <
0.01; Fig. 5). There is a concomitant decrease in IFN--producing T
cells from 43 to 23% in the presence of IL-6 and IL-10.
|
To dissect the effect of activated B cells on T cell
differentiation, we used whole spleen cell cultures from DO.11.10 mice
in which OVA peptide was included but, in addition, the B cells were
activated with anti-Ig and anti-CD40. In these cultures, the
number of IL-4-expressing T cells increased from 4.0% (in peptide only
cultures) to 13.1% (Fig. 6A).
This was accompanied by a 50% decrease in the number of
IFN--producing cells (40 to 19%; Fig. 6A).
|
B shows that
addition of either anti-IL-6 or anti-IL-10 to these B
cell-activated splenic cultures restored the cytokine profile seen in
the absence of activated B cells (i.e., a small amount of IL-4 and a
lot of IFN-). Interaction of B cells with IL-12-producing DC enhances their capacity to induce Th2 differentiation
Because the likely source of IL-12 to act on B cells during B-T
interactions in secondary lymphoid tissues is DC (see above), we set up
in vitro cultures to ask whether IL-4 production by DO.11.10 T cells
was enhanced by the IL-12 produced by DC. For this experiment, purified
B cells were preactivated with anti-Ig and anti-CD40 in the
presence of cell populations enriched for splenic DC (see Fig. 4B). The DC were derived from
IL-12-/- mice or wild-type littermates.
The results depicted in Fig. 7 show that,
as previously shown, coculture of DO.11.10 T cells with preactivated B
cells enhanced differentiation of IL-4 producers (<1% in negative
controls to 8.2%; mean of two experiments shown in Fig. 7). The
appearance of IL-4-producing T cells was even further increased when
the B cells were preactivated in the presence of wild-type DC (23.1%
positive; mean of Expts. 1 and 2 in Fig. 7). However, preactivation
together with IL-12-/- DC allowed the induction
of only 5.5% IL-4 producers (mean of Expts. 1 and 2 in Fig. 7). Two
conclusions can be drawn from these results: That interaction of B
cells with DC during T-dependent activation enhances their ability to
influence T cell differentiation (toward Th2) and that the DC-derived
enhancement is mediated by IL-12. It should be noted that IFN-
expression was similar in most cultures (12–25%), even in the
cultures containing IL-12-/- DC (12.4% mean of
Expts. 1 and 2; data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
, IL-6, and IL-10. We have shown
in subsequent experiments that IL-6 and IL-10 are mediators of the
observed capacity of B cells to induce Th2 differentiation in naive T
cells. We presume that IL-6 can act directly on activated T cells to
induce IL-4 transcription, as previously described (16),
and that IL-10 acts to down-regulate IL-12 production by DC (Fig. 4C and Refs. 5 and 7); we show
that soluble factors secreted by activated B cells have this effect
(Fig. 4). Interestingly, however, we also find that IL-12 enhances the
production of the IL-6 and IL-10 messages, and furthermore, that IL-12
is crucial for optimal induction of IL-4 expression in differentiating
T cells. This places IL-12 in a central control point for the induction
of Th2 cells as well as Th1 cells. This may seem counterintuitive given
the current thinking on IL-12 and Th1 development, but we believe this
represents a simple immunoregulatory loop in which IL-12 causes its own
shutdown to limit further Th1 development and, in addition, induces a
balancing Th2 response to restrict the effects of Th1 cytokines.
It is worth citing previous studies in which similar unexpected effects
of IL-12, either in vivo or in vitro, were noted. In vivo,
administration of IL-12 to mice causes IL-10 production
(36). These results were interpreted to indicate
stimulation of IL-10 production from T cells by IL-12, as shown in
vitro (37, 38, 39); however, we would predict that B cells
might also be major IL-10 producers in these mice. IL-12 has been
reported to induce IL-6 and IL-10 expression by B cells, but this was
linked to the aging process (40). A role for IL-12 in Th2
induction can be implied from experiments in
IFN--/- mice in which Th1 development is
impaired; in such mice immunized with schistosome eggs or infected with
Leishmania, IL-12 was found to enhance IL-4 (41, 42) and IgE secretion (42, 43). Indeed more
recently, because of its ability to enhance mucosal responses of both
Th1 and Th2 type (44), IL-12 has been proposed as a
general oral vaccine adjuvant (45).
The immunoregulatory process we describe is likely to take place in the
T zones of secondary lymphoid organs where T and B cells first
proliferate, in association with DC, in response to T-dependent Ags
(19, 20). Our data emphasize the importance of DC in B
cell activation, as described in a number of recent papers
(21, 22, 23) and identify IL-12 as at least one of the
DC-derived enhancers of B cell activation/differentiation. This is in
agreement with the results published by Dubois et al. (46)
and Maruo et al. (47). The data in Fig. 3 and other
previous studies show that IL-12 has significant costimulatory effects
on both B cell proliferation and Ab production (48, 49, 50).
Given our data indicating that IL-12 induces cytokine secretion by B
cells, it seems possible that the augmentation of B cell function by
IL-12 acts via one or more of these cytokines in an autocrine
manner.
The expression of IL-12R on B cells does not present a clear picture. Mouse B cells activated with LPS or human B cells stimulated with Staphylococcus aureus and IL-2 up-regulate the ß1-chain and bind IL-12 (51); however, the expression of the ß2-chain after stimulation (most informatively with anti-Ig and anti-CD40) has not been addressed in the literature. Although the mouse ß1 subunit can bind IL-12 with high affinity (52), it is the ß2 subunit that seems to be the main signaling component of the receptor (53, 54). Thus, the functional status of the receptor on B cells is the subject of some confusion. As the accumulated evidence implicates IL-12 as a major influence on B cell responses, this is a question that requires rapid clarification.
We have given little attention in this study to the fact that B cells
also make a message for TGF-ß and TNF-. The potential expression
of TGF-ß is of interest in the context of immunoregulation because it
has been documented to inhibit cytokine production by T cells in
general (see Ref. 55 for review). More specifically
TGF-ß can antagonize the IL-12-driven differentiation of the Th1
subset (55, 56). The down-regulation of the IL-12R
ß2-chain by TGF-ß is likely to be the basis of this effect
(57, 58). We do not know at present whether the TGF-ß
mRNA found in resting B cells is transcribed or whether any protein is
processed and secreted in active form. We presume that processing and
secretion may only occur after activation. Active TGF has been observed
previously in activated mouse B cells (59). The TNF-
made by activated B cells is likely to be important for the development
and maintenance of follicular dendritic cell, based on the information
from TNF knockout mice (60) and from blocking studies
(61). Clearly, as an inflammatory cytokine, TNF-
influences differentiation to effector T cells; however, there is
relatively little data describing any effects on Th1/Th2 ratios,
although they can, under some circumstances, enhance IL-12 production
by APC (62).
Despite the demonstrations that IL-6 (16) and OX-40
(63) play active roles in inducing IL-4 production by
differentiating T cells, Th2 development is often said to be a default
pathway that occurs in the absence of IL-12. Our data argue against
this because the induction of Th2 cells in this system is dependent
upon delivery of IL-12 (from DC) to B cells. Thus, in the absence of
IL-12 we see very little Th2 development (Fig. 7). We have not
definitively identified the B cell-derived factor that drives Th2
differentiation; clearly IL-6 and IL-10 are active (Figs. 5 and 6), but
we have not investigated OX-40 in this system, and there may be other
molecules that contribute to differentiation. The data presented do
show that in IL-6, IL-10, and possibly TGF-ß, B cells produce a host
of cytokines that can influence the T cell response positively in the
Th2 direction. The literature is heavy with papers describing factors
that set up the Th1/Th2 dichotomy, and it is pertinent to ask how the
model of B cell induction fits in with other models. The simple answer
is that it may be one of several ways in which Th2 differentiation is
brought about, but certainly not the only one (64). For
instance, it is unlikely to be the only mechanism driving Th2 cells in
response to nematodes (65) or other parasites. Ags such as
schistosome eggs can induce IL-4 directly in the absence of any B cells
(66, 67). In this example in which mast cells make the
IL-4, as in the standard protocol to bias Th2 differentiation in vitro,
there is an exogenous source of IL-4, which, in turn, induces T cells
to make their own IL-4. There are many circumstances in vivo in which
an exogenous source is not present. The B cell mechanism may be
especially important for soluble Ags reaching lymph nodes and spleen
and may not be so effective in responses to larger particulate Ags. The
recent distinction of DC1 and DC2 human DC (68) that
induce, respectively, Th1 and Th2 differentiation, is not mutually
exclusive with the B cell model. In the absence of any data concerning
the localization and function of DC2 cells in vivo, we feel that the B
cell is a more obvious candidate to influence differentiating T cells,
being ideally placed during an immune response in time, site, and need
(help for Ab secretion).
In summary, activated B cells make cyokines that inhibit the production of IL-12 by DC (IL-10) and that promote Th2 differentiation (IL-6). We show that the secretion of these cytokines to a large extent underlies their ability to engender Th2 differentiation. The secretion of IL-6 and IL-10 by B cells in quantities that affect T cell differentiation is dependent on delivery of IL-12 during activation of the B cells and, hence, our data extend the role of IL-12 from an inducer of Th1 development to a pivotal position in Th2 development also. This conclusion means that, far from being a therapeutic target for down-regulation of Th1-mediated disease, IL-12 might be viewed as a potential adjuvant for both Th1 and Th2 responses.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David Gray, Institute of Cell Animal and Population Biology, University of Edinburgh, Ashworth Laboratories, King’s Buildings, West Mains Road, Edinburgh EH9 3JT, U.K. E-mail address:
3 Abbreviations used in this paper: DC, dendritic cells; Tg, transgenic; MACS, magnetic-activated cell sorting.
Received for publication April 26, 1999. Accepted for publication August 9, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236:944. production by T helper 1 cells. Eur. J. Immunol. 26:659.[Medline]
-ß T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065. production and type 1 cytokine responses. Immunity 4:471.[Medline]
. J. Immunol. 157:12.[Abstract]
-independent effects of interleukin-12 administered durinf acute or established infection due to Leishmania major. Proc. Natl. Acad. Sci. USA 91:12932.. J. Immunol. 154:3999.[Abstract]
-dependent and -independent mechanisms. Eur. J. Immunol. 27:1958.[Medline]
and is inhibited by transforming growth factor-ß. Eur. J. Immunol. 24:793.[Medline]
-deficient mice: a critical requirement for TNF in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184:1397.- and interleukin-4-producing T cells can be primed on dendritic cells in vivo and do not require the presence of B cells. Eur. J. Immunol. 24:1148.[Medline]
This article has been cited by other articles:
|
|
 |
|
  V. Lampropoulou, K. Hoehlig, T. Roch, P. Neves, E. C. Gomez, C. H. Sweenie, Y. Hao, A. A. Freitas, U. Steinhoff, S. M. Anderton, et al. TLR-Activated B Cells Suppress T Cell-Mediated Autoimmunity J. Immunol., April 1, 2008; 180(7): 4763 - 4773. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Sun, K. Arias, D. Alvarez, R. Fattouh, T. Walker, S. Goncharova, B. Kim, S. Waserman, J. Reed, A. J. Coyle, et al. Impact of CD40 Ligand, B Cells, and Mast Cells in Peanut-Induced Anaphylactic Responses J. Immunol., November 15, 2007; 179(10): 6696 - 6703. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Perona-Wright, S. M. Anderton, S. E. M. Howie, and D. Gray IL-10 permits transient activation of dendritic cells to tolerize T cells and protect from central nervous system autoimmune disease Int. Immunol., September 1, 2007; 19(9): 1123 - 1134. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Hasegawa, Y. Hamaguchi, K. Yanaba, J.-D. Bouaziz, J. Uchida, M. Fujimoto, T. Matsushita, Y. Matsushita, M. Horikawa, K. Komura, et al. B-Lymphocyte Depletion Reduces Skin Fibrosis and Autoimmunity in the Tight-Skin Mouse Model for Systemic Sclerosis Am. J. Pathol., September 1, 2006; 169(3): 954 - 966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Crawford, M. MacLeod, T. Schumacher, L. Corlett, and D. Gray Primary T Cell Expansion and Differentiation In Vivo Requires Antigen Presentation by B Cells J. Immunol., March 15, 2006; 176(6): 3498 - 3506. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Grdic, L. Ekman, K. Schon, K. Lindgren, J. Mattsson, K.-E. Magnusson, P. Ricciardi-Castagnoli, and N. Lycke Splenic Marginal Zone Dendritic Cells Mediate the Cholera Toxin Adjuvant Effect: Dependence on the ADP-Ribosyltransferase Activity of the Holotoxin J. Immunol., October 15, 2005; 175(8): 5192 - 5202. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Bayry, S. Lacroix-Desmazes, M. D. Kazatchkine, O. Hermine, D. F. Tough, and S. V. Kaveri Modulation of Dendritic Cell Maturation and Function by B Lymphocytes J. Immunol., July 1, 2005; 175(1): 15 - 20. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. G. Nair, I. J. Gallagher, M. D. Taylor, P. Loke, P. S. Coulson, R. A. Wilson, R. M. Maizels, and J. E. Allen Chitinase and Fizz Family Members Are a Generalized Feature of Nematode Infection with Selective Upregulation of Ym1 and Fizz1 by Antigen-Presenting Cells Infect. Immun., January 1, 2005; 73(1): 385 - 394. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. V. Parekh, D. V. R. Prasad, P. P. Banerjee, B. N. Joshi, A. Kumar, and G. C. Mishra B Cells Activated by Lipopolysaccharide, But Not By Anti-Ig and Anti-CD40 Antibody, Induce Anergy in CD8+ T Cells: Role of TGF-{beta}1 J. Immunol., June 15, 2003; 170(12): 5897 - 5911. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Mauri, D. Gray, N. Mushtaq, and M. Londei Prevention of Arthritis by Interleukin 10-producing B Cells J. Exp. Med., February 17, 2003; 197(4): 489 - 501. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Fillatreau and D. Gray T Cell Accumulation in B Cell Follicles Is Regulated by Dendritic Cells and Is Independent of B Cell Activation J. Exp. Med., January 20, 2003; 197(2): 195 - 206. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. M. Blackwell and K. J. Else B Cells and Antibodies Are Required for Resistance to the Parasitic Gastrointestinal Nematode Trichuris muris Infect. Immun., June 1, 2001; 69(6): 3860 - 3868. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Bergthorsdottir, A. Gallagher, S. Jainandunsing, D. Cockayne, J. Sutton, T. Leanderson, and D. Gray Signals That Initiate Somatic Hypermutation of B Cells In Vitro J. Immunol., February 15, 2001; 166(4): 2228 - 2234. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Kuroda, T. Sugiura, K. Okada, K. Zeki, and U. Yamashita Prostaglandin E2 Up-Regulates Macrophage-Derived Chemokine Production but Suppresses IFN-Inducible Protein-10 Production by APC J. Immunol., February 1, 2001; 166(3): 1650 - 1658. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Airoldi, G. Gri, J. D. Marshall, A. Corcione, P. Facchetti, R. Guglielmino, G. Trinchieri, and V. Pistoia Expression and Function of IL-12 and IL-18 Receptors on Human Tonsillar B Cells J. Immunol., December 15, 2000; 165(12): 6880 - 6888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Moulin, F. Andris, K. Thielemans, C. Maliszewski, J. Urbain, and M. Moser B Lymphocytes Regulate Dendritic Cell (Dc) Function in Vivo: Increased Interleukin 12 Production by DCs from B Cell-Deficient Mice Results in T Helper Cell Type 1 Deviation J. Exp. Med., August 21, 2000; 192(4): 475 - 482. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
