The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Skok, J.
Right arrow Articles by Gray, D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Skok, J.
Right arrow Articles by Gray, D.
The Journal of Immunology, 1999, 163: 4284-4291.
Copyright © 1999 by The American Association of Immunologists

Dendritic Cell-Derived IL-12 Promotes B Cell Induction of Th2 Differentiation: A Feedback Regulation of Th1 Development1

Jane Skok*, Johanne Poudrier*,{dagger} and David Gray2,*,{ddagger}

* Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, London, United Kingdom; {dagger} Clinical Research Institute of Montreal, Montreal, Quebec, Canada; and {ddagger} Institute of Cell Animal and Population Biology, University of Edinburgh, Ashworth Laboratories, Edinburgh, United Kingdom


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B cells convert what are normally conditions for Th1 differentiation into an environment suitable for Th2 development. This capacity is dependent on CD40 as B cells from CD40-/- mice do not elicit Th2 differentiation. To elucidate the basis of this effect, we surveyed cytokine RNA made by naive B cells after activation with anti-Ig and anti-CD40. Resting B cells make TGF-ß message only, however, 4 days after activation, RNA encoding IL-6, IL-10, and TNF-{alpha} was found. The expression of these messages was accelerated by 2 days in the presence of IL-12. The relevance of these observations to T cell differentiation was investigated: addition of OVA peptide to splenic cells from DO.11.10 transgenic mice causes most T cells to make IFN-{gamma}. Coactivation of B cells in these cultures reduces the number of IFN-{gamma}-producing T cells and increases the number synthesizing IL-4. Abs to IL-6 and IL-10 block the IL-4 enhancement. Dissection of the component APC demonstrated that interaction of B cells with IL-12-producing dendritic cells is crucial for B cell-mediated IL-4 enhancement: Thus, B cells preactivated in the presence of dendritic cells from IL-12-/- mice show little IL-4-inducing activity when used to activate T cells. This immune regulation is initiated by IL-12 and therefore represents a feedback loop to temper its own dominant effect (IFN-{gamma} induction).


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Tcells respond in characteristic ways to infectious agents, depending on whether these are intracellular pathogens or extracellular organisms. The critical, resolving responses against viruses or intracellular bacteria tend to involve cytotoxic T cells and Th cells of the Th1 subset, secreting IFN-{gamma}. In contrast, many helminth infections cause a predominantly Th2 response to develop, with T cells secreting IL-4, IL-5, and IL-13, among other cytokines (1, 2, 3). It would be disadvantageous, however, for a response to be completely polarized to Th1 or Th2. This is particularly true of a Th1 response that, if unchecked, would lead to damaging immunopathology (4); it is the Th2 cytokines, such as IL-10, that down-regulate the Th1 response by shutting down IL-12 production (5, 6, 7). It is also true that there are components of protective immunity to viruses that require input from Th2 cells; for instance, high-level production of neutralizing Abs both systemically and, in particular, at mucosal surfaces (8). Similarly, IFN-{gamma} is a crucial switch factor for certain Ab isotypes (9). Thus, most immune responses benefit from the development of a "balance" between Th1 and Th2 subsets.

The programming of T cell differentiation into these subsets is influenced by a number of factors, including the local cytokine environment, concentration of Ag, the type of costimulation, and the genetic background of the animal (1, 2, 3). It is also clear that the type of APC plays a critical role: dendritic cells (DC)3 preferentially evoke a Th1 response as a result of IL-12 production by these cells (10, 11), whereas B cells engender development of the Th2 subset (12, 13, 14, 15). By analogy with DC, we surmised that the B cell mediator of Th2 development might be a cytokine. Indeed, B cells are known to make IL-6 and IL-10, both of which influence Th2 development (5, 7, 16, 17). Although B cells are reported to synthesize these and other cytokines, the data are anecdotal and mostly derived from B cell lymphomas or cell lines (18) and do not relate to the situation in vivo during the early part of an immune response. For this reason we embarked on a systematic survey of cytokine RNA expression in normal, resting, naive mouse B cells and in those stimulated via the B cell receptor and CD40 (to mimic the first two signals that impinge upon the cell during a T cell dependent immune response).

It is important in investigating this question to keep in mind the microenvironment of early B cell activation. The work of MacLennan (19) and Kelsoe (20) has shown that the first sites of B cell proliferation and hence, presumably T-B cell interaction, occur within T zones of secondary lymphoid organs. These foci also include interdigitating DC that are the initiators of T cell activation. It is now becoming clear that DC may also influence B cell activation and differentiation (21, 22, 23). For this reason, we investigated the effect DC and IL-12 (a major product of CD40- activated DC) on cytokine production by B cells and on ability of B cells to engender Th2 development in TCR transgenic (Tg) T cells (17). Our results show that the production of cytokines by B cells that inhibit Th1 development (IL-10) and induce Th2 development (IL-6) is considerably enhanced in the presence of IL-12. We find that IL-12 production by DC is necessary for the IL-4-inducing capacity of B cells when used as APCs to DO.11.10 TCR Tg T cells (H2Ad-restricted anti-OVA) (17). This suggests that as well as driving Th1 development, IL-12 initiates a negative feedback loop via B cells that shuts down its own synthesis and enhances IL-4 production.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice

CD40-/- mice were derived in Osaka, Japan as described previously (24) and were generously supplied to us by Dr. Hitoshi Kikutani (Research Institute for Microbial Diseases, University of Osaka, Osaka, Japan). CD40-/- mice were maintained by homozygous breeding and were a third generation backcross to C57BL/6. C57BL/6 mice (Harlan-Olac, Bicester, U.K.) were used as wild-type (+/+) controls. DO11.10 TCR Tg mice (H2Ad-restricted, OVA peptide 323–339-specific) (25) were kindly given to us by Dr. Hans Reiser (Department of Immunology, Imperial College School of Medicine, Hammersmith Hospital, London, U.K.) who also provided IL-12-/- mice (26). BALB/c mice (Harlan-Olac) were used as a source of APC in experiments with DO11.10 T cells. All mice were bred and maintained under standard laboratory conditions in the Biological Services Unit of the Imperial College School of Medicine, and were used in experiments at 8–16 wk of age.

Antibodies

The mAbs used were T24 (anti-Thy1), 145-2C11 (anti-CD3), N418 (anti-CD11c), I45.2 (anti-CD44), 16A (anti-CD45RB), S4B6 (anti-IL-2), 11B11 (anti-IL-4), AN18 (anti-IFN-{gamma}), R4-6A2 (anti-IFN-{gamma}), M5114 (anti-MHC class II), 53-6.7.2 (anti-CD8), and 187.1 (anti-{kappa}); the sources of these commonly used Abs are listed in Ref. 30 . The 37.N.51.1 mAb (anti-CD28) was a kind gift of Dr. J. Allison (University of California, Berkeley, CA), and FGK-45 (anti-CD40; Ref. 27) was given to us by Dr. A. Rolink (Basel Institute for Immunology, Basel, Switzerland). We are grateful to Dr. A. O’Garra (DNAX, Palo Alto, CA) for providing the Abs to IL-6 (20F3 and 32C11) and IL-10 (SXC-1 and SXC-2). For use in FACS staining or magnetic-activated cell sorting (MACS) purification, some Abs were either fluoresceinated or biotinylated. PE-labeled streptavidin was purchased from Southern Biotechnology Associates (Birmingham, AL).

Cell preparations

Spleens were harvested from mice and cell suspensions made by pressing the spleen between two squares of nylon gauze, followed by passage through a 25-gauge needle. CD4+ T cells were obtained from the spleens by magnetic depletion of MHC class II+, IgM+, and CD8+ cells (MACS; Miltenyi Biotech, Bergisch Gladbach, Germany). Further purification of resting/naive CD4+ T cells on the basis of levels of CD44 expression was also conducted by MACS depletion of CD44high cells. B cells were purified from spleens using CD43 microbeads followed by separation on a MACS column. Mature mouse B cells are CD43-, whereas all other hemopoietic cells are CD43+, and hence a single passage through the MACS column yielded a B cell population that was 98.5–99.5% pure. For preparation of high-density, resting B cells, the CD43- cells were loaded onto Percoll gradients as described previously (28) and the 1.079–1.085 g/ml interface harvested. DC were purified from spleens as described previously (29). Briefly, this involved dispersion of spleens using enzymes (collagenase and DNase), separation on a Percoll gradient, and two adhesion steps (of 90 min and overnight). Nonadherent DC were harvested. Contaminating B cells and T cells were depleted with goat anti-rat IgG Dynabeads after incubation with anti-{kappa} (187.1) and anti-Thy1 (T24).

Stimulation cultures

Cell cultures were established in IMDM supplemented with 5% FCS, 2 mM L-glutamine (Life Technologies, Rockville, MD), 50 mM 2-ME, and penicillin-streptomycin (50 mg/ml). The cultures were maintained at 37°C in a humidified 5% CO2 atmosphere. For analysis of T cell activation, wild-type or CD40-/--sorted splenic T cell cultures (2 x 105 to 5 x 105 cells/well) were plated in anti-CD3-coated microwells (0.1 µg/ml) in the presence of anti-CD28. Stimulation of T cells for FACS analysis was conducted in 48-well plates (Costar, Cambridge, MA) at 106 cells per well. B cells were stimulated by addition of anti-{kappa} (187.1; 5 µg/ml) with or without anti-CD40 (FGK-45; 10 µg/ml). DO11.10 splenic and T cell cultures were stimulated in the presence of OVA323–339 (0.1 µg/ml). Stimulation of DC was by addition of anti-CD40 (10 µg/ml). Blocking Abs to IL-6 (20F3 and 32C11) and to IL-10 (SXC-1 and SXC-2) were used at 20 µg/ml. B cell-conditioned supernatant was obtained from activated B cell cultures after 4 days. For restimulation of splenic and T cell cultures, cells were cultured for 3–5 days, washed twice, and recultured under exactly the same conditions for 2–3 days. Cytokines were purchased from R&D Systems (Abingdon, U.K.) and were used at the following concentrations in cultures: IL-6 at 15 ng/ml, IL-10 at 15 ng/ml, and IL-12 at 20 ng/ml. B cell proliferation assays were set up in flat-bottom 96-well plates; DNA synthesis was measured over the period of 64–72 h by addition of [3H]thymidine (1 µCi/well).

Measurement of cytokine release

The presence of cytokines in day 3 culture supernatant was detected as follows. IL-4 production was measured using the CT4S cell line in the presence of anti-IL-2 mAb as described previously (30). [3H]Thymidine was added to the CT4S cells at a time when the negative control wells exhibited significant cell mortality (normally after 24–36 h); plates were harvested for counting after 8 h. Proliferation of the CT4S cells could be completely blocked in the presence of anti-IL-2 and anti-IL-4. Supernatant from the X63-Ag8-mIL-4 cell line (31) was used as a source of IL-4. IFN-{gamma} secretion was measured by ELISA using two anti-IFN-{gamma} mAbs (R4–6A2 and AN18), the second biotinylated to allow detection with streptavidin-alkaline phosphatase (Southern Biotechnology Associates). Supernatants from activated horse myoglobin-reactive Th1 clone (11.3.7; Ref. 32) or from the X63-Ag8-mIL-4 cell line containing known amounts of IFN-{gamma} and IL-4 were used as standards (quantified using recombinant cytokines purchased from R&D Systems).

Detection of cytokine message

RNA was made from the same number of cells in comparable cultures. Cell pellets (106 cells) were vortex mixed in 0.5 ml RNAzol B (RNA isolation solvent; AMS Biotechnology, Oxon, U.K.) or equivalent for fewer cells. Chloroform/isoamylalcholol (0.1 vol, 24:1) was added and the tubes thoroughly vortex mixed and left on ice for 15 min. Samples were centrifuged at 15,000 rpm for 10 min, and the upper phase was transferred to a fresh tube to which an equal volume of isopropanol was added. These were stored at -80°C for at least 20 min. Samples were centrifuged for 25 min at 15,000 rpm and washed in 1 ml (or equivalent for fewer cells) 75% ethanol. Pellets were resuspended in 100 µl H2O (or equivalent for fewer cells). RNA was stored at -80°C. cDNA was made using a Promega reverse transcription kit (Promega, Madison, WI) containing all the reagents for synthesis of single-stranded cDNA.

As an internal control for the cytokine RT-PCR, we used the pMus3 construct contained in a pTZ plasmid kindly provided by Dr. David Shire (Sanofi Recherche, Labège, France) (33). The primers used for PCR amplification were: ß2-microglobulin, 5'-TGACCGGCTTGTATGCTATC and 3'-CAGTGTGAGCCAGGATATAG; IL-12 p35, 5'-GATCATGAAGACATCACACGG and 3'- AGAATGATCTGCTGATGGTTG; IL-12 p40, 5'-CAGTACACCTGCCACAAAGGA and 3'-GTGTGACCTTCTCTGCAGACA; for IL-6, 5'- GTTCTCTGGGAAATCGTGGA and 3'- TGTACTCCAGGTAGCTATGG; IL-10, 5'- ATGCAGGACTTTAAGGGTTACTTG and 3'- TAGACACCTTGGTCTTGGAGCTTA; TNF-{alpha}, 5'- TCTCATCAGTTCTATGGCCC and 3'-GGGAGTAGACAAGGTACAAC. RT-PCR as a template was used to amplify cDNA encoding cytokines. Buffers required were supplied with the Taq polymerase (Promega). Three microliters of cDNA was added to 5 µl 10x Taq polymerase buffer, 5 µl 1 mM dNTP (Promega), and 1 µl primer (300 ng/µl), and 36.5 µl H2O added. This was overlayed with 3 drops of mineral oil. The PCRs were performed in 0.5-ml tubes in a Touch Down thermal cycler (Hybaid, Ashford, Middlelesex, U.K.). An initial denaturation step of 5 min at 94°C was conducted before addition of 0.5 µl Taq polymerase. This was followed by 33 cycles of 60 s at 94°C, 60 s at annealing temperture (65°C for IL-12 p40 and 60°C for all other cytokines), and 60 s at 72°C. This was followed by a final elongation step of 10 min at 72°C. The PCR product was separated on a 2.5% agarose gel containing ethidium bromide and photographed.

Intracellular cytokine staining.

At the appropriate time points cultured cells were harvested and washed. Before staining cells were stimulated with PMA (10 ng/ml; Sigma-Aldrich, Poole, U.K.) and ionomycin (1 µg/ml; Sigma) in the presence Golgi Stop according to the manufacturer’s protocol (Cytofix/Cytoperm Plus cytostain kit; PharMingen, San Diego, CA) for 5 h such that cytokine accumulated in the cytoplasm. The cells were stained with T24-FITC (anti-Thy1.2) and then fixed and permeabilized according to the manufacturer’s protocol for the cytostain kit. Cells were then stained with biotinylated anti-IFN-{gamma} (clone XMG1.2) and anti-IL-4-PE (clone 11B11) (both from PharMingen) at a final concentration of 1/100. After washing, the cells were stained with streptavidin-quantum red (Sigma-Aldrich) at a final concentration of 1/200. For each sample, 10,000 gated cells were analyzed using a FACSCaliber (Becton Dickinson, Mountain View, CA) and CellQuest software. Final percentages of intracellular cytokine staining were recorded from T24 (anti-Thy1)-FITC gated populations. The statistical significance of observed differences was analyzed using Student’s t test.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
CD40 is necessary for induction of Th2 cells by B cells

Given our previous observations on the influence of B cells on the generation of Th2 cells (12), we investigated whether this capacity was related to their expression of CD40. CD44loCD4+ T cells from C57BL/6 mice were stimulated with anti-CD3 in the presence of DC or B cells from either wild-type or CD40-/- mice. The DC were grown from bone marrow in cultures containing GM-CSF (34), whereas B cells were prepared from the spleen. Because CD40 signals may augment the costimulatory capacity of B cells, we not only activated the B cells with anti-Ig to up-regulate B7 molecules, but also added anti-CD28 to these cultures.

Fig. 1Go shows the results of this experiment. In cocultures with DC, the anti-CD3-activated T cells made no IL-4, however, they did produce significant amounts of IFN-{gamma}, even in the absence of CD40 on the DC. When activated (CD40+) B cells were used as APC, IL-4 was readily detectable, with a concomitant reduction in IFN-{gamma} secretion. However, B cells from CD40-/- mice did not have the capacity to stimulate IL-4 production. It is important to point out that the low concentration of anti-CD3 used in these cultures (0.1 µg/ml) is one at which, in our hands using anti-CD3 coated onto plastic (together with anti-CD28) in the absence of any APC, never gives rise to IL-4 (30); IL-4 can only be elicited at anti-CD3 concentrations that are 100-fold higher. Thus CD40+ B cells skew the response in the Th2 direction under conditions that would normally lead to Th1 development.



View larger version (20K):
[in this window]
[in a new window]
  		FIGURE 1. Induction of Th2 differentiation by B cells is dependent on their expression of CD40. CD4+CD44low T cells were cocultured in the presence of DC or B cells from wild-type or CD40-/- mice. B cells were preactivated with anti-Ig for 18 h to induce high levels of B7 molecules before coculture; in the experiments shown, anti-CD28 was also added. All cultures were in the presence of anti-CD3 coated onto the plates at a concentration of 0.1 µg/ml. Cells were cultured for 5 days, harvested, and recultured in the exact same conditions for 5 days. Means and SD of triplicate cultures are shown. These data are derived from one of three replica experiments.

 
Cytokine mRNA expression in B cells following activation

The potency of the IL-4-inducing effect suggested to us that, in a manner analogous to DC, IL-12, and Th1 cells, B cells might produce a mediator upon CD40 ligation that drives Th2 differentiation. Obvious candidates for this role would be cytokines, and so we conducted a systematic survey of cytokine mRNAs expressed in naive, resting B cells before and after stimuli that we expected them to receive during a T cell-dependent response, namely, anti-Ig and anti-CD40 (mimicking Ag and CD40 ligand). All previous data relating to cytokine expression by B cells has derived from ill-defined activated populations, cell lines, or tumors; in this study we felt it was important to address B cell cytokine production in the context, as far as possible, of a primary immune response.

We also took great pains to deplete our Percoll high-density, resting B cells preparations of DC by passage over anti-CD11c MACS columns. On day 3 the cultures were stained for MHC class II and CD11c for FACS analysis and no DC were found (data not shown). In addition, the absence of IL-12 p40 message was an indicator that the cultures were free of contaminating DC (Fig. 2Go). The quality of the RNA preparations was assessed by ß2-microglobulin message. Cytokine message was assessed at day 0 (prestimulation) and subsequently on days 2, 3, and 4 poststimulation (Fig. 2Go).



View larger version (53K):
[in this window]
[in a new window]
  		FIGURE 2. Time course of cytokine mRNA expression in B cells following activation. Naive B cells stimulated with anti-Ig and anti-CD40, then RNA made from the same number of cells from cultures on days 2, 3, and 4, as well as before culture (day 0, unstimulated). RT-PCR was performed using specific primers for IL-12 p40, TNF-{alpha}, IL-6, IL-10, TGF-ß, and IL-12 p35. These primers also amplified cytokine gene sequences contained in the pMus3 plasmid as positive controls. Amplification of ß2-microglobulin mRNA controlled for equal RNA loading. These results were reproducible in six separate experiments.

 
Both IL-12 p35 and TGF-ß messages are expressed in resting B cells before stimulation (Fig. 2Go), and there appears to be no up-regulation of either of these mRNAs following activation. Only three other cytokines were detectable: IL-6, IL-10, and TNF-{alpha}. All three were inducible from undetectable baseline levels following anti-Ig + anti-CD40 activation. The kinetics of RNA synthesis after stimulation were different, with the IL-6 and IL-10 messages relatively slow to appear (detectable routinely only by day 4), whereas the TNF-{alpha} message was present by day 2 or earlier. We also tested for IL-2, IL-4, IL-5, IL-9, and IL-13 and no message was observed at any time after activation (data not shown).

IL-12 enhances B cell cytokine production

The first sites of B cell proliferation are the T zones of secondary lymphoid tissues (19, 20). As far as we can tell, these are the same location as for T cell activation, and so it is likely that the first T-B cell interactions occur here in the locale of DC. The DC are also activated during this process (via CD40) and, as a consequence, secrete IL-12 (5, 35). Given these facts, B cells may be exposed to IL-12 during their early activation. We repeated the analysis of B cell cytokine message production after activation with anti-Ig and anti-CD40, this time in the presence of IL-12. As Fig. 3GoA shows, IL-12 accelerates the appearance of IL-6 and IL-10 message in these cultures from day 4 to day 2. The IL-12 "costimulus" had no effect on the expression of TNF-{alpha} message (data not shown).



View larger version (37K):
[in this window]
[in a new window]
  		FIGURE 3. Enhanced expression of cytokine mRNA and proliferation following activation of B cells in the presence of IL-12. A, Naive B cells stimulated with anti-Ig and anti-CD40 in the presence or absence of IL-12. RNA was made from the same number of cells from cultures on days 2, 3, and 4, as well as before culture (day 0, unstimulated). RT-PCR was performed using specific primers for IL-12 p40, TNF-{alpha}, IL-6, IL-10, TGF-ß, and IL-12 p35. These primers also amplified cytokine gene sequences contained in the pMus3 plasmid as positive controls. Amplification of ß2-microglobulin mRNA controlled for equal RNA loading. These results were reproducible in five separate experiments. B, Proliferation of naive B cells after stimulation in the presence or absence of IL-12. Entry into cell cycle was measured by [3H]thymidine incorporation from 64–72 h. Means and SD of triplicate cultures are shown.

 
In Fig. 3GoB we show that the addition of IL-12 to the cultures also has a potent effect on B cell proliferation, with a 3-fold enhancement of cell division over a 72-h period. This augmentation of proliferation was observed only when the cells were stimulated with anti-CD40; IL-12 did not costimulate with anti-Ig. This might indicate a CD40-specific up-regulation of IL-12R chains (ß1 or ß2). We believe the effect is a direct one on B cells and does not work through an intermediate cell such as a T cell or a DC, because we can detect no such cells in our B cell preparations. It may be, however, that the IL-12-mediated augmentation results from the autocrine production of cytokines such as IL-6, which also costimulates with anti-CD40 (data not shown). In the light of this effect on proliferation, it is important to point out that the enhancement of cytokine message by IL-12, described above, is on a per cell basis because mRNA was made from a fixed number of harvested cells (106), as evidenced by the even band density in the ß2-microgobulin amplification (Fig. 3GoA).

IL-12 message is down-regulated in DC cultured with B cell-conditioned supernatant

Both IL-6 and IL-10 are implicated in Th2 development: IL-6 by a direct effect on differentiating T cells (16) and IL-10 by inhibiting Th1 differentiation as a result of a shutdown of IL-12 production (5, 7). To assess the feasibility of a B cell-mediated feedback mechanism operating on DC IL-12 production, we stimulated DC (with anti-CD40) in the presence and absence of B cell-conditioned supernatant. The DC used in this experiment were isolated from spleen suspensions to high purity (Fig. 4GoA). RT-PCR was conducted at days 0, 1, 2, 3, 4, and 5 to determine the level of IL-12 message over time. Fig. 4GoB shows that the IL-12 p35 message is not detectable in DC cultured with the B cell supernatant, and the IL-12 p40 message is down-regulated after day 2. To see whether this down-regulation of IL-12 message was mediated by IL-10 secreted by B cells, we repeated the above stimulation of DC in B cell supernatant in the presence of anti-IL-10 Abs (SXC-1 and SXC-2). The decrease in IL-12 p40 and p35 message seen at 3 days of culture in B cell supernatant was completely blocked by these Abs (Fig. 4GoC).



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 4. Down-regulation of IL-12 mRNA in CD40-activated splenic DC cultured with supernatant from activated B cells. A, Purified mature splenic DC stained for MHC class II and CD11c. B, DC stimulated with anti-CD40 in the presence or absence of supernatant from B cell activation cultures. RNA was prepared daily from day 0 (unstimulated) to day 5. RT-PCR was performed using specific primers for IL-12 p40 and IL-12 p35. These primers also amplified cytokine gene sequences contained in the pMus3 plasmid as positive controls. C, Anti-CD40-stimulated DC cultured with B cell supernatant in the presence or absence of anti-IL-10 Abs. Cells were harvested after 3 days and RT-PCR for IL-12 p40 and IL-12 p35 performed. Amplification of ß2-microglobulin mRNA controlled for equal RNA loading. These results were reproducible in three separate experiments.

 
IL-6 and IL-10 induce IL-4 expression in DO.11.10 TCR Tg T cells

To assess whether the above data on B cell cytokine RNA expression had relevance to the differentiation of Th2 cells, we turned to an Ag-specific TCR Tg stimulation assay in vitro. Whole spleen populations (i.e., Tg T cells + APC) from DO.11.10 mice were cultured with OVA peptide for 3 days and then replated under the same conditions for another 2 days of culture. Cells were then harvested, washed, and stimulated with PMA and ionomycin for 5 h in the presence of Golgi-Stop (PharMingen) and then stained for intracellular cytokines. Under these basic conditions, >40% of the T cells made IFN-{gamma} and little more than 1% made IL-4 (Fig. 5Go). If IL-6 is added to these 5-day restimulation cultures, there is a small increase in IL-4 expression and the same is true whether IL-10 is added; if both IL-10 and IL-6 are added together, the number of IL-4-producing cells increases 7-fold (p < 0.01; Fig. 5Go). There is a concomitant decrease in IFN-{gamma}-producing T cells from 43 to 23% in the presence of IL-6 and IL-10.



View larger version (49K):
[in this window]
[in a new window]
  		FIGURE 5. IL-6 and IL-10 induce IL-4 expression in DO11.10 Tg T cells after peptide stimulation. Spleen cells from DO.11.10 Tg mice stimulated with OVA peptide alone or with added IL-6, IL-10, or both. Cultures were restimulated (same conditions) on day 3 and intracellular staining for IL-4 and IFN-{gamma} was performed on day 5. The results are expressed as the proportion of positive T cells, gated as Thy1+ cells. Means and SD of triplicate cultures are shown. The increase in IL-4-producing cells in the presence of both IL-6 and IL-10 was statistically significant (p < 0.01), as was the decrease in IFN-{gamma} (p < 0.05). These results were reproducible in three separate experiments.

 
B cell-induced IL-4 secretion in DO.11.10 TCR Tg T cells is dependent on IL-6 and IL-10

To dissect the effect of activated B cells on T cell differentiation, we used whole spleen cell cultures from DO.11.10 mice in which OVA peptide was included but, in addition, the B cells were activated with anti-Ig and anti-CD40. In these cultures, the number of IL-4-expressing T cells increased from 4.0% (in peptide only cultures) to 13.1% (Fig. 6GoA). This was accompanied by a 50% decrease in the number of IFN-{gamma}-producing cells (40 to 19%; Fig. 6GoA).



View larger version (41K):
[in this window]
[in a new window]
  		FIGURE 6. B cell-induced expression of IL-4 in DO11.10 Tg T cells is blocked by Abs to IL-6 and IL-10. A, Spleen cells from DO11.10 Tg mice stimulated with peptide alone or together with anti-Ig and anti-CD40 to activate B cells. The difference in number of IL-4-producing T cells is statistically significant after anti-Ig/CD40 stimulation; IL-4 (p < 0.05) and IFN-{gamma} (p < 0.1). B, Cultures set up as those in A, with the addition of Abs to IL-6 or IL-10 or both together included from the start. Cultures were restimulated on day 3 (same conditions) and intracellular staining for IL-4 and IFN-{gamma} was performed on day 5. The results, from FACS analysis, are expressed as the proportion of positive T cells, gated as Thy1+ cells. Means and SE of results from three experiments are shown. The decrease in IL-4-producing cells in the presence of anti-IL-6 (p < 0.1) and anti-IL-10 (p < 0.01) were significant, as was the increase in IFN-{gamma} (anti-IL-6 and anti-IL-10 both p < 0.05).

 
To see whether IL-6 or IL-10 was the basis for this phenomenon, we tried to block the Th2 switch with Abs. Fig. 6GoB shows that addition of either anti-IL-6 or anti-IL-10 to these B cell-activated splenic cultures restored the cytokine profile seen in the absence of activated B cells (i.e., a small amount of IL-4 and a lot of IFN-{gamma}).

Interaction of B cells with IL-12-producing DC enhances their capacity to induce Th2 differentiation

Because the likely source of IL-12 to act on B cells during B-T interactions in secondary lymphoid tissues is DC (see above), we set up in vitro cultures to ask whether IL-4 production by DO.11.10 T cells was enhanced by the IL-12 produced by DC. For this experiment, purified B cells were preactivated with anti-Ig and anti-CD40 in the presence of cell populations enriched for splenic DC (see Fig. 4GoB). The DC were derived from IL-12-/- mice or wild-type littermates.

The results depicted in Fig. 7Go show that, as previously shown, coculture of DO.11.10 T cells with preactivated B cells enhanced differentiation of IL-4 producers (<1% in negative controls to 8.2%; mean of two experiments shown in Fig. 7Go). The appearance of IL-4-producing T cells was even further increased when the B cells were preactivated in the presence of wild-type DC (23.1% positive; mean of Expts. 1 and 2 in Fig. 7Go). However, preactivation together with IL-12-/- DC allowed the induction of only 5.5% IL-4 producers (mean of Expts. 1 and 2 in Fig. 7Go). Two conclusions can be drawn from these results: That interaction of B cells with DC during T-dependent activation enhances their ability to influence T cell differentiation (toward Th2) and that the DC-derived enhancement is mediated by IL-12. It should be noted that IFN-{gamma} expression was similar in most cultures (12–25%), even in the cultures containing IL-12-/- DC (12.4% mean of Expts. 1 and 2; data not shown).



View larger version (54K):
[in this window]
[in a new window]
  		FIGURE 7. Interaction with IL-12-producing DC enhances the B cells capacity to induce IL-4 expression in DO11.10 Tg T cells. Purified B cells and purified DC (ratio, 10:1) cocultured overnight in the presence of anti-Ig and anti-CD40 before addition of purified DO11.10 Tg T cells (B:T = 1:1) plus OVA peptide. Cultures were restimulated on day 3 (same conditions) and intracellular staining for IL-4 performed on day 5. The results, from FACS analysis, are expressed as the proportion of positive T cells, gated as Thy1+ cells. Data from two separate experiments are shown. In experiment 2, means and SDs of triplicate cultures are shown. In this experiment, the difference between IL-4 production in the presence IL-12-/- DC and wild-type DC is statistically significant (p < 0.05). Experiment 1 is not expressed as mean and SD because single, not triplicate, cultures were set up.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
After activation via receptors that we expect to be ligated early during a T-dependent response (surface Ig and CD40), normal resting B cells transcribe at a significant level only 4 cytokine genes (of the 12 tested). These are TGF-ß, TNF-{alpha}, IL-6, and IL-10. We have shown in subsequent experiments that IL-6 and IL-10 are mediators of the observed capacity of B cells to induce Th2 differentiation in naive T cells. We presume that IL-6 can act directly on activated T cells to induce IL-4 transcription, as previously described (16), and that IL-10 acts to down-regulate IL-12 production by DC (Fig. 4GoC and Refs. 5 and 7); we show that soluble factors secreted by activated B cells have this effect (Fig. 4Go). Interestingly, however, we also find that IL-12 enhances the production of the IL-6 and IL-10 messages, and furthermore, that IL-12 is crucial for optimal induction of IL-4 expression in differentiating T cells. This places IL-12 in a central control point for the induction of Th2 cells as well as Th1 cells. This may seem counterintuitive given the current thinking on IL-12 and Th1 development, but we believe this represents a simple immunoregulatory loop in which IL-12 causes its own shutdown to limit further Th1 development and, in addition, induces a balancing Th2 response to restrict the effects of Th1 cytokines.

It is worth citing previous studies in which similar unexpected effects of IL-12, either in vivo or in vitro, were noted. In vivo, administration of IL-12 to mice causes IL-10 production (36). These results were interpreted to indicate stimulation of IL-10 production from T cells by IL-12, as shown in vitro (37, 38, 39); however, we would predict that B cells might also be major IL-10 producers in these mice. IL-12 has been reported to induce IL-6 and IL-10 expression by B cells, but this was linked to the aging process (40). A role for IL-12 in Th2 induction can be implied from experiments in IFN-{gamma}-/- mice in which Th1 development is impaired; in such mice immunized with schistosome eggs or infected with Leishmania, IL-12 was found to enhance IL-4 (41, 42) and IgE secretion (42, 43). Indeed more recently, because of its ability to enhance mucosal responses of both Th1 and Th2 type (44), IL-12 has been proposed as a general oral vaccine adjuvant (45).

The immunoregulatory process we describe is likely to take place in the T zones of secondary lymphoid organs where T and B cells first proliferate, in association with DC, in response to T-dependent Ags (19, 20). Our data emphasize the importance of DC in B cell activation, as described in a number of recent papers (21, 22, 23) and identify IL-12 as at least one of the DC-derived enhancers of B cell activation/differentiation. This is in agreement with the results published by Dubois et al. (46) and Maruo et al. (47). The data in Fig. 3Go and other previous studies show that IL-12 has significant costimulatory effects on both B cell proliferation and Ab production (48, 49, 50). Given our data indicating that IL-12 induces cytokine secretion by B cells, it seems possible that the augmentation of B cell function by IL-12 acts via one or more of these cytokines in an autocrine manner.

The expression of IL-12R on B cells does not present a clear picture. Mouse B cells activated with LPS or human B cells stimulated with Staphylococcus aureus and IL-2 up-regulate the ß1-chain and bind IL-12 (51); however, the expression of the ß2-chain after stimulation (most informatively with anti-Ig and anti-CD40) has not been addressed in the literature. Although the mouse ß1 subunit can bind IL-12 with high affinity (52), it is the ß2 subunit that seems to be the main signaling component of the receptor (53, 54). Thus, the functional status of the receptor on B cells is the subject of some confusion. As the accumulated evidence implicates IL-12 as a major influence on B cell responses, this is a question that requires rapid clarification.

We have given little attention in this study to the fact that B cells also make a message for TGF-ß and TNF-{alpha}. The potential expression of TGF-ß is of interest in the context of immunoregulation because it has been documented to inhibit cytokine production by T cells in general (see Ref. 55 for review). More specifically TGF-ß can antagonize the IL-12-driven differentiation of the Th1 subset (55, 56). The down-regulation of the IL-12R ß2-chain by TGF-ß is likely to be the basis of this effect (57, 58). We do not know at present whether the TGF-ß mRNA found in resting B cells is transcribed or whether any protein is processed and secreted in active form. We presume that processing and secretion may only occur after activation. Active TGF has been observed previously in activated mouse B cells (59). The TNF-{alpha} made by activated B cells is likely to be important for the development and maintenance of follicular dendritic cell, based on the information from TNF knockout mice (60) and from blocking studies (61). Clearly, as an inflammatory cytokine, TNF-{alpha} influences differentiation to effector T cells; however, there is relatively little data describing any effects on Th1/Th2 ratios, although they can, under some circumstances, enhance IL-12 production by APC (62).

Despite the demonstrations that IL-6 (16) and OX-40 (63) play active roles in inducing IL-4 production by differentiating T cells, Th2 development is often said to be a default pathway that occurs in the absence of IL-12. Our data argue against this because the induction of Th2 cells in this system is dependent upon delivery of IL-12 (from DC) to B cells. Thus, in the absence of IL-12 we see very little Th2 development (Fig. 7Go). We have not definitively identified the B cell-derived factor that drives Th2 differentiation; clearly IL-6 and IL-10 are active (Figs. 5Go and 6Go), but we have not investigated OX-40 in this system, and there may be other molecules that contribute to differentiation. The data presented do show that in IL-6, IL-10, and possibly TGF-ß, B cells produce a host of cytokines that can influence the T cell response positively in the Th2 direction. The literature is heavy with papers describing factors that set up the Th1/Th2 dichotomy, and it is pertinent to ask how the model of B cell induction fits in with other models. The simple answer is that it may be one of several ways in which Th2 differentiation is brought about, but certainly not the only one (64). For instance, it is unlikely to be the only mechanism driving Th2 cells in response to nematodes (65) or other parasites. Ags such as schistosome eggs can induce IL-4 directly in the absence of any B cells (66, 67). In this example in which mast cells make the IL-4, as in the standard protocol to bias Th2 differentiation in vitro, there is an exogenous source of IL-4, which, in turn, induces T cells to make their own IL-4. There are many circumstances in vivo in which an exogenous source is not present. The B cell mechanism may be especially important for soluble Ags reaching lymph nodes and spleen and may not be so effective in responses to larger particulate Ags. The recent distinction of DC1 and DC2 human DC (68) that induce, respectively, Th1 and Th2 differentiation, is not mutually exclusive with the B cell model. In the absence of any data concerning the localization and function of DC2 cells in vivo, we feel that the B cell is a more obvious candidate to influence differentiating T cells, being ideally placed during an immune response in time, site, and need (help for Ab secretion).

In summary, activated B cells make cyokines that inhibit the production of IL-12 by DC (IL-10) and that promote Th2 differentiation (IL-6). We show that the secretion of these cytokines to a large extent underlies their ability to engender Th2 differentiation. The secretion of IL-6 and IL-10 by B cells in quantities that affect T cell differentiation is dependent on delivery of IL-12 during activation of the B cells and, hence, our data extend the role of IL-12 from an inducer of Th1 development to a pivotal position in Th2 development also. This conclusion means that, far from being a therapeutic target for down-regulation of Th1-mediated disease, IL-12 might be viewed as a potential adjuvant for both Th1 and Th2 responses.


   Acknowledgments
 
We thank Drs. Gitta Stockinger and Mohini Perraudeau for critical reading of the manuscript.


   Footnotes
 
1 This work was supported by the Wellcome Trust and the Medical Research Council (U.K.). J.P. was the recipient of a Fellowship from the Medical Research Council of Canada. Back

2 Address correspondence and reprint requests to Dr. David Gray, Institute of Cell Animal and Population Biology, University of Edinburgh, Ashworth Laboratories, King’s Buildings, West Mains Road, Edinburgh EH9 3JT, U.K. E-mail address: Back

3 Abbreviations used in this paper: DC, dendritic cells; Tg, transgenic; MACS, magnetic-activated cell sorting. Back

Received for publication April 26, 1999. Accepted for publication August 9, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  2. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4+ T cells. Annu. Rev. Immunol. 12:635.[Medline]
  3. O’Garra, A.. 1998. Cytokines induce the development of funtionally heterogenous Y helper cell subsets. Immunity 8:275.[Medline]
  4. Wolf, S. D., B. N. Dittel, F. Hardardottir, C. A. Janeway. 1996. Experimental autoimmune encephalomyelitis induction in genetically B cell-deficient mice. J. Exp. Med. 184:2271.[Abstract/Free Full Text]
  5. Koch, F., U. Stanzl, P. Jennewein, K. Janke, C. Heufler, E. Kampgen, N. Romani, G. Schuler. 1996. High level IL-12 production by murine dendritic cells: upregulation via MHC class II and CD40 molecules and downregulation by IL-4 and IL-10. J. Exp. Med. 184:741.[Abstract/Free Full Text]
  6. Hino, A., H. Nariuchi. 1996. Negative feedback mechanism suppresses interleukin-12 production by antigen-presenting cells interacting with T helper 2 cells. Eur. J. Immunol. 26:623.[Medline]
  7. De Smedt, T., M. Van Mechelen, G. De Becker, J. Urbain, O. Leo, M. Moser. 1997. Effect of interleukin-10 on dendritic cell maturation and function. Eur. J. Immunol. 27:1229.[Medline]
  8. Coffman, R. L., D. A. Lebman, P. Rothman. 1993. Mechanism and regulation of immunoglobulin isotype switching. Adv. Immunol. 54:229.[Medline]
  9. Snapper, C. M., W. E. Paul. 1987. Interferon-{gamma} and B cell stimulatory factor-1 reciprocally regulate Ig isotype production. Science 236:944.[Abstract/Free Full Text]
  10. Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. S. Hsieh, J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1995. Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells. J. Immunol. 154:5071.[Abstract]
  11. Heufler, C., F. Koch, U. Stanzl, G. Topar, M. Wysocka, G. Trinchieri, A. Enk, R.M. Steinman, N. Romani, G. Schuler. 1996. Interleukin-12 is produced by dendritic cells and mediates T helper 1 development as well as interferon-{gamma} production by T helper 1 cells. Eur. J. Immunol. 26:659.[Medline]
  12. Stockinger, B., T. Zal, A. Zal, D. Gray. 1995. B cells solicit their own help. J. Exp. Med. 183:891.[Abstract/Free Full Text]
  13. Mason, D. The role of B cells in the programming of T cells for IL-4 synthesis. J. Exp. Med. 183:717.
  14. Saoudi, A., S. Simmonds, I. Huitinga, D. Mason. 1995. Prevention of experimental allergic encephalomyelitis in rats by targeting autoantigen to B cells: evidence that the protective mechanism depends on changes in the cytokine response and migratory properties of the autoantigen-specific T cells. J. Exp. Med. 182:335.[Abstract/Free Full Text]
  15. Macauley, A. E., R. H. DeKruyff, C. C. Goodnow, D. T. Umetsu. 1997. Antigen-specific B cells preferentialy induce CD4+ T cells to produce IL-4. J. Immunol. 158:4171.[Abstract]
  16. Rincon, M., J. Anguita, T. Nakamura, E. Fikrig, R. A. Flavell. 1997. Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells. J. Exp. Med. 185:461.[Abstract/Free Full Text]
  17. Hsieh, C.-S., A. B. Heimberger, J. S. Gold, A. O’Garra, K. M. Murphy. 1992. Differential regulation of T helper phenotype development by interleukins 4 and 10 in an {alpha}-ß T-cell-receptor transgenic system. Proc. Natl. Acad. Sci. USA 89:6065.[Abstract/Free Full Text]
  18. Pistoia, V.. 1997. Production of cytokines by human B cells in health and disease. Immunol. Today 18:343.[Medline]
  19. Liu, Y.-J., P. J. L. Lane, E. Y.-T. Chan, I. C. M. MacLennan. 1992. Sites of specific B cell activation in primary and secondary responses to T cell-dependent and T cell-independent antigens. Eur. J. Immunol. 21:2951.
  20. Jacob, J., R. Kassir, G. Kelsoe. 1991. In situ studies of the primary immune response to (4-hydroxy-3-nitropheny) acetyl. I. Architecture and dynamics of responding cell populations. J. Exp. Med. 173:1165.[Abstract/Free Full Text]
  21. Sornasse, T., V. Flamand, M. de Becker, H. Bazin, K. Tielemans, J. Urbain, L. Oberdan, M. Moser. 1992. Antigen-pulsed dendritic cells can efficiently induce an antibody response in vivo. J. Exp. Med. 175:15.[Abstract/Free Full Text]
  22. Dubois, B., B. Vanbervliet, J. Fayette, C. Massacrier, C. van Kooten, F. Brière, J. Banchereau, C. Caux. 1997. Dendritic cells enhance growth and differentiation of CD40-activated B lymphocytes. J. Exp. Med. 185:941.[Abstract/Free Full Text]
  23. Wykes, M., A. Pombo, C. Jenkins, G. G. MacPherson. 1998. Dendritic cells interact directly with naive B lymphocytes to transfer antigen and initiate class switching in a primary T-dependent response. J. Immunol. 161:1313.[Abstract/Free Full Text]
  24. Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto, H. Kikutani. 1994. The immune responses in CD40-deficient mice: Impaired immunoglobulin calls switching and germinal center formation. Immunity 1:167.[Medline]
  25. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+ CD8+TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  26. Magram, J., S. E. Connaughton, R. R. Warrier, D. M. Carvajal, C. Y. Wu, J. Ferrante, C. Stewart, U. Sarmiento, D. A. Faherty, M. K. Gately. 1996. IL-12-deficient mice are defective in IFN {gamma} production and type 1 cytokine responses. Immunity 4:471.[Medline]
  27. Rolink, A., F. Melchers, J. Andersson. 1996. The SCID but not the RAG-2 gene product is required for S µ-S epsilon heavy chain class switching. Immunity 5:319.[Medline]
  28. Kosco-Vilbois, M. H., D. Gray, D. Scheidegger, M. Julius. 1993. Follicular dendritic cells help resting B cells to become effective antigen-presenting cells: induction of B7/BB1 and up-regulation of major histocompatibility complex class II molecules. J. Exp. Med. 178:2055.[Abstract/Free Full Text]
  29. Livingstone, A. 1997. Use of mouse dendritic cells to prime T cell responses in vivo. In Immunology Methods Manual. I. Lefkovits, ed. Academic Press, London, p. 1456.
  30. Poudrier, J., D. van Essen, S. Morales-Alcelay, T. Leanderson, S. Berthorsdottir, D. Gray. 1998. CD40 ligand signals optimize T helper cell cytokine production: role in Th2 development and induction of germinal centers. Eur. J. Immunol 28:3371.[Medline]
  31. Karasayama, H., F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukins 2, 3, 4 or 5 using modified cDNA expression vectors. Eur. J. Immunol. 18:97.[Medline]
  32. Morel, P. A., A. M. Livingstone, C. G. Fathman. 1987. Correlation of T cell receptor Vß gene family with MHC restriction. J. Exp. Med. 166:583.[Abstract/Free Full Text]
  33. Legoux, P., C. Minty, B. Delpech, A. J. Minty, D. Shire. 1992. Simultaneous quantitation of cytokine mRNAs in interleukin-1 ß stimulated U373 human astrocytoma cells by a polymerisation chain reaction method involving co-amplification with an internal multi-specific control. Eur. Cytokine Network 3:553.[Medline]
  34. Zal, T., A. Volkmann, B. Stockinger. 1994. Mechanisms of tolerance induction in major histocompatibility complex class II-restricted T cells specific for a blood-borne self-antigen. J. Exp. Med. 180:2089.[Abstract/Free Full Text]
  35. Cella, M., D. Scheidegger, L. K. Palmer, P. Lane, A. Lanzavecchia, G. Alber. 1996. Ligation of CD40 on dendritic cells triggers production of high levels of interleukin-12 and enhances T cell stimulatory capacity: T-T help via APC activation. J. Exp. Med. 184:747.[Abstract/Free Full Text]
  36. Morris, S. C., K. B. Madden, J. J. Adamovicz, W. C. Gause, B. R. Hubbard, M. K. Gately, F. D. Finkelman. 1994. Effects of IL-12 on in vivo cytokine gene expression and Ig isotype selection. J. Immunol. 152:1047.[Abstract]
  37. Meyaard, L., E. Hovencamp, S. A. Otto, F. Miedema. 1996. IL-12-induced IL-10 production by human T cells as a negative feedback for IL-12-induced immune responses. J. Immunol. 156:2776.[Abstract]
  38. Jeannin, P., Y. Delneste, M. Seveso, P. Life, J.-Y. Bonnefoy. 1996. IL-12 synergises with IL-2 and other stimuli in inducing IL-10 production by human T cells. J. Immunol. 156:3159.[Abstract]
  39. Daftarian, P. M., A. Kumar, M. Kryworuchko, F. Diaz-Mitoma. 1996. IL-10 production is enhanced in human T cells by IL-12 and IL-6 and in monocytes by tumour necrosis factor-{alpha}. J. Immunol. 157:12.[Abstract]
  40. Spencer, N. F., R. A. Daynes. 1997. IL-12 directly stimulates expression of IL-10 by CD5+ B cells and IL-6 by both CD5+ and CD5- cells: possible involvement in age-associated cytokine dysregulation. Int. Immunol. 9:745.[Abstract/Free Full Text]
  41. Wang, Z. E., S. Zheng, D. B. Corry, D. K. Dalton, R. Seder, S. L. Reiner, R. M. Locksley. 1994. Interferon {gamma}-independent effects of interleukin-12 administered durinf acute or established infection due to Leishmania major. Proc. Natl. Acad. Sci. USA 91:12932.[Abstract/Free Full Text]
  42. Wynn, T. A., D. Jankovic, S. Heiny, K. Zioncheck, P. Jardieu, A. W. Cheever, A. Sher. 1995. IL-12 exacerbates rather than suppresses T helper 2-dependent pathology in the absence of endogenous IFN-{gamma}. J. Immunol. 154:3999.[Abstract]
  43. Germann, T., S. Guckes, M. Bongartz, H. Dlugonska, E. Schmitt, L. Kolbe, E. Kölsch, F. J. Podlaski, M. K. Gately, E. Rüde. 1995. Administration of IL-12 during ongoing immune responses fails to permanently suppress and can even enhance the synthesis of antigen-specific IgE. Int. Immunol. 7:1649.[Abstract/Free Full Text]
  44. Marinaro, M., P. N. Boyaka, R. J. Jackson, F. D. Finkelman, H. Kiyono, E. Jirillo, J. R. McGee. 1999. Use of intranasal IL-12 to target predominantly Th1 responses to nasal and Th2 responses to oral vaccines given with cholera toxin. J. Immunol. 162:114.[Abstract/Free Full Text]
  45. Boyaka, P. N., M. Marinaro, R. J. Jackson, S. Menon, H. Kiyono, E. Jirillo, J. R. McGee. 1999. IL-12 is an effective adjuvant for induction of mucosal immunity. J. Immunol. 162:122.[Abstract/Free Full Text]
  46. Dubois, B., C. Massacrier, B. Vanbervliet, J. Fayette, F. Brière, J. Banchereau, C. Caux. 1998. Critical role of IL-12 in dendritic cell-induced differentiation of naive B lymphocytes. J. Immunol. 161:2223.[Abstract/Free Full Text]
  47. Maruo, S., M. Oh-hora, H.-J. Ahn, S. Ono, M. Wysocka, Y. Kaneko, H. Yagita, K. Okumura, T. Kishimoto, M. Kobayashi, et al 1997. B cells regulate CD40 ligand-induced IL-12 production in antigen-presenting cells (APC) during T cell/APC interactions. J. Immunol. 158:120.[Abstract]
  48. Jelinek, D. F., J. K. Braaten. 1995. Role of IL-12 in human B lymphocyte proliferation and differentiation. J. Immunol. 154:1606.[Abstract]
  49. Luzzati, A. L., L. Giordani, E. Giacomini. 1997. Interleukin-12 up-regulates the induction of an antigen-specific antibody response in cultures of human lymphocytes. Eur. J. Immunol. 27:2696.[Medline]
  50. Metzger, D. W., R. M. McNutt, J. T. Collins, J. M. Buchanan, V. H. Van Cleave, W. A. Dunnick. 1997. Interleukin-12 acts as an adjuvant for humoral immunity through interferon-{gamma}-dependent and -independent mechanisms. Eur. J. Immunol. 27:1958.[Medline]
  51. Vogel, L. A., L. C. Showe, T. L. Lester, R. M. McNutt, V. H. Van Cleave, D. M. Metzger. 1996. Direct binding of IL-12 to human and mouse B lymphocytes. Int. Immunol. 8:1955.[Abstract/Free Full Text]
  52. Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler, D. H. Presky. 1998. The interleukin-12/interleukin-12-receptor system: Role in normal and pathologic immune responses. Annu. Rev. Immunol. 16:495.[Medline]
  53. Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately, U. Gubler. 1996. A functional interleukin 12 receptor complex is composed of two ß type cytokine receptor subunits. Proc. Natl. Acad. Sci. USA 93:14002.[Abstract/Free Full Text]
  54. Zou, J., D. H. Presky, C. Y. Wu, U. Gubler. 1997. Differential associations between the cytoplasmic regions of the interleukin 12 receptor subunits ß1 and ß2 and JAK kinases. J. Biol. Chem. 272:6073.[Abstract/Free Full Text]
  55. Letterio, J. L., A. B. Roberts. 1998. Regulation of immune responses by TGF-ß. Annu. Rev. Immunol. 16:137.[Medline]
  56. Schmitt, E., P. Hoehn, C. Huels, S. Goedert, N. Palm, E. Rude, T. Germann. 1994. T helper type 1 development of naive CD4+ T cells requires co-ordinate action of interleukin-12 and interferon-{gamma} and is inhibited by transforming growth factor-ß. Eur. J. Immunol. 24:793.[Medline]
  57. Szabo, S. J., A. S. Dighe, U. Gubler, K. M. Murphy. 1997. Regulation of interleukin (IL)-12R ß2 subunit expression in developing T helper (Th1) and Th2 cells. J. Exp. Med. 185:817.[Abstract/Free Full Text]
  58. Rogge, L., L. Barberis-Maino, M. Biffi, N. Passini, D. H. Presky, U. Gubler, F. Sinigaglia. 1997. Selective expression of an interleukin-12 receptor component by human T helper 1 cells. J. Exp. Med. 185:825.[Abstract/Free Full Text]
  59. Snapper, C. M., W. Waegell, H. Beernink, J. R. Dasch. 1993. Transforming growth factor-ß is required for secretion of IgG of all subclasses by LPS-activated murine B cells in vitro. J. Immunol. 151:4625.[Abstract]
  60. Pasparakis, M., L. Alexopoulou, V. Episkopou, G. Kollias. 1996. Immune and inflammatory responses in TNF {alpha}-deficient mice: a critical requirement for TNF {alpha} in the formation of primary B cell follicles, follicular dendritic cell networks and germinal centers, and in the maturation of the humoral immune response. J. Exp. Med. 184:1397.[Abstract/Free Full Text]
  61. Mackay, F., J. L. Browning. 1998. Turning off follicular dendritic cells. Nature 395:26.[Medline]
  62. Becher, B., M. Blain, P. S. Giacomini, J. P. Antel. 1999. Inhibition of Th1 polarization by soluble TNF receptor is dependent on antigen-presenting cell-derived IL-12. J. Immunol. 162:684.[Abstract/Free Full Text]
  63. Flynn, S., K. M. Toellner, C. Raykundalia, M. Goodall, P. Lane. 1998. CD4 T cell cytokine differentiation: the B cell activation molecule, OX40 ligand, instructs CD4 T cells to express interleukin 4 and upregulates expression of the chemokine receptor, Blr-1. J. Exp. Med. 188:297.[Abstract/Free Full Text]
  64. Ronchese, F., B. Hausmann, G. Le Gros. 1994. Interferon-{gamma}- and interleukin-4-producing T cells can be primed on dendritic cells in vivo and do not require the presence of B cells. Eur. J. Immunol. 24:1148.[Medline]
  65. Sher, A., R. L. Coffman. 1992. Regulation of immunity to parasites by T cells and T cell-derived cytokines. Annu. Rev. Immunol. 10:385.[Medline]
  66. Epstein, M. M., F. Di Rosa, D. Jankovic, A. Sher, P. Matzinger. 1995. Successful priming in B cell-deficient mice. J. Exp. Med. 182:915.[Abstract/Free Full Text]
  67. Sabin, E. A., M. A. Kopf, and E. J. Pearce. 1996. Schistosoma mansoni egg-induced early IL-4 production is dependent upon IL-5 and eosinophils. J. Exp. Med. 184:1871.
  68. Rissoan, M.-C., V. Soumelis, N. Kadowaki, G. Grouard, F. Brière, R. de Waal Malefyt, and Y.-J. Liu. 1999. Reciprocal control of helper cell and dendritic cell differentiation. Science 283:1183.



This article has been cited by other articles:


Home page
 J. Immunol.Home page
V. Lampropoulou, K. Hoehlig, T. Roch, P. Neves, E. C. Gomez, C. H. Sweenie, Y. Hao, A. A. Freitas, U. Steinhoff, S. M. Anderton, et al.
TLR-Activated B Cells Suppress T Cell-Mediated Autoimmunity
J. Immunol., April 1, 2008; 180(7): 4763 - 4773.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Sun, K. Arias, D. Alvarez, R. Fattouh, T. Walker, S. Goncharova, B. Kim, S. Waserman, J. Reed, A. J. Coyle, et al.
Impact of CD40 Ligand, B Cells, and Mast Cells in Peanut-Induced Anaphylactic Responses
J. Immunol., November 15, 2007; 179(10): 6696 - 6703.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
G. Perona-Wright, S. M. Anderton, S. E. M. Howie, and D. Gray
IL-10 permits transient activation of dendritic cells to tolerize T cells and protect from central nervous system autoimmune disease
Int. Immunol., September 1, 2007; 19(9): 1123 - 1134.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Pathol.Home page
M. Hasegawa, Y. Hamaguchi, K. Yanaba, J.-D. Bouaziz, J. Uchida, M. Fujimoto, T. Matsushita, Y. Matsushita, M. Horikawa, K. Komura, et al.
B-Lymphocyte Depletion Reduces Skin Fibrosis and Autoimmunity in the Tight-Skin Mouse Model for Systemic Sclerosis
Am. J. Pathol., September 1, 2006; 169(3): 954 - 966.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Crawford, M. MacLeod, T. Schumacher, L. Corlett, and D. Gray
Primary T Cell Expansion and Differentiation In Vivo Requires Antigen Presentation by B Cells
J. Immunol., March 15, 2006; 176(6): 3498 - 3506.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
D. Grdic, L. Ekman, K. Schon, K. Lindgren, J. Mattsson, K.-E. Magnusson, P. Ricciardi-Castagnoli, and N. Lycke
Splenic Marginal Zone Dendritic Cells Mediate the Cholera Toxin Adjuvant Effect: Dependence on the ADP-Ribosyltransferase Activity of the Holotoxin
J. Immunol., October 15, 2005; 175(8): 5192 - 5202.
[Abstract] [Full Text] [PDF]