The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solomon, K. A.
Right arrow Articles by Newton, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solomon, K. A.
Right arrow Articles by Newton, R. C.
The Journal of Immunology, 1999, 163: 4105-4108.
Copyright © 1999 by The American Association of Immunologists


CUTTING EDGE

Cutting Edge: A Dominant Negative Form of TNF-{alpha} Converting Enzyme Inhibits ProTNF and TNFRII Secretion

Kimberly A. Solomon, Nancy Pesti, Guoxin Wu and Robert C. Newton

Department of Inflammatory Diseases Research, DuPont Pharmaceuticals Company, Wilmington, DE 19880


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
TNF-{alpha} converting enzyme (TACE) is the protease responsible for processing proTNF from the 26-kDa membrane-anchored precursor to the secreted 17-kDa TNF-{alpha}. We show here that a deletion mutant of TACE (dTACE), lacking the pro and catalytic domains of the protease, acts as a dominant negative for proTNF processing in transfected HEK293 cells. We used the same system to test the effect of dTACE on TNFRII processing. Overexpression of dTACE with TNFRII resulted in >80% inhibition of TNFRII shedding. Although significant inhibition of TNF-{alpha} and TNFRII shedding was achieved with dTACE, we could not detect a cell surface accumulation of the noncleaved substrates above that observed in the absence of dTACE. Our results suggest that TNFRII is a substrate for TACE, and that dTACE is capable of interfering with the function of endogenous TACE, either by binding and sequestering TACE substrates via the disintegrin domain, transmembrane domain, or cytoplasmic tail, or by some other mechanism that has yet to be determined.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Many functionally diverse proteins are synthesized as membrane-anchored precursors that are released from the cell by a regulated process of proteolysis. This shedding process, which often occurs after cell activation (1, 2), can rapidly modulate cell surface responsiveness to external signals as well as release soluble regulatory factors. The shedding of many proteins (2, 3, 4, 5) is blocked by hydroxamic acid-based inhibitors, implying that the enzyme(s) that mediates the release belongs to the zinc-metalloprotease family. It is not yet known whether membrane protein shedding is mediated by several enzyme activities or through a single protein functioning as a general "sheddase."

One of the most extensively studied shedding events is the release of soluble TNF-{alpha} (TNF), a pleiotropic cytokine produced primarily by macrophages and T cells (3, 4, 5). TNF is synthesized as a membrane-anchored 26-kDa precursor (proTNF) that is cleaved to the secreted 17-kDa form. The release of soluble TNF initiates a diverse array of inflammatory and immune modulatory activities necessary for host defense. Clinical interest in TNF has stemmed from its known pathophysiological role in systemic responses (6).

ProTNF cleavage is one of the few shedding events for which a processing enzyme has been identified. TNF-{alpha} converting enzyme (TACE)2 is a member of the metalloprotease-disintegrin family of membrane-anchored glycoproteins (7, 8). Its role in proTNF processing has been supported by studies using chimeric mice that are null for TACE activity (7). T cells derived from these mice express a form of TACE that lacks a portion of the catalytic domain and are unable to process proTNF. Recent reports indicate that the shedding of other cell surface proteins is also hindered in this background (9, 10). Because TACE is expressed in these cells, albeit in an enzymatically inactive state, it is unclear whether the effects are due to the absence of TACE activity or to a dominant negative effect on all metalloprotease-mediated cleavages. In this study, we show that a mutant form of TACE lacking the pro and catalytic domains of the protease (referred to as dTACE) acts as a dominant negative for proTNF and TNFRII processing. Possible mechanisms by which all or part of the disintegrin, transmembrane, and cytoplasmic tail regions of dTACE inhibit endogenous TACE function could involve a direct binding and sequestering of TACE substrates or the indirect inhibition of endogenous TACE activation.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Plasmid constructs

Full-length proTNF cDNA was PCR amplified from RNA purified from LPS-treated monocytes and cloned into the mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA). Recombinant TACE (11) was used as a template to generate a PCR fragment encoding the disintegrin, transmembrane, and cytoplasmic tail regions of enzyme. The 5' (AAGCTTAGCAATAAAGTTTGTGGGAAC) primer included a HindIII site, and the 3' (TCTAGATTAGCACTGTGTTTCTTTGC) primer included an XbaI site for cloning into the pFLAG/CMV1 expression vector (Eastman Kodak, Rochester, NY). Full-length TNFRII was PCR amplified from LPS-treated monocytes and subcloned into the HindIII/XbaI site of pcDNA3.

Cell culture and transfection experiments

HEK293 cells (American Type Culture Collection, Manassas, VA) were grown in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FBS (HyClone, Logan, UT), 2 mM glutamine, and penicillin G/streptomycin (Life Technologies, Gaithersburg, MD). Transfections were conducted using lipofectamine reagent (Life Technologies). HEK293 cells (2 x 106) were seeded onto 100-mM tissue culture dishes 24 h before transfection. Cells were washed with OPTI-MEM I reduced serum medium (Life Technologies), incubated with the transfection mixture (10 µg of DNA and 50 µl of lipofectamine reagent) for 6 h at 37°C in a CO2 incubator, and washed once with PBS before being replaced with RPMI 1640 growth medium. Cells were washed at 24 h posttransfection before fresh medium was added. Soluble TNF and TNFRII were allowed to accumulate in the culture medium for 24 or 8 h, respectively, before culture supernatant harvest. For transfections with proTNF or TNFRII cDNA, a total of 1 µg of each of these DNAs was added to 9 µg of pcDNA3.1 carrier DNA. Cotransfection of proTNF or TNFRII with dTACE cDNA was conducted using 9 µg of dTACE cDNA with 1 µg of either proTNF or TNFRII cDNA.

TNF and TNFRII ELISA

The level of secreted TNF produced from transfected HEK293 cells was quantitated by ELISA (12). Soluble TNFRII was quantitated using the human soluble TNFRII Quantikine immunoassay from R&D Systems (Minneapolis, MN).

Analysis of proTNF-{alpha} and TNFRII cell surface expression

ProTNF-transfected HEK293 cells were lifted from plates at 48 h posttransfection (1x EDTA/trypsin (Life Technologies)), washed with PBS, and resuspended at 5 x 106 cells/ml. Cells (5 x 105) were incubated with either 10 µg/ml of TNF-specific mAb or an isotype-matched mouse IgG (mIgG) for 30 min at 4°C, washed with PBS, and treated with a PE-conjugated goat anti-mouse IgG (Chemicon, Temecula, CA). Cells were washed once before resuspension in PBS and analysis on a Becton Dickinson FACScan (Mountain View, CA). The Abs MAB266 (R&D) and M2 (Sigma, Costa Mesa, CA) were used to characterize the expression of TNFRII and dTACE, respectively.

Metabolic cell labeling and immunoprecipitation

Metabolic labeling and immunoprecipitation experiments were conducted as described previously (12). HEK293 cells, transfected with either proTNF alone or in combination with dTACE, were harvested (2 x 106 each) at 48 h posttransfection and pulse-labeled with [35S]cysteine for 30 min before lysis. Immunoprecipitations were conducted using the TNF-specific polyclonal Ab Rb504. Immunoprecipitates were subjected to electrophoresis in a 14% SDS-polyacrylamide gel and visualized by autoradiography.


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
In this study, we sought to further investigate whether TACE, in addition to its known role in proTNF processing, could mediate the shedding of other membrane proteins. For these studies we chose TNFRII as a candidate for TACE processing, because the cell surface release of TNFRII and TNF occur concurrently, are similarly sensitive to inhibition by the hydroxamate TAPI (5), and possess a similar cleavage site (alanine-valine). Our approach was to express a mutant form of TACE that we hypothesized would act as a dominant negative for endogenous TACE activity, previously shown to exist in HEK293 cells (13). We designed our TACE mutant construct after an N-terminal truncation of the homologous Kuzbanian protein (14), which encoded only the disintegrin, transmembrane, and cytoplasmic tail regions of the enzyme. This proteolytically inactive mutant acted as a dominant negative form for Notch processing in Drosophila. PCR amplification of a comparable fragment of TACE was performed using recombinant full-length TACE as a template, and the sequence structure proposed by Black et al. (7) as a guide for domain delineation. The resultant product (encoding amino acids S 474 to C 824) was cloned into the pFLAG/CMV1 vector, which drives the expression of a TACE fusion protein containing an N-terminal preprotrypsin signal sequence followed by the 8-aa FLAG tag. We refer to this mutant form of TACE as dTACE.

Before testing the functional activity of dTACE, we confirmed endogenous TACE activity in HEK293 cells using criteria described previously (13). Furthermore, because recent reports implicate ADAM 10 as a TNF convertase (15, 16), we analyzed the HEK293 cells for ADAM 10 expression by RT-PCR. HEK293 cells express ADAM 10 at levels comparable with that expressed in human peripheral blood monocytes (data not shown). Therefore, HEK293 cells express at least two convertases reported to be capable of cleaving proTNF.

Given this information, we used the HEK293 background to test the effect of dTACE expression on proTNF processing. Recombinant proTNF was transfected into HEK293 cells with or without dTACE cDNA. TNF secretion into the culture supernatant was quantified after an accumulation period of 24 h. HEK293 cells, on average, produced 18.5 ng/ml (range 11.5–25 ng/ml/4 x 106 cells) of soluble TNF when transfected with 1 µg of proTNF cDNA (Fig. 1Go). This level of TNF secretion was reduced by 84% in cells overexpressing the mutant dTACE, which was comparable with that obtained with hydroxamic acid-based metalloprotease inhibitor treatment. Addition of PMA, which increased the soluble TNF released from TNF transfected cells by 128%, did not overcome the inhibitory effects of dTACE on the metalloprotease-mediated cleavage of proTNF (data not shown). The inhibition of proTNF secretion occurred in a dTACE dose-dependent manner, because decreasing the amount of dTACE cDNA from 9 µg to 0.5 µg reduced the inhibitory effect from 90% to 30%, respectively (Fig. 2Go). We confirmed the expression of dTACE and proTNF in each of the transfection experiments by monitoring the cell surface levels of each protein by immunofluorescence labeling (Fig. 3Go).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of dTACE on TNF secretion. HEK293 cells were transfected with proTNF cDNA in combination with either pcDNA3.1 (proTNF alone) or dTACE cDNA (proTNF + dTACE). ProTNF + HA represents HEK293 cells transfected with proTNF (plus carrier) and treated with a broad-based hydroxamic acid for 24 h before supernatant harvest. Data are a compilation of nine separate experiments.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 2. Dose-dependent inhibition of TNF secretion by dTACE. The percentage of inhibition of TNF-{alpha} production from HEK293 cells transfected with proTNF (1 µg) and increasing amounts of dTACE cDNA (0, 0.5, 1, 2, 4, 5, and 9 µg) is shown.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Cell surface expression of proTNF and dTACE in cotransfected cells. Cells were incubated either with mIgG or anti-TNF-{alpha} mAb (A) or with mIgG or anti-FLAG (dTACE) mAb (B) for 30 min before incubation with anti-mouse PE Ab and visualization by flow cytometry.

 
To ensure that the inhibitory effects of dTACE on TNF secretion were due to the presence of the mutant form of TACE and not to reduced proTNF substrate in cells expressing two recombinant proteins, we metabolically labeled proTNF and proTNF/dTACE transfected cells before lysis and immunoprecipitation of proTNF protein. The precipitates were analyzed on a SDS gel and visualized by autoradiography (Fig. 4Go). The results indicate that cells transfected with proTNF alone or in combination with dTACE express comparable levels of proTNF protein. We conclude that the reduced level of TNF secretion from cells expressing dTACE is not due to reduced proTNF protein synthesis but rather is due to a true inhibition of proTNF processing.



View larger version (76K):
[in this window]
[in a new window]
 
FIGURE 4. Comparison of TNF expression by proTNF and proTNF + dTACE transfectants. ProTNF (1) or proTNF + dTACE (2) transfected cells were pulsed with [35S]cysteine before lysis, immunoprecipitation, and analysis by SDS-PAGE and autoradiography.

 
Thus, an N-terminal truncation of TACE, comprising the disintegrin, transmembrane, and cytoplasmic tail region of the enzyme, is capable of preventing the processing of proTNF by endogenous TACE and, presumably, ADAM 10 in HEK293 cells. Therefore, we classify dTACE as dominant negative for metalloprotease-mediated cleavage of proTNF in this cellular background.

We subsequently tested the effect of dTACE on the release of soluble TNFRII from transfected HEK293 cells. HEK293 cells constitutively secrete TNFRII at an average (n = 2) level of 1.43 ng/ml/4 x 106 cells over the 8-h accumulation period when transfected with recombinant TNFRII alone (Fig. 5Go). Coexpression of dTACE with TNFRII resulted in an 88% reduction in the level of soluble TNFRII released (Fig. 5Go), which was comparable with that obtained in the presence of PMA (data not shown). The cell surface expression of TNFRII and dTACE was confirmed in each of the transfections by immunofluorescent staining followed by FACScan analysis (Fig. 6Go). These data indicate that dTACE can inhibit the proteolytic release of both proTNF and TNFRII.



View larger version (45K):
[in this window]
[in a new window]
 
FIGURE 5. Effect of dTACE on TNFRII secretion. HEK293 cells were transfected with TNFRII cDNA alone or with dTACE cDNA. Soluble TNFRII was allowed to accumulate for 8 h before quantification (ELISA). Data represent a compilation of three separate experiments.

 


View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 6. Cell surface expression of TNFRII and dTACE in cotransfected cells. Cells incubated either with mIgG or anti-TNFRII mAb (A) or with mIgG and anti-FLAG (dTACE) mAb (B) before incubation with anti-mouse PE Ab and visualization by flow cytometry are shown.

 
Because one of the consequences of inhibiting the shedding of membrane-bound proteins is the potential for accumulation on the cell surface, we used flow cytometry to probe the effect of dTACE on proTNF and TNFRII cell surface expression (Table IGo). Transfection of HEK293 cells with either proTNF or TNFRII cDNA resulted in a significant increase in the geometric mean fluorescence values over background. Interestingly, we could not detect a measurable increase in the cell surface expression of proTNF or TNFRII with coexpression of dTACE under conditions that inhibited release into the media by ~90%. Therefore, inhibition of TNFRII and proTNF shedding by dTACE does not induce an accumulation of cell surface expression of either of these proteins over that observed in cells lacking the dominant negative form of TACE. In a previous report, we provided evidence for rapid degradation of unprocessed proTNF in LPS-stimulated monocytes treated with hydroxamic-based metalloprotease inhibitors (12). It appears that the proTNF and TNFRII transfected HEK293 cells may invoke a similar mechanism of degradation of noncleaved substrates.


View this table:
[in this window]
[in a new window]
 
Table I. Effect of dTACE on proTNF and TNFRII cell surface expression1

 
In summary, these results indicate that an N-terminally truncated and enzymatically inactive form of TACE is capable of inhibiting metalloprotease-mediated cleavage of proTNF and TNFRII in a cellular background that expresses endogenous TACE as well as other family members shown to be capable of processing proTNF (i.e., ADAM 10). The dominant negative effects we observed are likely due to the interaction of all or part of the disintegrin, transmembrane, and cytoplasmic tail of TACE with proTNF and TNFRII, thereby preventing association and cleavage by the endogenous metalloprotease activity. However, because a direct association of TACE with the two substrates remains to be established, alternative explanations for the observed effects are possible, including an inhibition of TACE activation by cytoplasmic proteins such as protein kinases or the sequestering of cofactors required for enzyme activity. The mechanism of inhibition, as well as the minimal portion of TACE required for these effects, will need to be probed with further experimentation. Finally, because we know that an enzymatically inactive form of TACE can act as a dominant negative, it is possible that the global inhibition of shedding events observed in cells derived from chimeric mice described by Black and colleagues. (7, 9, 10) may be due to similar dominant negative effects. The role of TACE in cell surface protein shedding must therefore await the generation of mice proven to be completely deficient in TACE expression.


    Acknowledgments
 
We thank Sherrill Nurnberg, Persymphonie Miller, and Xiaosui Jiang for excellent technical assistance.


    Footnotes
 
1 Address correspondence and reprint requests to Dr. Kimberly A. Solomon, Department of Inflammatory Diseases Research, E400-4241, DuPont Pharmaceuticals Company, P.O. Box 80400, Wilmington, DE 19880-0400. Back

2 Abbreviations used in this paper: TACE, TNF-{alpha} converting enzyme; dTACE, deletion mutant of TACE; TNFRII, TNF receptor II; mIg, mouse Ig; ADAM, a disintegrin and metalloprotease; TAPI, TNF-{alpha} protease inhibitor (N-{DL-[2-(hydroxyaminocarbonyl)methyl]-4-methylpentanoyl}-L-3-(2[prime]-naphthyl)alanyl-L-alanine, 2-aminoethylamide); FLAG, marker octapeptide (N-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-C). Back

Received for publication May 6, 1999. Accepted for publication August 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Hooper, N. M., E. H. Karran, A. J. Turner. 1997. Membrane protein secretases. Biochem. J. 321:265.
  2. Heaney, M. L., D. W. Golde. 1998. Soluble receptors in human disease. J. Leukocyte Biol. 64:135.[Abstract]
  3. Gearing, A., P. Beckett, M. Christodoulou, M. Churchill, J. Clements, A. Davidson, A. Drummond, W. Galloway, R. Gilbert, J. Gordon, et al 1994. Processing of tumour necrosis factor-{alpha} precursor by metalloproteinases. Nature 370:555.[Medline]
  4. McGeehan, G., J. Becherer, Jr R. Bast, C. Boyer, B. Champion, K. Connolly, J. Conway, P. Furdon, S. Karp, S. Kidao, et al 1994. Regulation of tumour necrosis factor-{alpha} processing by a metalloproteinase inhibitor. Nature 370:558.[Medline]
  5. Crowe, P. D., B. N. Walter, K. M. Mohler, C. Otten-Evans, R. A. Black, C. F. Ware. 1995. A metalloprotease inhibitor blocks shedding of the 80-kDa TNF receptor and TNF processing in T lymphocytes. J. Exp. Med. 181:1205.[Abstract/Free Full Text]
  6. Eigler, A., B. Sinha, G. Hartmann, S. Endres. 1997. Taming TNF: strategies to restrain this proinflammatory cytokine. Immunol. Today 18:487.[Medline]
  7. Black, R. A., C. T. Rauch, C. J. Kozlosky, J. J. Peschon, J. L. Slack, M. F. Wolfson, B. J. Castner, K. L. Stocking, P. Reddy, S. Srinivasan, et al 1997. A metalloproteinase disintegrin that releases tumour-necrosis factor-{alpha} from cells. Nature 385:729.[Medline]
  8. Moss, M., S. Jin, M. Milla, W. Burkhart, H. Carter, W. Chen, W. Clay, J. Didsbury, D. Hassler, C. Hoffman, et al 1997. Cloning of a disintegrin metalloproteinase that processes precursor tumour-necrosis factor-{alpha}. Nature 385:733.[Medline]
  9. Buxbaum, J. D., K. N. Liu, Y. Luo, J. L. Slack, K. L. Stocking, J. J. Peschon, R. S. Johnson, B. J. Castner, D. P. Cerretti, R. A. Black. 1998. Evidence that tumor necrosis factor {alpha} converting enzyme is involved in regulated {alpha}-secretase cleavage of the Alzheimer amyloid protein precursor. J. Biol. Chem. 273:27765.[Abstract/Free Full Text]
  10. Peschon, J. J., J. L. Slack, P. Reddy, K. L. Stocking, S. W. Sunnarborg, D. C. Lee, W. E. Russell, B. J. Castner, R. S. Johnson, J. N. Fitzner, et al 1998. An essential role for ectodomain shedding in mammalian development. Science 282:1281.[Abstract/Free Full Text]
  11. Patel, I. R., M. G. Attur, R. N. Patel, S. A. Stuchin, R. A. Abagyan, S. B. Abramson, A. R. Amin. 1998. TNF-{alpha} convertase enzyme from human arthritis-affected cartilage: isolation of cDNA by differential display, expression of the active enzyme, and regulation of TNF-{alpha}. J. Immunol. 160:4570.[Abstract/Free Full Text]
  12. Solomon, K. A., M. B. Covington, C. P. DeCicco, R. C. Newton. 1997. The fate of pro-TNF-{alpha} following inhibition of metalloprotease-dependent processing to soluble TNF-{alpha} in human monocytes. J. Immunol. 159:4524.[Abstract]
  13. Glaser, K. B., M. Falduto, R. Metzger, T. Pederson, L. Pease, K. Shiosaki, D. W. Morgan. 1997. Expression, release, and regulation of human TNF {alpha} from stable transfectants of HEK-293 cells. Inflamm. Res. 46:(Suppl. 2):S127.
  14. Pan, D., G. M. Rubin. 1997. Kuzbanian controls proteolytic processing of Notch and mediates lateral inhibition during Drosophila and vertebrate neurogenesis. Cell 90:271.[Medline]
  15. Lunn, C. A., X. Fan, B. Dalie, K. Miller, P. J. Zavodny, S. K. Narula, D. Lundell. 1997. Purification of ADAM 10 from bovine spleen as a TNF{alpha} convertase. FEBS Lett. 400:333.[Medline]
  16. Rosendahl, M., S. Ko, D. Long, M. Brewer, B. Rosenzweig, E. Hedl, L. Anderson, S. Pyle, J. Moreland, M. Meyers, et al 1997. Identification and characterization of a pro-tumor necrosis factor-{alpha}-processing enzyme from the ADAM family of zinc metalloproteases. J. Biol. Chem. 272:24588.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
K. Horiuchi, T. Miyamoto, H. Takaishi, A. Hakozaki, N. Kosaki, Y. Miyauchi, M. Furukawa, J. Takito, H. Kaneko, K. Matsuzaki, et al.
Cell Surface Colony-Stimulating Factor 1 Can Be Cleaved by TNF-{alpha} Converting Enzyme or Endocytosed in a Clathrin-Dependent Manner
J. Immunol., November 15, 2007; 179(10): 6715 - 6724.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Canault, A. S. Leroyer, F. Peiretti, G. Leseche, A. Tedgui, B. Bonardo, M.-C. Alessi, C. M. Boulanger, and G. Nalbone
Microparticles of Human Atherosclerotic Plaques Enhance the Shedding of the Tumor Necrosis Factor-{alpha} Converting Enzyme/ADAM17 Substrates, Tumor Necrosis Factor and Tumor Necrosis Factor Receptor-1
Am. J. Pathol., November 1, 2007; 171(5): 1713 - 1723.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Chalaris, B. Rabe, K. Paliga, H. Lange, T. Laskay, C. A. Fielding, S. A. Jones, S. Rose-John, and J. Scheller
Apoptosis is a natural stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of neutrophils
Blood, September 15, 2007; 110(6): 1748 - 1755.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. A. Lemieux, F. Blumenkron, N. Yeung, P. Zhou, J. Williams, A. C. Grammer, R. Petrovich, P. E. Lipsky, M. L. Moss, and Z. Werb
The Low Affinity IgE Receptor (CD23) Is Cleaved by the Metalloproteinase ADAM10
J. Biol. Chem., May 18, 2007; 282(20): 14836 - 14844.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Ringel, R. Jesnowski, N. Moniaux, J. Luttges, J. Ringel, A. Choudhury, S. K. Batra, G. Kloppel, and M. Lohr
Aberrant Expression of a Disintegrin and Metalloproteinase 17/Tumor Necrosis Factor-{alpha} Converting Enzyme Increases the Malignant Potential in Human Pancreatic Ductal Adenocarcinoma.
Cancer Res., September 15, 2006; 66(18): 9045 - 9053.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. M. Soond, B. Everson, D. W. H. Riches, and G. Murphy
ERK-mediated phosphorylation of Thr735 in TNF{alpha}-converting enzyme and its potential role in TACE protein trafficking
J. Cell Sci., June 1, 2005; 118(11): 2371 - 2380.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
C. A. Buckley, F. N. Rouhani, M. Kaler, B. Adamik, F. I. Hawari, and S. J. Levine
Amino-terminal TACE prodomain attenuates TNFR2 cleavage independently of the cysteine switch
Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1132 - L1138.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
P. W.M. Fedak, D. S. Smookler, Z. Kassiri, N. Ohno, K. J. Leco, S. Verma, D. A.G. Mickle, K. L. Watson, C. V. Hojilla, W. Cruz, et al.
TIMP-3 Deficiency Leads to Dilated Cardiomyopathy
Circulation, October 19, 2004; 110(16): 2401 - 2409.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. M. Powell, J. Wicks, J. W. Holloway, S. T. Holgate, and D. E. Davies
The Splicing and Fate of ADAM33 Transcripts in Primary Human Airways Fibroblasts
Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 13 - 21.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Contin, V. Pitard, T. Itai, S. Nagata, J.-F. Moreau, and J. Dechanet-Merville
Membrane-anchored CD40 Is Processed by the Tumor Necrosis Factor-{alpha}-converting Enzyme: IMPLICATIONS FOR CD40 SIGNALING
J. Biol. Chem., August 29, 2003; 278(35): 32801 - 32809.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
F. Peiretti, P. Deprez-Beauclair, B. Bonardo, H. Aubert, I. Juhan-Vague, and G. Nalbone
Identification of SAP97 as an intracellular binding partner of TACE
J. Cell Sci., May 15, 2003; 116(10): 1949 - 1957.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
M. Pandey, G. Tuncman, G. S. Hotamisligil, and F. Samad
Divergent Roles for p55 and p75 TNF-{alpha} Receptors in the Induction of Plasminogen Activator Inhibitor-1
Am. J. Pathol., March 1, 2003; 162(3): 933 - 941.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
D. F. Seals and S. A. Courtneidge
The ADAMs family of metalloproteases: multidomain proteins with multiple functions
Genes & Dev., January 1, 2003; 17(1): 7 - 30.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Zheng, J. Schlondorff, and C. P. Blobel
Evidence for Regulation of the Tumor Necrosis Factor alpha -Convertase (TACE) by Protein-tyrosine Phosphatase PTPH1
J. Biol. Chem., November 1, 2002; 277(45): 42463 - 42470.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Hirohata, L. W. Wang, M. Miyagi, L. Yan, M. F. Seldin, D. R. Keene, J. W. Crabb, and S. S. Apte
Punctin, a Novel ADAMTS-like Molecule, ADAMTSL-1, in Extracellular Matrix
J. Biol. Chem., March 29, 2002; 277(14): 12182 - 12189.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
R C Newton, K A Solomon, M B Covington, C P Decicco, P J Haley, S M Friedman, and K Vaddi
Biology of TACE inhibition
Ann Rheum Dis, November 1, 2001; 60(90003): iii25 - 32.
[Abstract] [Full Text] [PDF]


Home page
CirculationHome page
A. Deswal, N. J. Petersen, A. M. Feldman, J. B. Young, B. G. White, and D. L. Mann
Cytokines and Cytokine Receptors in Advanced Heart Failure : An Analysis of the Cytokine Database from the Vesnarinone Trial (VEST)
Circulation, April 24, 2001; 103(16): 2055 - 2059.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L.-c. Zhao, M. Shey, M. Farnsworth, and M. O. Dailey
Regulation of Membrane Metalloproteolytic Cleavage of L-selectin (CD62L) by the Epidermal Growth Factor Domain
J. Biol. Chem., August 10, 2001; 276(33): 30631 - 30640.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Solomon, K. A.
Right arrow Articles by Newton, R. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Solomon, K. A.
Right arrow Articles by Newton, R. C.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS