|
|
||||||||
CUTTING EDGE |
Converting Enzyme Inhibits ProTNF and TNFRII Secretion
Department of Inflammatory Diseases Research, DuPont Pharmaceuticals Company, Wilmington, DE 19880
| Abstract |
|---|
|
|
|---|
converting enzyme (TACE) is the protease responsible for
processing proTNF from the 26-kDa membrane-anchored precursor to the
secreted 17-kDa TNF-
. We show here that a deletion mutant of TACE
(dTACE), lacking the pro and catalytic domains of the protease, acts as
a dominant negative for proTNF processing in transfected HEK293 cells.
We used the same system to test the effect of dTACE on TNFRII
processing. Overexpression of dTACE with TNFRII resulted in >80%
inhibition of TNFRII shedding. Although significant inhibition of
TNF-
and TNFRII shedding was achieved with dTACE, we could not
detect a cell surface accumulation of the noncleaved substrates above
that observed in the absence of dTACE. Our results suggest that TNFRII
is a substrate for TACE, and that dTACE is capable of interfering with
the function of endogenous TACE, either by binding and sequestering
TACE substrates via the disintegrin domain, transmembrane domain, or
cytoplasmic tail, or by some other mechanism that has yet to be
determined. | Introduction |
|---|
|
|
|---|
One of the most extensively studied shedding events is the release of
soluble TNF-
(TNF), a pleiotropic cytokine produced primarily by
macrophages and T cells (3, 4, 5). TNF is synthesized as a
membrane-anchored 26-kDa precursor (proTNF) that is cleaved to the
secreted 17-kDa form. The release of soluble TNF initiates a diverse
array of inflammatory and immune modulatory activities necessary for
host defense. Clinical interest in TNF has stemmed from its known
pathophysiological role in systemic responses (6).
ProTNF cleavage is one of the few shedding events for which a
processing enzyme has been identified. TNF-
converting enzyme
(TACE)2 is a member of
the metalloprotease-disintegrin family of membrane-anchored
glycoproteins (7, 8). Its role in proTNF processing has
been supported by studies using chimeric mice that are null for TACE
activity (7). T cells derived from these mice express a
form of TACE that lacks a portion of the catalytic domain and are
unable to process proTNF. Recent reports indicate that the shedding of
other cell surface proteins is also hindered in this background
(9, 10). Because TACE is expressed in these cells, albeit
in an enzymatically inactive state, it is unclear whether the effects
are due to the absence of TACE activity or to a dominant negative
effect on all metalloprotease-mediated cleavages. In this study, we
show that a mutant form of TACE lacking the pro and catalytic
domains of the protease (referred to as dTACE) acts as a dominant
negative for proTNF and TNFRII processing. Possible mechanisms by
which all or part of the disintegrin, transmembrane, and cytoplasmic
tail regions of dTACE inhibit endogenous TACE function could involve a
direct binding and sequestering of TACE substrates or the indirect
inhibition of endogenous TACE activation.
| Materials and Methods |
|---|
|
|
|---|
Full-length proTNF cDNA was PCR amplified from RNA purified from LPS-treated monocytes and cloned into the mammalian expression vector pcDNA3.1 (Invitrogen, Carlsbad, CA). Recombinant TACE (11) was used as a template to generate a PCR fragment encoding the disintegrin, transmembrane, and cytoplasmic tail regions of enzyme. The 5' (AAGCTTAGCAATAAAGTTTGTGGGAAC) primer included a HindIII site, and the 3' (TCTAGATTAGCACTGTGTTTCTTTGC) primer included an XbaI site for cloning into the pFLAG/CMV1 expression vector (Eastman Kodak, Rochester, NY). Full-length TNFRII was PCR amplified from LPS-treated monocytes and subcloned into the HindIII/XbaI site of pcDNA3.
Cell culture and transfection experiments
HEK293 cells (American Type Culture Collection, Manassas, VA) were grown in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FBS (HyClone, Logan, UT), 2 mM glutamine, and penicillin G/streptomycin (Life Technologies, Gaithersburg, MD). Transfections were conducted using lipofectamine reagent (Life Technologies). HEK293 cells (2 x 106) were seeded onto 100-mM tissue culture dishes 24 h before transfection. Cells were washed with OPTI-MEM I reduced serum medium (Life Technologies), incubated with the transfection mixture (10 µg of DNA and 50 µl of lipofectamine reagent) for 6 h at 37°C in a CO2 incubator, and washed once with PBS before being replaced with RPMI 1640 growth medium. Cells were washed at 24 h posttransfection before fresh medium was added. Soluble TNF and TNFRII were allowed to accumulate in the culture medium for 24 or 8 h, respectively, before culture supernatant harvest. For transfections with proTNF or TNFRII cDNA, a total of 1 µg of each of these DNAs was added to 9 µg of pcDNA3.1 carrier DNA. Cotransfection of proTNF or TNFRII with dTACE cDNA was conducted using 9 µg of dTACE cDNA with 1 µg of either proTNF or TNFRII cDNA.
TNF and TNFRII ELISA
The level of secreted TNF produced from transfected HEK293 cells was quantitated by ELISA (12). Soluble TNFRII was quantitated using the human soluble TNFRII Quantikine immunoassay from R&D Systems (Minneapolis, MN).
Analysis of proTNF-
and TNFRII cell surface expression
ProTNF-transfected HEK293 cells were lifted from plates at 48 h posttransfection (1x EDTA/trypsin (Life Technologies)), washed with PBS, and resuspended at 5 x 106 cells/ml. Cells (5 x 105) were incubated with either 10 µg/ml of TNF-specific mAb or an isotype-matched mouse IgG (mIgG) for 30 min at 4°C, washed with PBS, and treated with a PE-conjugated goat anti-mouse IgG (Chemicon, Temecula, CA). Cells were washed once before resuspension in PBS and analysis on a Becton Dickinson FACScan (Mountain View, CA). The Abs MAB266 (R&D) and M2 (Sigma, Costa Mesa, CA) were used to characterize the expression of TNFRII and dTACE, respectively.
Metabolic cell labeling and immunoprecipitation
Metabolic labeling and immunoprecipitation experiments were conducted as described previously (12). HEK293 cells, transfected with either proTNF alone or in combination with dTACE, were harvested (2 x 106 each) at 48 h posttransfection and pulse-labeled with [35S]cysteine for 30 min before lysis. Immunoprecipitations were conducted using the TNF-specific polyclonal Ab Rb504. Immunoprecipitates were subjected to electrophoresis in a 14% SDS-polyacrylamide gel and visualized by autoradiography.
| Results and Discussion |
|---|
|
|
|---|
Before testing the functional activity of dTACE, we confirmed endogenous TACE activity in HEK293 cells using criteria described previously (13). Furthermore, because recent reports implicate ADAM 10 as a TNF convertase (15, 16), we analyzed the HEK293 cells for ADAM 10 expression by RT-PCR. HEK293 cells express ADAM 10 at levels comparable with that expressed in human peripheral blood monocytes (data not shown). Therefore, HEK293 cells express at least two convertases reported to be capable of cleaving proTNF.
Given this information, we used the HEK293 background to test the
effect of dTACE expression on proTNF processing. Recombinant proTNF was
transfected into HEK293 cells with or without dTACE cDNA. TNF secretion
into the culture supernatant was quantified after an accumulation
period of 24 h. HEK293 cells, on average, produced 18.5 ng/ml
(range 11.525 ng/ml/4 x 106 cells) of
soluble TNF when transfected with 1 µg of proTNF cDNA (Fig. 1
). This level of TNF secretion was
reduced by 84% in cells overexpressing the mutant dTACE, which was
comparable with that obtained with hydroxamic acid-based
metalloprotease inhibitor treatment. Addition of PMA, which increased
the soluble TNF released from TNF transfected cells by 128%, did not
overcome the inhibitory effects of dTACE on the
metalloprotease-mediated cleavage of proTNF (data not shown). The
inhibition of proTNF secretion occurred in a dTACE dose-dependent
manner, because decreasing the amount of dTACE cDNA from 9 µg to 0.5
µg reduced the inhibitory effect from 90% to 30%, respectively
(Fig. 2
). We confirmed the expression of
dTACE and proTNF in each of the transfection experiments by monitoring
the cell surface levels of each protein by immunofluorescence labeling
(Fig. 3
).
|
|
|
|
We subsequently tested the effect of dTACE on the release of soluble
TNFRII from transfected HEK293 cells. HEK293 cells constitutively
secrete TNFRII at an average (n = 2) level of 1.43
ng/ml/4 x 106 cells over the 8-h
accumulation period when transfected with recombinant TNFRII alone
(Fig. 5
). Coexpression of dTACE with
TNFRII resulted in an 88% reduction in the level of soluble TNFRII
released (Fig. 5
), which was comparable with that obtained in the
presence of PMA (data not shown). The cell surface expression of TNFRII
and dTACE was confirmed in each of the transfections by
immunofluorescent staining followed by FACScan analysis (Fig. 6
). These data indicate that dTACE can
inhibit the proteolytic release of both proTNF and TNFRII.
|
|
90%.
Therefore, inhibition of TNFRII and proTNF shedding by
dTACE does not induce an accumulation of cell surface
expression of either of these proteins over that observed in
cells lacking the dominant negative form of TACE. In a previous report,
we provided evidence for rapid degradation of unprocessed proTNF in
LPS-stimulated monocytes treated with hydroxamic-based metalloprotease
inhibitors (12). It appears that the proTNF and TNFRII
transfected HEK293 cells may invoke a similar mechanism of degradation
of noncleaved substrates.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: TACE, TNF-
converting enzyme; dTACE, deletion mutant of TACE; TNFRII, TNF receptor II; mIg, mouse Ig; ADAM, a disintegrin and metalloprotease; TAPI, TNF-
protease inhibitor (N-{DL-[2-(hydroxyaminocarbonyl)methyl]-4-methylpentanoyl}-L-3-(2[prime]-naphthyl)alanyl-L-alanine, 2-aminoethylamide); FLAG, marker octapeptide (N-Asp-Tyr-Lys-Asp-Asp-Asp-Asp-Lys-C). ![]()
Received for publication May 6, 1999. Accepted for publication August 16, 1999.
| References |
|---|
|
|
|---|
precursor by metalloproteinases. Nature 370:555.[Medline]
processing by a metalloproteinase inhibitor. Nature 370:558.[Medline]
from cells. Nature 385:729.[Medline]
. Nature 385:733.[Medline]
converting enzyme is involved in regulated
-secretase cleavage of the Alzheimer amyloid protein precursor. J. Biol. Chem. 273:27765.
convertase enzyme from human arthritis-affected cartilage: isolation of cDNA by differential display, expression of the active enzyme, and regulation of TNF-
. J. Immunol. 160:4570.
following inhibition of metalloprotease-dependent processing to soluble TNF-
in human monocytes. J. Immunol. 159:4524.[Abstract]
from stable transfectants of HEK-293 cells. Inflamm. Res. 46:(Suppl. 2):S127.
convertase. FEBS Lett. 400:333.[Medline]
-processing enzyme from the ADAM family of zinc metalloproteases. J. Biol. Chem. 272:24588.This article has been cited by other articles:
![]() |
K. Horiuchi, T. Miyamoto, H. Takaishi, A. Hakozaki, N. Kosaki, Y. Miyauchi, M. Furukawa, J. Takito, H. Kaneko, K. Matsuzaki, et al. Cell Surface Colony-Stimulating Factor 1 Can Be Cleaved by TNF-{alpha} Converting Enzyme or Endocytosed in a Clathrin-Dependent Manner J. Immunol., November 15, 2007; 179(10): 6715 - 6724. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Canault, A. S. Leroyer, F. Peiretti, G. Leseche, A. Tedgui, B. Bonardo, M.-C. Alessi, C. M. Boulanger, and G. Nalbone Microparticles of Human Atherosclerotic Plaques Enhance the Shedding of the Tumor Necrosis Factor-{alpha} Converting Enzyme/ADAM17 Substrates, Tumor Necrosis Factor and Tumor Necrosis Factor Receptor-1 Am. J. Pathol., November 1, 2007; 171(5): 1713 - 1723. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Chalaris, B. Rabe, K. Paliga, H. Lange, T. Laskay, C. A. Fielding, S. A. Jones, S. Rose-John, and J. Scheller Apoptosis is a natural stimulus of IL6R shedding and contributes to the proinflammatory trans-signaling function of neutrophils Blood, September 15, 2007; 110(6): 1748 - 1755. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. A. Lemieux, F. Blumenkron, N. Yeung, P. Zhou, J. Williams, A. C. Grammer, R. Petrovich, P. E. Lipsky, M. L. Moss, and Z. Werb The Low Affinity IgE Receptor (CD23) Is Cleaved by the Metalloproteinase ADAM10 J. Biol. Chem., May 18, 2007; 282(20): 14836 - 14844. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ringel, R. Jesnowski, N. Moniaux, J. Luttges, J. Ringel, A. Choudhury, S. K. Batra, G. Kloppel, and M. Lohr Aberrant Expression of a Disintegrin and Metalloproteinase 17/Tumor Necrosis Factor-{alpha} Converting Enzyme Increases the Malignant Potential in Human Pancreatic Ductal Adenocarcinoma. Cancer Res., September 15, 2006; 66(18): 9045 - 9053. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Soond, B. Everson, D. W. H. Riches, and G. Murphy ERK-mediated phosphorylation of Thr735 in TNF{alpha}-converting enzyme and its potential role in TACE protein trafficking J. Cell Sci., June 1, 2005; 118(11): 2371 - 2380. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Buckley, F. N. Rouhani, M. Kaler, B. Adamik, F. I. Hawari, and S. J. Levine Amino-terminal TACE prodomain attenuates TNFR2 cleavage independently of the cysteine switch Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1132 - L1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. W.M. Fedak, D. S. Smookler, Z. Kassiri, N. Ohno, K. J. Leco, S. Verma, D. A.G. Mickle, K. L. Watson, C. V. Hojilla, W. Cruz, et al. TIMP-3 Deficiency Leads to Dilated Cardiomyopathy Circulation, October 19, 2004; 110(16): 2401 - 2409. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Powell, J. Wicks, J. W. Holloway, S. T. Holgate, and D. E. Davies The Splicing and Fate of ADAM33 Transcripts in Primary Human Airways Fibroblasts Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 13 - 21. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Contin, V. Pitard, T. Itai, S. Nagata, J.-F. Moreau, and J. Dechanet-Merville Membrane-anchored CD40 Is Processed by the Tumor Necrosis Factor-{alpha}-converting Enzyme: IMPLICATIONS FOR CD40 SIGNALING J. Biol. Chem., August 29, 2003; 278(35): 32801 - 32809. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Peiretti, P. Deprez-Beauclair, B. Bonardo, H. Aubert, I. Juhan-Vague, and G. Nalbone Identification of SAP97 as an intracellular binding partner of TACE J. Cell Sci., May 15, 2003; 116(10): 1949 - 1957. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pandey, G. Tuncman, G. S. Hotamisligil, and F. Samad Divergent Roles for p55 and p75 TNF-{alpha} Receptors in the Induction of Plasminogen Activator Inhibitor-1 Am. J. Pathol., March 1, 2003; 162(3): 933 - 941. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. Seals and S. A. Courtneidge The ADAMs family of metalloproteases: multidomain proteins with multiple functions Genes & Dev., January 1, 2003; 17(1): 7 - 30. [Full Text] [PDF] |
||||
![]() |
Y. Zheng, J. Schlondorff, and C. P. Blobel Evidence for Regulation of the Tumor Necrosis Factor alpha -Convertase (TACE) by Protein-tyrosine Phosphatase PTPH1 J. Biol. Chem., November 1, 2002; 277(45): 42463 - 42470. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hirohata, L. W. Wang, M. Miyagi, L. Yan, M. F. Seldin, D. R. Keene, J. W. Crabb, and S. S. Apte Punctin, a Novel ADAMTS-like Molecule, ADAMTSL-1, in Extracellular Matrix J. Biol. Chem., March 29, 2002; 277(14): 12182 - 12189. [Abstract] [Full Text] [PDF] |
||||
![]() |
R C Newton, K A Solomon, M B Covington, C P Decicco, P J Haley, S M Friedman, and K Vaddi Biology of TACE inhibition Ann Rheum Dis, November 1, 2001; 60(90003): iii25 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Deswal, N. J. Petersen, A. M. Feldman, J. B. Young, B. G. White, and D. L. Mann Cytokines and Cytokine Receptors in Advanced Heart Failure : An Analysis of the Cytokine Database from the Vesnarinone Trial (VEST) Circulation, April 24, 2001; 103(16): 2055 - 2059. [Abstract] [Full Text] [PDF] |
||||
![]() |
L.-c. Zhao, M. Shey, M. Farnsworth, and M. O. Dailey Regulation of Membrane Metalloproteolytic Cleavage of L-selectin (CD62L) by the Epidermal Growth Factor Domain J. Biol. Chem., August 10, 2001; 276(33): 30631 - 30640. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |