HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Messaoudi, I. Articles by LeMaoult, J. Search for Related Content PubMed PubMed Citation Articles by Messaoudi, I. Articles by LeMaoult, J. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB (L)-ARGININE

The Mode of Ligand Recognition by Two Peptide:MHC Class I-Specific Monoclonal Antibodies¹

Ilhem Messaoudi^*,, Joël LeMaoult^* and Janko Nikoli-ugi^2,*,

^* Laboratory of T Cell Development, Immunology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021; and Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021

	Abstract

Top Abstract Introduction Materials and Methods Results and Discussion References

 
The Ig superfamily members TCR and B cell receptor (BCR) share high structural and amino acid homology, yet interact with Ags in a distinct manner. The overall shape of the TCR ligand is rather constant, with the variation coming from the MHC polymorphism and the peptide heterogeneity. Consequently, the TCR - and ß-chains form a relatively flat ligand-binding site that interacts with the peptide:MHC (pep:MHC) ligand in a fixed diagonal orientation relative to the MHC -helices, with the - and ß-chains of the TCR contacting the N and C termini of the pep:MHC complex, respectively. By contrast, the shape of BCR ligands varies dramatically, and the BCR exhibits much greater variability of the Ag-binding site. The mAbs 25-D1.16 (D1) and 22-C5.9 (C5), specific for the OVA-8:H-2K^b complex, allowed us to directly compare how TCR and BCR approach the same ligand. To that effect, we mapped D1 and C5 footprints over the OVA-8:H-2K^b complex. Using peptide variants and mutant MHC molecules, we show that the D1 and C5 contacts with the OVA-8:K^b complex C terminus overlap with the TCR ß-chain footprint, but that this footprint also extends to the regions of the molecule not contacted by the TCR. These studies suggest that D1 and C5 exhibit a hybrid mode of pep:MHC recognition, in part similar to that of the TCR ß-chain and in part similar to the conventional anti-MHC Ab.

	Introduction

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Bcells recognize conformational epitopes present at the surface of native Ags (1). By contrast, T cells recognize short peptide fragments of cytosollically degraded proteins bound to the MHC-encoded class I or class II molecules (2). To recognize Ag, both B and T cells use heterodimeric receptors, IgH/IgL and TCR /ß, respectively. The Ag recognition segments of the TCR - and ß-chains closely resemble those of the Fab portion of the Ab (1, 2, 3, 4, 5, 6). Similarly to Abs, the TCR Ag recognition site is formed by six hypervariable loops (complementarity determining regions, CDRs)³ connected in a framework of anti-parallel ß-pleated sheets. This framework is stabilized by intrachain disulfide and hydrogen bonds such that each domain is folded into a compact structure (reviewed in 4). The TCR interacts with the peptide:MHC (pep:MHC) complex in a diagonal orientation, by descending on the peptide while avoiding the high points of the MHC -helices (2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12). It is generally believed that the TCR - and ß-chains contact the N and C termini of the pep:MHC complex. The fixed orientation of the TCR might be crucial for thymic selection, interaction with CD4/CD8 coreceptors, and for putative oligomer formation during T cell activation.

Despite the common scaffold and other similarities, several differences stand out between the TCR and B cell receptor (BCR)/Ab modes of Ag recognition. MHC restriction dictates that the TCR recognizes Ag in a fixed orientation and mandates that the TCR must interact with a relatively fixed area of the pep:MHC complex. The TCR contacts a relatively flat antigenic surface composed of the top of the 1 and 2 helices of the MHC molecules and of three to five exposed amino acids of the bound peptide (reviewed in 3). Consequently, the binding site of the TCR is also flat to allow maximal specific and simultaneous interactions with the elongated peptide and the exposed MHC residues. Abs, on the other hand, recognize a wide variety of Ag classes that include carbohydrates, haptens, lipids, and proteins, and therefore have to exhibit a much more flexible mode of interaction (1). In fact, the Ag-binding site of Abs frequently displays concave surfaces that increases its plasticity and allows it to interact with different classes of Ags (13, 14). Moreover, comparison of Ab structures in the presence or the absence of various haptens and larger Ags have shown that Abs modify the shape of their combining site to match the corresponding features or epitopes on the Ag. For example, Abs are known to bury small Ags (e.g., haptens) entirely, hugging them with their concave surfaces. As the size of the Ag surface increases, the Ag-binding site of Abs becomes flatter, but the limits of this adaptation are not known. Overall, this suggests that the Ag binding site of many Abs is rather plastic, allowing conformational adaptation to Ag that involves significant CDR loop loop-rearrangements and domain shifts (15, 16, 17). While one TCR crystallized with the pep:MHC complex (18) did exhibit a ligand-induced adaptation, its structural characteristics, including a very small V-Vß interface, were unusually conducive to such a rearrangement. More remarkably, even this ligand-induced adaptation was achieved without domain shifts that are frequently observed in Ag-Ab interactions (16). The other two TCRs showed no such movement (7), and it is unlikely that significant movement would frequently occur in TCR molecules upon ligand binding.

The above differences are likely to prevent most Abs from recognizing the pep:MHC complex with the same degree of specificity as the TCR. Abs to MHC molecules can readily be produced, but generating Abs that specifically recognize a pep:MHC complex in a TCR-like manner has proven to be a difficult task, so far accomplished for only three distinct pep:MHC complexes (19, 20, 21). The Abs 25-D1.16 and 22-C5.9 recognize the OVA-8 peptide bound to the murine class I molecule H-2K^b. D1 and C5 are able to detect OVA-8:K^b complexes at the surface of APCs and to compete with OVA-8:K^b-specific TCRs. It was therefore of interest to compare the molecular contacts with the OVA-8:K^b complex of these mAbs and of the OVA-8:K^b-specific TCRs. Here, we show that the D1 and C5 footprints overlap the area contacted by the OVA-8-specific TCR ß-chain. We also show that D1 and C5 may be used to study the topology of class I:peptide complexes. Moreover, D1 and C5 enabled us to show for the first time that the K^bm8 mutation, which affects the buried residue P2 of the bound peptide, also modifies the orientation of the amino acids exposed to the TCR and located in the middle of the bound peptide.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results and Discussion References

 
Mice

OT-1 TCR transgenic mice (22) were obtained from Drs. F. Carbone (Monash Institute, Melbourne, Australia) and W. Heath (Walter and Eliza Hall Institute, Melbourne, Australia) and were maintained in the Memorial Sloan-laettering Cancer Center vivarium.

Cells

TAP-deficient cell lines RMA-S (23) and SJ-2 (24), expressing K^b and K^bm8 class I molecules, respectively, were used for the thermodynamic stabilization assays. The S.bm cell lines (S.bm1, S.bm3, S.bm5, S.bm8, S.bm10, S.bm11, S.bm23), expressing the indicated K^bm mutant molecules (25), were used to map the footprints of D1 and C5 over the K^b molecule. A detailed map of the mutations and the solvent accessibility of the side chains of involved amino acids is shown in Fig. 1. This provides a measure of the side chain availability for the TCR contact; buried residues have no solvent accessibility and chiefly participate in the contacts with the MHC.

View larger version (41K): [in this window] [in a new window]   FIGURE 1. Ribbon diagram of the H-2Kb molecule with the position and orientation of the residues changed in Kbm molecules. The highlighted amino acid residues denote the changes occurring in the Kbm mutants. The list below the figure details the characteristics and the predicted orientation of the side chain of each residue changed in individual Kbm mutants, as deduced from Refs. 18, 25, and 30, with an emphasis on functional studies in the OVA-8 model using Kbm molecules (25 ). TCR denotes solvent accessibility and the potential of the side chain to interact with the TCR. It does not implicate lack of interaction of the side chain with the MHC.

A complete list of the peptides used in the experiments is provided in Table I. All peptides were variants of the H-2K^b binding immunodominant OVA_257–264 (OVA-8, SIINFEKL) peptide except for GAG-10, the HIV gp120-derived decamer (RGPGRAFVTI), which does not bind K^b and was used as a negative control. All peptides were purchased from Research Genetics (Huntsville, AL). The peptides were named to identify the original amino acid in OVA-8, the position of the substituted amino acid, and the new amino acid. For example, N4R is a variant of OVA-8 in which the Asn residue (N) at position 4 was replaced with Arg (R). Otherwise, peptide positions in the text are referred to as P# from the N terminus (e.g. P2 is the second position from the N terminus).

Abs 25-D1.16 (D1) and 22-C5.9 (C5) (21) were used as tissue culture supernatants from hybridoma kindly donated by R. Germain (National Institutes of Health). The K^b-specific mAb Y3 (American Type Culture Collection, Manassas, VA) was used in the form of ascitic fluid, generated in our laboratory. PE-conjugated secondary Abs specific for IgG1 (to detect D1), IgG2a (C5), and IgG2b (Y3) were purchased from Fisher Biotech (Malvern, PA). Cells were stained on ice for 30 min using excess Ab, washed, and then incubated with an excess of fluorochrome-conjugated secondary Ab. Following another incubation and a wash, cells were resuspended in a paraformaldehyde fixative and analyzed on a FACScan instrument using the CellQuest 3.1 software (Beckton Dickinson, Mountain View, CA). A total of 5–10 x 10³ cells were analyzed per sample using unstained, isotype-stained, and secondary Ab controls to determine specific fluorescence. Results are reported as mean fluorescence intensity (MFI) corrected for the background, or as a derivative or normalized values thereof, as described for the assays below.

Assays for mAb recognition of pep:MHC complexes

Peptide binding to K^b and K^bm8 molecules was assessed by a FCM-based assay that quantifies the surface expression of thermodynamically stable class I molecules on TAP-deficient cell lines in the presence of different concentrations of peptides, exactly as described previously (24, 26). Briefly, TAP-deficient cells were incubated overnight at 29°C to allow maximal accumulation of empty class I molecules at the cell surface. Peptide was then added to triplicate samples in serial 10-fold dilutions (10^-5–10^-10 M) and the cells were incubated for 30 min at 29°C, following by another 3 h at 37°C. Excess peptide was then washed (three times), and each of the triplicate samples was stained with Y3, D1, or C5. Y3 recognizes only properly conformed MHC molecules, but it binds to all K^bm molecules (25), and this binding is not affected by the nature of the bound peptide. As this mAb also detects the "empty" MHC molecules (in fact, probably the ones occupied with suboptimally fitting peptides) that are stable at 29°C but not at 37°C, it is suitable for quantification of total expression of K^b-like molecules (24). Therefore, Y3 fluorescence was used to provide a measure of overall K^{b or bm} expression at 37°C in normal cells (S.bm series) or a measure of both the capacity for "maximal" K^{b or bm8} expression and of peptide binding in TAP-deficient cells.

To be able to compare data from different experiments, the Y3 MFI was converted into stabilization percentage, with MFI of cells incubated overnight at 29°C = 100% and MFI of cells shifted to 37°C in the absence of peptide = 0%. These stabilization percentage values were normalized at each peptide concentration to the percentages obtained using the index peptide I2S (unlike OVA-8, I2S binds in an equivalent fashion to K^bm8 and K^b). For D1 and C5, which do not recognize K^b in the absence of OVA-8, the MFI of I2S at 10^-5 M was taken as 100%, and the other values were normalized to it.

To assess mAb recognition of the OVA-8:K^bm complexes, S.bm cells were incubated overnight with 10^-6 M of OVA-8 or GAG-10 at 37°C. The cells were then washed and stained with Y3 to determine the H2-K levels, and with D1 and C5 to measure specific recognition of the various OVA-8:class I complexes. The MFI values were then converted into specific % of OVA-8:K^b binding using the following formula: [experimental MFI (OVA-8:K^bm) - control MFI (GAG-10:K^bm)]/maximal MFI (OVA-8:K^b) - control MFI (GAG-10:K^b)] x 100.

Ig chain sequencing

Sequencing of the Ig heavy and light chains was carried out as described (27). For sequencing of the Ig heavy and light chains of C5 and D1, total RNA was extracted from 5 million C5 and D1 hybridoma cells using the RNA-isolator kit (Genosys Biotechnologies, The Woodlands, TX) and quantitated by optical density. A total of 5 µg of total RNA was then reverse-transcribed in a 30 µl reaction using the Avian myeloblastosis virus (AMV)-reverse transcriptase kit (Boehringer Mannheim, Indianapolis, IN). After the reaction was completed, 30 µl of double-distilled water was added and 2 µl of the final mixture was used for PCR. PCR was performed using sense V-specific and antisense C-specific primers (V consensus, GGRGTCCCATCAAGGTTCAGTGGC; C, GGGAAGATGGATACAGTTGGTGCA; VhJ558, AAGGCCACACTGACTGTAGAC; IgG1, AAGGACACAGGGATCATTTACC; IgG2, GTGRGTGCTGAGCTCAATTTACC, where R is any nucleotide). The PCR products were visualized on a 1.5% agarose gel using ethidium bromide and purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA). One-fourth of the purified PCR products was then sequenced by using the same primers as for the PCR and the BigDye Terminator cycle sequencing kit (Applied Biosystems, Foster City, CA). Nucleotides contributed by the V H/k, J H/k, or D genes were identified by alignment with germline gene sequences (28). Only those nucleotides that could not have been contributed by one of these genes were designated as VH-D or D-JH junctions for the heavy chains and as Vk-Jk junctions for the light chains.

	Results and Discussion

Top Abstract Introduction Materials and Methods Results and Discussion References

 
OVA-8:K^b-specific mAbs D1 and C5 contact OVA-8:H-2K^b near the C terminus of the peptide

To compare the recognition patterns of D1 and C5 to that of OVA-8:K^b-specific TCRs, we mapped the footprint of the mAbs over the K^b molecule. To this end we used the K^bm mutants previously shown to bind OVA-8 and measured D1 and C5 binding to the various OVA-8:K^bm complexes (25). The K^bm mutants are spontaneous natural variants of the K^b molecule that differ from it by up to 5 aa changes located in the 1 and 2 domains (29). Fig. 1 shows the location of substituted amino acids in a ribbon diagram of the K^b molecule. Some of these changes are predicted to dominantly affect TCR binding, some to influence peptide binding and conformation, whereas others are likely to influence both, as judged by the solvent accessibility of the side chains of the OVA-8:K^b complex (30) and the actual contacts of a different peptide, dEV-8, with K^b and the 2C TCR (18) (Fig. 1).

With the exception of K^bm1 and K^bm8, it was previously demonstrated that all K^bm mutants can present OVA-8 to OVA-8-specific CTLs. Furthermore, mice expressing various K^bm mutants are able to mount a CTL response against the OVA-8 epitope (25, 29). As a consequence of an altered Ag binding B pocket, the K^bm8 molecule binds OVA-8 only at high peptide concentrations (10^-5–10^-6 M) whereas K^b can still bind it at 10^-8–10^-9 M. Furthermore, bm8 mice do not mount a CTL response against OVA-8 due to a lack of positive selection of OVA-8-specific CTLs (29).

The effects of the K^bm mutations on the recognition pattern of D1 and C5 are summarized in Figs. 2 and 3. An example of actual FCM profiles is provided in Fig. 2, illustrating binding of mAbs to K^b and K^bm3. Recognition by D1 was abrogated by the K^bm1, K^bm3, and K^bm11 mutations. K^bm1 is located on the 2 helix near the C terminus of the peptide and affects both TCR and peptide binding (Refs. 29 and 32; Fig. 1). K^bm11 and K^bm3 mutations are located at the C-terminal part of the 1 helix and share a substitution at amino acid residue 77. However, as the mutation at position 77 is also shared with K^bm23, and the OVA-8:K^bm23 complex is recognized by D1, it is unlikely that the change at residue 77 affects recognition. The most plausible possibility is that D1 is sensitive to independent changes in K^bm3 (residue 89) and K^bm11 (residue 80), none of which are present in K^bm23. Alternatively, and much less likely, the mutation at residue 77 could directly affect recognition by D1 of the OVA-8:K^b complex, but the second mutation at residue 75 of K^bm23 would compensate for its effect.

View larger version (15K): [in this window] [in a new window]   FIGURE 2. 25-D1.16 (A) and 22-C5.9 (B) binding to the OVA-8:Kb and OVA-8:Kbm3. FCM histograms are shown for the fluorescence obtained for S.B6 (Kb, solid line) and S.bm3 (Kbm3, dotted line), following staining with no Ab (A), Y3 (B), D1 (C), or C5 (D). All cell lines were incubated with 10-6 M peptide for 1 h prior to staining, as described in Materials and Methods. Data are representative of four experiments.

View larger version (22K): [in this window] [in a new window]   FIGURE 3. 25-D1.16 (A) and 22-C5.9 (B) binding to the OVA-8:Kbm complexes. The results are represented as percentage recognition standardized to the MFI of the parental complex, OVA-8:Kb, as detailed in Materials and Methods. The black and gray bars represent the percentage recognition by D1 or C5 of the different OVA-8:Kbm and GAG-10:Kbm complexes, respectively. GAG-10 is the HIV gp120 decamer that does not bind to any of the molecules tested. OVA-8 and GAG-10 were used at 10-6 M. Results are shown as an average of triplicates ± SD, representative of four independent experiments. For the position of amino acid changes, please refer to Fig. 1.

mAb recognition of OVA-8:K^b involves the TCR contact residues P4, P6, and P7 of OVA-8

To determine the amino acid residues of OVA-8 important for recognition by D1 and C5, single amino acid substitutions of OVA-8 were assayed for K^b binding and recognition by D1 and C5. A complete list of the OVA-8 variants analyzed (with the exception of the P2 variants I2D and I2E, which bound poorly to K^b and were therefore excluded from this analysis) is given in Table I. Typical peptides presented by K^b are 8 aa long and contain anchor residues F/Y at P5 and L/I at P8 (34). These amino acids are buried in the MHC pockets C and F, respectively, and their alteration severely affects K^b binding. Side chains at positions 2 and 3 are also completely or partially buried and can serve as auxiliary MHC binding anchors (35). Furthermore, in certain peptides, including OVA-8, mutations at the P2 have the potential to induce a change in the peptide conformation that can be detected at the level of TCR recognition (30). Residues P1S, P4N, P6E, and P7K are solvent accessible and were functionally implicated in TCR contact because their substitution alters the recognition by OVA-8:K^b-specific CTLs (24, 26, 31). To compare the specificity of OVA-8:K^b recognition by T cells to that by D1 and C5, we mutated residues at positions 1, 2, 4, 6, and 7. No changes were made at P3, P5, and P8 to preserve OVA-8 binding to K^b (Table I).

We used TAP-deficient RMA-S cells to evaluate OVA-8 variant recognition by D1 and C5. The RMA-S cells were stained with Y3 to obtain a measure of OVA-8 variant binding to K^b and with D1 and C5 to measure recognition of the OVA-8 variant:K^b complex (Figs. 4 and 5). The percentages obtained at 10^-6 M were chosen for comparison between the OVA-8 variants because they typically resided at the linear portion of the titration curves. The comparative results are qualitatively summarized in Table II.

View larger version (31K): [in this window] [in a new window]   FIGURE 4. mAb recognition of the OVA-8 and position 4 OVA-8 variant:Kb or bm complexes. MHC class I stabilization assay was performed as described in Materials and Methods. The level of class I expression was determined by Y3 staining and measured by flow cytometry, ascertaining that all peptides bound well to Kb (A) and Kbm8 (D). The level of specific D1 (B and E) and C5 (C and F) binding were also determined by FCM. Mean fluorescence values were converted to relative stabilization, and further standardized to the index peptide I2S, as described in Materials and Methods. The remaining of the data is summarized in Tables II and III based on the percentage recognition values at 10-6 M. Results are shown as mean ± SD (n = 3) and are representative of six experiments.

All single amino acid changes at P6 and P7 completely abolished recognition by D1 (Fig. 5). The same pattern applied to C5, with the exception of the K7A peptide, that was weakly recognized by this mAb (Fig. 5). These results indicated that P6 and P7 must be directly involved in mAb contact, consistent with the initial analysis of Porgador et al. (21). Interestingly, the double substituant E6AK7R was recognized by D1 (but not by C5), despite the fact that the mutations E6A and K7R were not individually tolerated by this mAb (Table II). One explanation for this effect is that the two mutations compensate for each other when present in the same variant (currently under investigation).

View larger version (18K): [in this window] [in a new window]   FIGURE 5. Recognition of position 6 and 7 variants of OVA-8. MHC class I stabilization assay was performed as described in Materials and Methods. The level of class I expression was determined by Y3 staining and measured by FCM, ascertaining that all peptides bound well to Kb (A). The level of specific D1 (B) and C5 (C) binding were also determined by FCM. Mean fluorescence values were converted to relative stabilization and further standardized to the index peptide I2S, as described in Materials and Methods. The remaining data are summarized in Tables II and III based on the percentage recognition values at 10-6 M. Results are shown as mean ± SD (n = 3) and are representative of six experiments.

D1 and C5 detect the K^bm8-induced conformational change at the solvent-exposed central part of the OVA-8:K^bm8 complex

The above data indicate that the recognition by D1 and C5 of OVA-8:K^b overlaps the area contacted by TCR ß-chains. Hence, they may be considered mimics of a soluble TCRß and be used to probe conformational changes introduced into the bound peptide by class I mutations. We investigated whether D1 and/or C5 can detect subtle differences in peptide conformation (24, 37) introduced by the K^bm8 mutation. This mutation encompasses amino acid mutations at positions 22, 23, 24, and 30, all buried within the peptide binding groove (38). Hunt et al. (39) showed that changes at positions 22 and 24 carry the bulk of the biological effect of this K^b variant. Both residues are part of the B pocket of the MHC, which interacts with the side chain of the P2 residue of the peptide. Their mutation results in a disruption of the hydrogen bond network that exists within the B pocket of K^b (24), with a potential to affect peptide binding and conformation. According to the TCR crystal structures and the biological data, the N-terminal domain of the pep:MHC complex is contacted by the -chain. However, bm8 mice use a different CTL Vß repertoire in response to HSV than the wild-type B6 mice (R. Dyall, I. Messaoudi, J. LeMaoult, and J. Nikoli-ugi, unpublished observations), suggesting that the conformational differences introduced by the B pocket mutation may extend into the central peptide portion, including the residues contacted by the ß-chain.

We investigated whether D1 or C5 can detect the conformational differences between the OVA-8:K^b and OVA-8:K^bm8 complexes. To this end, we used the thermodynamic stabilization assay with TAP-deficient cell lines expressing K^b or K^bm8 and the OVA-8 peptide variants described in Table I. We then compared the recognition pattern of D1 and C5 of the peptide:K^bm8 complex to that of peptide:K^b complex. The recognition pattern of D1 remained unchanged whether OVA-8 variants were bound to K^b or K^bm8 (Fig. 4, B and E). However, in contrast to what was observed on K^b, the recognition pattern of C5 of the K^bm8 complex was now abolished by the presence of positive charges at P4 (Fig. 4, C and F; Table III). This strongly suggests that the side chain of P4 has moved upon binding to K^bm8, compared to its position in complex with K^b, so that it now can affect C5 binding.

CDR3 sequence analysis of D1 and C5 chains reveals a conserved R between mAb heavy chains and OVA-8 specific TCR ß-chains

Positively charged residues at P4 abrogate the binding of D1 and C5 to OVA-8:K^b and OVA-8:K^bm8, respectively. To investigate the molecular basis for this repulsion, the CDR3 regions of the heavy and light chain of both D1 and C5 were sequenced (Table IV). The two Ig-chain CDR3s were identical and contained an R in the middle of the region. The two IgH chains differed, but contained an R-K pair at the same positions in the CDR3s. It is tempting to speculate that one or more of these positively charged residues may have caused the inability of these mAbs to bind to OVA-8 variants which had a positive charge at P4, but so could have any of the other CDRs not sequenced in this study. Curiously, a conserved R residue was previously observed in many TCRß CDR3 obtained from OVA-8:K^b specific CTL lines and clones (35, 40).

In this study, we investigated the molecular contacts that define ligand recognition of two peptide:class I-specific mAbs and compared them to that of the TCR. The data show that D1 and C5 footprints overlap that of the ß-chain of the TCR. Mutations of the K^b molecule at the C terminus of the 1 and 2 helices disrupted the binding of D1 and C5, whereas changes at the N terminus did not affect binding of either Ab. Moreover, changes at the TCR contact residues P6, P7, and, to a lesser extent, P4, were detrimental to the binding of both D1 and C5, whereas changes at TCR contact residue P1 did not affect either Ab. TCR contact residues P4, P6, and P7 were previously shown to be contacted by the CDR3 of the ß-chain, whereas P1 is contacted by the -chain. Therefore, D1 and C5 partly mimic TCR ß-chain interaction with OVA-8:K^b. One possible footprint of these Abs over the pep:MHC complex is shown in Fig. 5. (Our data are consistent with this layout. However, this should be considered a coarse and a necessarily imprecise approximation, shown for illustrative purposes.) Additional preliminary data using the point mutants generated by Nathenson and colleagues (41, 42) support our conclusions. For example, neither D1 nor C5 could recognize alterations at positions 80 (1 helix) and 141 (2 helix), and both were oblivious to the changes at positions 158 and 173 (the peptide N-terminus-proximal part of the 2 helix) (data not shown). The influence of residue 141 on the mAb binding stands in contrast to its lack of effect on TCR binding (41), again stressing the overlapping, but not identical, contacts between TCR and anti-pep:MHC mAbs.

Based on the above findings, the anti-pep:MHC Abs studied here appear to make a compromise between a TCR-like and an Ab-like mode of interaction with Ag. Unlike the TCR, these Abs do not interact with the pep:MHC complex in a parallel fashion to the ß-pleated sheets. Unlike the typical anti-MHC Abs, they also do not wrap around only one part of the MHC molecule (e.g., the loops behind the 1 helix, or parts of helices; Refs. 33 and 42). Rather, the recognition mode appears to be a hybrid between the two. At least one loop is involved (the loop connecting the end of the 1 helix to ß-strand 5, carrying the residue 89), but so is a larger and flatter area composed of the MHC residues 80 (1 helix) and one or more residues in the 141–156 segment (2 helix) and the peptide residues P4, P6, and P7. This area is contacted by the TCR ß-chain during TCR recognition. The above findings are entirely consistent with the affinity of D1 and C5 (8 x 10^-7 M; 21), which is significantly lower than that of most affinity-matured IgG Abs (10^-9–10^-12 M; 15), but is also clearly higher than that of TCRs (10^-5–10^-6, exceptionally 1 x 10^-7 M; 2).

D1 and C5 also detected conformational changes introduced by mutations of the K^b molecule that exclusively affected peptide binding. Therefore, they provided the first direct measure of the conformational difference introduced by the K^b allele K^bm8. Indeed, previous experiments all relied on CTL lysis, which involved multiple steps from TCR ligation by pep:MHC to CTL degranulation and target cell lysis. Abs against pep:MHC complexes can therefore be useful in studying the general topology of pep:MHC complexes.

View larger version (50K): [in this window] [in a new window]   FIGURE 6. The approximate footprints of 25-D1.16 and 22-C5.9 on the Kb:OVA-8 complex as suggested by the recognition patterns obtained in this study. Results shown in this Figure and Tables II and III, and discussed in the text, demonstrate that the footprint of the two Abs, although largely overlapping, is not identical. Most notably, C5 is less sensitive than D1 to the changes at P4 and to the Kbm11 mutation and thus may be positioned more towards the C terminus of the peptide than D1.

	Acknowledgments

	Footnotes

 
¹ This work was supported by the DeWitt Wallace Fund (to J.N.-) and Cancer Center Support Grant CA-02583 from the National Institutes of Health.

² Address correspondence and reprint requests to Dr. J. Nikoli-ugi, Immunology Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021. E-mail address:

³ Abbreviations used in this paper: CDR, complementarity determining region; pep:MHC, peptide:MHC; FMC, flow cytofluorometric; MFI, mean fluorescence intensity.

Received for publication March 16, 1999. Accepted for publication July 6, 1999.

	References

Top Abstract Introduction Materials and Methods Results and Discussion References

 

1. Davies, D. R., H. Metzger. 1983. Structural basis of antibody function. Annu. Rev. Immunol. 1:87.[Medline]
2. Davis, M. M., J. J. Boniface, Z. Reich, D. Lyons, J. Hampl, B. Arden, Y. Chien. 1998. Ligand recognition by ß T-cell receptors. Annu. Rev. Immunol. 16:523.[Medline]
3. Bongrand, P., B. Malissen. 1998. Quantitative aspects of T-cell recognition: from within the antigen presenting cell to within the T-cell. BioEssays 20:412.[Medline]
4. Mazza, G., D. Housset, C. Piras, C. Gregoire, S.-Y. Lin, J. C. Fontecilla-Camps, B. Malissen. 1998. Glimpses at the recognition of peptide:MHC complexes by T-cell antigen receptors. Immunol. Rev. 163:187.[Medline]
5. Garcia, K. C., M. Decagon, R. L. Stanfield, A. Brunmar, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. The structure of an ß T-cell receptor at 2.5 Å. Science 274:209.[Abstract/Free Full Text]
6. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
7. Ding, Y.-H., K. J. Smith, D. N. Garboczi, U. Utz, W. E. Beddison, D. C. Wiley. 1998. Two human T-cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity 8:403.[Medline]
8. Wang, J.-H., K. Lim, A. Smolyar, M.-K. Teng, J.-H. Liu, A. G. D. Tse, J. Liu, R. E. Hussey, Y. Chishti, C. T. Thomson, et al 1998. EMBO J. 17:19.
9. Jorgensen, J. L., U. Esser, B. Fazekas de St. Groth, P. A. Reay, M. M. Davis. 1992. Mapping the T cell antigen receptor/peptide contacts by variant peptide immunization of single-chain transgenics. Nature 355:224.[Medline]
10. Housset, D., G. Mazza, C. Gregoire, C. Piras, B. Malissen, J. C. Fontecilla-Camps. 1997. The three-dimensional structure of a T-cell antigen receptor VVß heterodimer reveals a novel arrangement of the Vß domain. EMBO J. 15:4205.
11. Sun, R., S. E. Shepherd, S. S. Geler, C. T. Thomson, J. M. Sheil, S. G. Nathenson. 1995. Evidence that the antigen receptors of cytotoxic T lymphocytes interact with a common recognition pattern on the H-2K^b molecule. Immunity 3:573.[Medline]
12. Sant’Angelo, D. B., G. Waterbury, P. Preston-Hurburt, S. T. Yoon, R. Medzhitov, S.-C. Hong, C. A. Janeway. 1996. The specificity and orientation of a TCR to its peptide-MHC class II ligands. Immunity 4:367.[Medline]
13. Mian, S., A. R. Bradwell, A. J. Olson. 1991. Structure, function and properties of antibody binding sites. J. Mol. Biol. 217:133.[Medline]
14. Alzar, P. M., M.-B. Lascombe, R. J. Poljak. 1988. Annu. Rev. Immunol. 6:555.[Medline]
15. Padlan, E.. 1994. Anatomy of the antibody molecule. Mol. Immunol. 31:169.[Medline]
16. Wilson, I. A., R. L. Stanfield. 1993. Antibody-antigen interactions. Cur. Opin. Struct. Biol. 3:113.
17. MacCallum, R. M., A. C. R. Martin, J. M. Thorton. 1996. Antibody-antigen interactions: contact analysis and binding site topography. J. Mol. Biol. 262:732.[Medline]
18. Garcia, K. C., M. Deagno, L. R. Pease, M. Huang, P. A. Peterson, L. Teyton, I. A. Wilson. 1998. Structural basis of plasticity in T cell receptor recognition of a self peptide:MHC antigen. Science 279:1166.[Abstract/Free Full Text]
19. Murphy, D. B., D. Lo, S. Rath, R. L. Brinster, R. A. Flavell, A. Slanetz, Jr C. A. Janeway. 1989. A novel MHC class II epitope expressed in thymic medulla but not cortex. Nature 338:765.[Medline]
20. Rudensky, A. Y., M. Maric, S. Eastman, L. Shoemaker, P. C. DeRoos, J. S. Blum. 1994. Intracellular assembly and transport of endogenous peptide-MHC class II complexes. Immunity 1:585.[Medline]
21. Porgador, A., J. W. Yewdell, Y. Deng, J. R. Bennink, R. N. Germain. 1997. Localization, quantitation, and in situ detection of specific peptide-MHC class I complexes using a monoclonal antibody. Immunity 6:715.[Medline]
22. Hogquist, K. A., A. G. Grandea, M. J. Bevan. 1993. Peptide variants reveal how antibodies recognize major histocompatibility complex class I. Eur. J. Immunol. 23:3028.[Medline]
23. Schumacher, N. M., M.-T. Heemels, J. J. Neefjes, W. M. Kast, C. J. Melief, M. H. L. Ploegh. 1990. Direct binding of peptide to empty MHC class I molecules on intact cells and in vitro. Cell 62:563.[Medline]
24. Dyall, R., D. H. Fremont, C. S. Jameson, J. Nikolic-Zugic. 1996. T-cell receptor (TCR) recognition of MHC class I variant: intermolecular second site reversion provides evidence for peptide:MHC conformational variation. J. Exp. Med. 184:253.[Abstract/Free Full Text]
25. Nikolic-Zugic, J., F. Carbone. 1990. The effect of mutations in the MHC class I peptide binding groove on the cytotoxic T lymphocyte recognition of the K^b restricted ovalbumin determinant. Eur. J. Immunol. 20:2431.[Medline]
26. Huard, R., R. Dyall, J. Nikolic-Zugic. 1997. The critical role of a solvent-exposed residue of an MHC class I-restricted peptide in MHC-peptide binding. Int. Immunol. 9:1701.[Abstract/Free Full Text]
27. LeMaoult, J., S. Delassus, R. Dyall, J. Nikolic-Zugic, P. Kourilsky, M. E. Weksler. 1997. Clonal expansions of B lymphocytes in old mice. J. Immunol. 159:3866.[Abstract]
28. Kabat, E. A., T. T. Wu, M. Perry, and K. S. Gottesman. 1991. Sequences of Proteins of Immunological Interest. National Institutes of Health, Bethesda, MD.
29. Nathenson, S. G., J. Geliebter, G. M. Pfaffenbach, R. A. Zeff. 1986. Murine major histocompatibility complex class I mutants: molecular analysis and structure-function implications. Annu. Rev. Immunol. 4:471.[Medline]
30. Fremont, D. H., E. A. Stura, M. Masazumi, P. A. Peterson, I. A. Wilson. 1995. Crystal structure of an H-2K^b-ovalbumin peptide complexes reveals the interplay of primary and secondary anchor positions in the major histocompatibility complex binding groove. Proc. Natl. Acad. Sci. USA 92:2479.[Abstract/Free Full Text]
31. Nikolic-Zugic, J., M. J. Bevan. 1990. Role of self-peptides in positively selecting the T-cell repertoire. Nature 344:65.[Medline]
32. Bjorkman, P. J., M. A. Saper, B. Samraoui, W. S. Bennett, J. L. Strominger, D. C. Wiley. 1987. The foreign antigen binding site and T cell recognition regions of class I histocompatibility antigens. Nature 329:512.[Medline]
33. Pullen, J. K., H. D. Hunt, R. M. Horton, L. R. Pease. 1989. The functional significance of two amino acid polymorphisms in the antigen binding domain of class I MHC molecules. J. Immunol. 143:1674.[Abstract]
34. Turner, S. J., J. C. Jameson, F. R. Carbone. 1997. Functional mapping of the orientation for TCR recognition of an H2-K^b-restricted ovalbumin peptide suggests that the ß-chain subunit can dominate the determination of peptide side chain specificity. J. Immunol 159:2312.[Abstract/Free Full Text]
35. Falk, K., O. Rotzschke, S. Stevanovic, G. Jung, H.-G. Rammensee. 1991. Allele-specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature 351:290.[Medline]
36. Chen, W., J. McCluskey, S. Rodda, F. R. Carbone. 1993. Changes at peptide residues buried in the major histocompatibility complex (MHC) class I binding cleft influence T cell recognition: a possible role for indirect conformational alterations in the MHC class I or bound peptide in determining T cell recognition. J. Exp. Med. 177:869.[Abstract/Free Full Text]
37. Chattopadhyay, S., T. Matthias, J. Biggs, L. A. Sherman. 1994. Conformational differences in major histocompatibility complex-peptide complexes can result in alloreactivity. J. Exp. Med. 179:213.[Abstract/Free Full Text]
38. Pfaffenbach, G. M., H. Uehara, J. Gieliebter, S. G. Nathenson, D. Schulze. 1991. Analysis of the H-2K^bm8 mutant: correlation of structure with function. Mol. Immunol. 28:697.[Medline]
39. Hunt, H. D., J. K. Pullen, R. F. Dick, J. A. Bluestone, L. R. Pease. 1990. Structural basis of K^bm8 alloreactivity. J. Immunol. 145:1456.[Abstract]
40. Kelly, J. M., S. J. Sterry, S. Cose, S. J. Turner, S. Rodda, P. J. Fink, F. R. Carbone. 1993. Identification of conserved T cell receptor CDR3 residues contacting known exposed peptide side chains from a major histocompatibility complex class I-bound determinant. Eur. J. Immunol. 23:3318.[Medline]
41. Ajitkumar, P., S. S. Geier, K. V. Kesari, F. Borriello, M. Nakagawa, J. A. Bluestone, M. A. Saper, D. C. Wiley, S. G. Natheson. 1988. Evidence that multiple residues on both the -helices of the class I MHC molecule are simultaneously recognized by the T cell receptor. Cell 54:47.[Medline]
42. Sun, R., S. E. Shepherd, S. S. Geier, C. T. Thomson, J. M. Shell, S. G. Nathenson. 1995. Evidence that the antigen receptors of cytotoxic T lymphocytes interact with a common recognition pattern on the H-2K^b molecule. Immunity 3:573.

This article has been cited by other articles:

				L. A. Benoit and R. Tan Xenogeneic beta2-Microglobulin Substitution Affects Functional Binding of MHC Class I Molecules by CD8+ T Cells J. Immunol., September 15, 2007; 179(6): 3588 - 3595. [Abstract] [Full Text] [PDF]

				S. M. Truscott, L. Lybarger, J. M. Martinko, V. E. Mitaksov, D. M. Kranz, J. M. Connolly, D. H. Fremont, and T. H. Hansen Disulfide Bond Engineering to Trap Peptides in the MHC Class I Binding Groove J. Immunol., May 15, 2007; 178(10): 6280 - 6289. [Abstract] [Full Text] [PDF]

				J. Racape, F. Connan, J. Hoebeke, J. Choppin, and J.-G. Guillet Influence of dominant HIV-1 epitopes on HLA-A3/peptide complex formation PNAS, November 28, 2006; 103(48): 18208 - 18213. [Abstract] [Full Text] [PDF]

				A. Mulder, C. Eijsink, M. G. D. Kester, M. E. I. Franke, M. J. Kardol, M. H. M. Heemskerk, C. van Kooten, F. A. Verreck, J. W. Drijfhout, F. Koning, et al. Impact of Peptides on the Recognition of HLA Class I Molecules by Human HLA Antibodies J. Immunol., November 1, 2005; 175(9): 5950 - 5957. [Abstract] [Full Text] [PDF]

				M. Hulsmeyer, P. Chames, R. C. Hillig, R. L. Stanfield, G. Held, P. G. Coulie, C. Alings, G. Wille, W. Saenger, B. Uchanska-Ziegler, et al. A Major Histocompatibility Complex{middle dot}Peptide-restricted Antibody and T Cell Receptor Molecules Recognize Their Target by Distinct Binding Modes: CRYSTAL STRUCTURE OF HUMAN LEUKOCYTE ANTIGEN (HLA)-A1{middle dot}MAGE-A1 IN COMPLEX WITH FAB-HYB3 J. Biol. Chem., January 28, 2005; 280(4): 2972 - 2980. [Abstract] [Full Text] [PDF]

				B. Laugel, J. M. Boulter, N. Lissin, A. Vuidepot, Y. Li, E. Gostick, L. E. Crotty, D. C. Douek, J. Hemelaar, D. A. Price, et al. Design of Soluble Recombinant T Cell Receptors for Antigen Targeting and T Cell Inhibition J. Biol. Chem., January 21, 2005; 280(3): 1882 - 1892. [Abstract] [Full Text] [PDF]

				M. J. Miley, I. Messaoudi, B. M. Metzner, Y. Wu, J. Nikolich-Zugich, and D. H. Fremont Structural Basis for the Restoration of TCR Recognition of an MHC Allelic Variant by Peptide Secondary Anchor Substitution J. Exp. Med., December 6, 2004; 200(11): 1445 - 1454. [Abstract] [Full Text] [PDF]

				W. E. Biddison, R. V. Turner, S. J. Gagnon, A. Lev, C. J. Cohen, and Y. Reiter Tax and M1 Peptide/HLA-A2-Specific Fabs and T Cell Receptors Recognize Nonidentical Structural Features on Peptide/HLA-A2 Complexes J. Immunol., September 15, 2003; 171(6): 3064 - 3074. [Abstract] [Full Text] [PDF]

				L. Lybarger, Y. Y. L. Yu, M. J. Miley, D. H. Fremont, N. Myers, T. Primeau, S. M. Truscott, J. M. Connolly, and T. H. Hansen Enhanced Immune Presentation of a Single-chain Major Histocompatibility Complex Class I Molecule Engineered to Optimize Linkage of a C-terminally Extended Peptide J. Biol. Chem., July 11, 2003; 278(29): 27105 - 27111. [Abstract] [Full Text] [PDF]

				V. Jankovic, K. Remus, A. Molano, and J. Nikolich-Zugich T Cell Recognition of an Engineered MHC Class I Molecule: Implications for Peptide-Independent Alloreactivity J. Immunol., August 15, 2002; 169(4): 1887 - 1892. [Abstract] [Full Text] [PDF]

				Y. Y. L. Yu, N. Netuschil, L. Lybarger, J. M. Connolly, and T. H. Hansen Cutting Edge: Single-Chain Trimers of MHC Class I Molecules Form Stable Structures That Potently Stimulate Antigen-Specific T Cells and B Cells J. Immunol., April 1, 2002; 168(7): 3145 - 3149. [Abstract] [Full Text] [PDF]

				I. Messaoudi, J. LeMaoult, B. M. Metzner, M. J. Miley, D. H. Fremont, and J. Nikolich-Zugich Functional Evidence That Conserved TCR CDR{{alpha}}3 Loop Docking Governs the Cross-Recognition of Closely Related Peptide:Class I Complexes J. Immunol., July 15, 2001; 167(2): 836 - 843. [Abstract] [Full Text] [PDF]

				K. Polakova, D. Plaksin, D. H. Chung, I. M. Belyakov, J. A. Berzofsky, and D. H. Margulies Antibodies Directed Against the MHC-I Molecule H-2Dd Complexed with an Antigenic Peptide: Similarities to a T Cell Receptor with the Same Specificity J. Immunol., November 15, 2000; 165(10): 5703 - 5712. [Abstract] [Full Text] [PDF]

				P. U.Y. Lee, H. R.O. Churchill, M. Daniels, S. C. Jameson, and D. M. Kranz Role of 2C T Cell Receptor Residues in the Binding of Self- and Allo-Major Histocompatibility Complexes J. Exp. Med., April 18, 2000; 191(8): 1355 - 1364. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Messaoudi, I. Articles by LeMaoult, J. Search for Related Content PubMed PubMed Citation Articles by Messaoudi, I. Articles by LeMaoult, J. Pubmed/NCBI databases Compound via MeSH Substance via MeSH Hazardous Substances DB (L)-ARGININE