|
|
||||||||




*
Department of Immunology, The Forsyth Institute, Boston, MA;
Division of Immunology, Childrens Hospital, Boston, MA;
Division of Rheumatology, Immunology and Allergy, Brigham and Womens Hospital, Boston, MA; and
§
Department of Microbiology, Hiroshima University Faculty of Dentistry, Hiroshima, Japan
| Abstract |
|---|
|
|
|---|
selectively enhanced transmigration of
Th1-type cells, but not Th2-type cells, in a transendothelial migration
assay. Enhanced transmigration of Th1-type cells was dependent on the
chemokine RANTES produced by endothelial cells, as indicated by the
findings that Ab neutralizing RANTES, or Ab to its receptor CCR5,
inhibited transmigration. Neutralizing Ab to chemokines
macrophage-inflammatory protein-1
or monocyte chemotactic protein-1
did not inhibit Th1 selective migration. Whereas anti-CD18 and
anti-CD54 blocked basal levels of Th1-type cell adherence to
endothelial cells and also inhibited transmigration, anti-RANTES
blocked only transmigration, indicating that RANTES appeared to induce
transmigration of adherent T cells. RANTES seemed to promote diapedesis
of adherent Th1-type cells by augmenting pseudopod formation in
conjunction with actin rearrangement by a pathway that was sensitive to
the phosphoinositol 3-kinase inhibitor wortmannin and to the Rho
GTP-binding protein inhibitor, epidermal cell differentiation
inhibitor. Thus, enhancement of Th1-type selective migration appeared
to be responsible for the diapedesis induced by interaction between
CCR5 on Th1-type cells and RANTES produced by endothelial cells.
Further evidence that CCR5 and RANTES play a modulatory role in
Th1-type selective migration derives from the abrogation of this
migration by anti-RANTES and anti-CCR5
Abs. | Introduction |
|---|
|
|
|---|
(MIP-1
), MIP-1ß, and RANTES
(8). Of these, only RANTES is produced by endothelial
cells (9). Despite the potential for relationship between
RANTES produced by endothelial cells and CCR5 on T cells, the
functional role of CCR5 in recruitment of Th1-type T cells into
inflammatory lesions is unclear.
The multistep model for lymphocyte transmigration across endothelial
cells consists of 1) lymphocytes rolling on endothelial cells, 2) rapid
activation through G-protein-linked receptors, 3) adhesion to
endothelial cells through activated integrin, and 4) diapedesis
(10, 11, 12, 13, 14). A particular group of chemokines, stromal
cell-derived factor-1, 6-C-kine, MIP-3
, and MIP-3ß, have been
shown to induce rapid and transient (23 min) integrin-dependent
adhesion of rolling lymphocytes, explaining the roles of chemokine in
steps 2 and 3 (15). However, the roles of other chemokines
in lymphocyte transendothelial chemotaxis and their effects on step 4
of this process (diapedesis) remain unclear. Because lymphocyte arrest
on endothelial cells by activation is transient (15),
rapidly acting specific signals are likely to be required to initiate
diapedesis of lymphocytes adherent to endothelial cells, a process
associated with substantial morphological changes in lymphocytes
(16). Although it is likely that endothelial-derived
chemokines contribute to this process, the source and identity of
biofunctional chemokines that regulate the traffic of lymphocytes from
blood stream to tissue is largely unknown.
To gain insight into Th1-type selective polarization into tissue, we
examined T cell transmigration across an endothelial layer in vitro.
Stimulation of endothelial cells with Th1-type cytokine IFN-
selectively enhanced the Th1 cell transmigration across the endothelial
cells. The enhanced Th1-type cell selective transendothelial migration
was dependent on the RANTES produced by endothelial cells and CCR5
expressed on Th1-type cells, but not on Th2-type or naive cells.
Strikingly, both anti-RANTES and anti-CCR5 Ab could abrogate
the Th1-type selective migration. Although RANTES did not affect T cell
adhesion to endothelial cells, it appeared to induce diapedesis of
adherent Th1-type cells by augmenting pseudopod formation beneath the
endothelial cell layer. Our findings point to the new concept that
discrimination of a Th1-type or Th2-type polarized trafficking pattern
is regulated at the diapedesis step.
| Materials and Methods |
|---|
|
|
|---|
T clone cells were isolated from the cervical lymph nodes of Rowett rats that were immunized with the Gram-negative periodontal disease pathogen Actinobacillus actinomycetemcomitans ATCC 43718 (strain Y4) and maintained as previously described (17, 18). Th1-type CD4+ clone cells (G21 and G23) specific for A. actinomycetemcomitans 29-kDa outer membrane protein (Omp29) (19), Th1-type CD4+ clone reactive to an A. actinomycetemcomitans Ag different from Omp29 (G26) and Th2-type CD4+ clone cells specific for Omp29 (F10 and F13) were activated by incubation with formalin-fixed A. actinomycetemcomitans and irradiated (3300 rad) syngeneic rat spleen cells. Rat recombinant IL-2 (1 U/ml; Serotec, Bicester, U.K.) or conditioned medium from Con A-stimulated spleen culture was added to the Th2-type cell culture.
Polarization of Th1 and Th2 cells
Naive CD4+ T lymphocytes were isolated by
passing suspensions of axillary and lateral axillary lymph node cells
through nylon wool and glass wool columns. The
CD8+ population was excluded by panning with mAb
anti-rat CD8 (OX8; Serotec)-coated plates. At least 95% of these
cells were CD4+ when tested with anti-CD4 mAb
(W3/25; Sera Lab, Crawley Down, U.K.). For the establishment of
polarized line T cells, CD4+ cells were treated
in 24-well plates with immobilized anti-rat TCR-
ß mAb (R73, 1
µg/ml, gift of Dr. T. Hünig, Institut für Virologie und
Immunobiologie, Würzburg, Germany) and soluble anti-CD28 mAb
(JJ319, 200 ng/ml, PharMingen, San Diego, CA). For the establishment of
polarized Th1 lines, mouse recombinant IL-12 (2 ng/ml; gift from
Genetic Institute, Cambridge, MA) was added. To develop Th2 lines, rat
recombinant IL-4 (10 ng/ml, PeproTec, Rocky Hill, NJ), mAb hamster
anti-mouse IL-12 p35 (1 µg/ml; gift from Genzyme, Cambridge, MA),
and recombinant rat IL-2 (1 U/ml) were added. Purified
CD4+ T cells (105/well)
were cultured for 5 days under the conditions described. To assess
functional capabilities, the T cell lines were restimulated as
described above. To verify the nature of the T cell lines, the cells
were restimulated with immobilized anti-TCR-
ß and soluble
anti-CD28 alone for 24 h to produce culture supernatant for
IL-4 and IFN-
ELISA.
Rat IL-4 and IFN-
ELISA
The concentration of IL-4 in the culture supernatant was
detected with a rat IL-4 ELISA kit with a lower detection limit of 15
pg/ml (BioSource International, Camarillo, CA). The amount of IFN-
in the culture supernatant was measured by sandwich ELISA.
Affinity-purified goat anti-rat IFN-
(2 µg/ml) was applied to
the ELISA plate. The samples and standard rat recombinant IFN-
(PeproTec) were diluted in the diluent buffer of the mouse IFN-
ELISA kit (BioSource International). The ELISA reaction was developed
with the reagents, anti-rat IFN-
mAb-biotin conjugate (2
µg/ml, DB-1, BioSource International) and avidin-conjugated
peroxidase (x4000 dilution, Boehringer Mannheim, Indianapolis, IN).
PBS containing 0.02% Tween 20 was used as the diluent and washing
solution. The ELISA color was developed for 5 min by reaction of
substrate o-phenylenediamine dihydrochloride (Sigma, St.
Louis, MO), 2.5 mg/ml in 0.1 M phosphate citrate buffer (pH 5.5) with
0.03% hydrogen peroxide, and terminated by 2 N
H2SO4. The lower detection
limit of rat IFN-
ELISA was 10 pg/ml.
Endothelial clone cells (ECC)
The establishment and the characteristics of a Rowett rat aorta endothelial clone cell (MAT-1) have been reported previously (18). ECC were maintained in 10% FBS-RPMI medium supplemented with 2.5% rat brain conditioned medium. Rat brain conditioned medium was prepared from a 2-day culture supernatant of minced rat whole brain tissue (46 mo old) in 15 ml of RPMI 1640 complete medium. The morphology and phenotype of MAT-1 were stable after >100 passages, showing no change in the expression pattern of ICAM-1, VCAM-1, MHC class I, MHC class II, very late Ags-1, inducible nitric oxide synthase, cyclooxygenase-2, RANTES, and von Willebrand factor.
Rabbit polyclonal anti-rat chemokine Abs and rat cross-reactive anti-human CCR5
Rabbit polyclonal anti-rat RANTES (PeproTec), anti-rat
MIP-1
(PeproTec) and anti-rat monocyte chemotactic protein-1
(MCP-1; PeproTec) reacted in direct ELISA with recombinant rat RANTES,
MIP-1
, and MCP-1 (PeproTec), respectively. No cross-reactivity to
these other recombinant chemokines was observed in direct ELISA when
these sera were tested against wells coated with 0.1 µg/ml of the
respective recombinant chemokines (RANTES, MIP-1
, and MCP-1). Also,
transendothelial chemotaxis exhibited by G23 (stimulated with APC and
A. actinomycetemcomitans for RANTES and MIP-1
, or with
IL-2 alone for MCP-1) to each of the chemokines above was inhibited
only by the respective corresponding Abs. RANTES-induced
transendothelial chemotaxis of G23 was also inhibited by CCR5 mAb
(anti-human CCR5 mAb, which cross-reacts with rat CCR5, clone
45502.111, IgG2b, R&D Systems, Minneapolis, MN). According to the
manufacturers report (R&D Systems), this mAb (#45502.111) reacts with
the amino-terminal domain of human CCR5 (20) which has
considerable homology with rat CCR5 (87% in the first 73 amino acids).
This mAb also blocks human recombinant RANTES-induced calcium flux on
human CCR5-transfected Swiss 3T3 cells, and it reacts with CCR5 on
fixed human PBMC in flow cytometry.
Flow cytometry
T cells were stained with mouse mAb to rat CD18 (IgG2a, Endogen, Boston, MA), anti-CCR5 (clone 45502.111) or isotype control mouse mAb (clone 44531.111, IgG2b (R&D Systems); clone PA20, IgG1; and clone PF18, IgG2a (21)) followed by FITC-labeled rat F(ab')2 anti-mouse IgG (Jackson ImmunoResearch Laboratory, West Grove, PA). All viable T cells were isolated by Isolymph (Gallard-Schlesinger, Carle Place, NY) gradient centrifugation and fixed with 2% paraformaldehyde before mAb staining. Endothelial cells were removed from culture flasks by washing with 0.05% EDTA-PBS and single-cell suspensions were stained with anti-rat ICAM-1 (IgG1, Serotec) followed by FITC-labeled rat F(ab')2 anti-mouse IgG. Fluorescence data were collected by using logarithmic amplification on 20,000 T cells or 5,000 endothelial cells as determined by forward light scatter intensity on a FACScan flow cytometer (Becton Dickinson, Mountain View, CA).
CCR5 and RANTES detection by RT-PCR
Total RNA was extracted from the cells using RNAzolB as described in the protocol of the manufacturer (Tel-Test, Friendswood, TX). First-strand cDNA was prepared by Superscript II (Life Technologies, Gaithersburg, MD), hexanucleotide mixture (Boehringer Mannheim) and 100 ng of sample RNA. PCR was performed on the resulting cDNA from each sample with specific primers for rat RANTES and ß-actin which were previously described elsewhere (22, 23). The PCR primer set specific to rat CCR5 was designed as the following sequences: 5' primer, ATCTATGACATCGATTATAGTATGTC, 3' primer, TAATGAGAA CCTTCTTTTTGAGATCT. The specificity of this primer set was searched by basic local alignment search tool and showed no cross-reactivity to any rat gene. cDNA was amplified 20 or 30 cycles (94°C for 30 s, 60°C for 1 min, 72°C for 1 min, and final elongation time of 10 min at 72°C) for CCR5 or RANTES with ß-actin as an internal control. PCR products were separated in 1.7% agarose gels and stained with ethidium bromide.
RANTES detection by immunoprecipitation
After stimulation of ECC with IFN-
for 18 h, cells were
incubated in methionine-free RPMI containing 2% dialyzed FBS for 30
min and were labeled with 100 µCi of
[L-35S]methionine (DuPont,
Wilmington, DE) for 3 h. The harvested supernatant was mixed with
1% Triton X-100, 10% glycerol, 1 mM DTT, 1 mM PMSF, and protease
inhibitor mixture (Boehringer Mannheim) and precleared by control
rabbit IgG. The supernatant was immunoprecipitated using rabbit
anti-RANTES or anti-MIP-1
or anti-MCP-1 antiserum and
GammaBind Plus Sepharose beads (Amersham Pharmacia Biotech, Piscataway,
NJ). The samples were electrophoresed on a 1020% polyacrylamide
gradient gel and exposed to x-ray film.
T lymphocyte adhesion to ECC
ECC were cultured in 96-well tissue culture plates and allowed
to reach confluency. T clone cells or T line cells were labeled with
[3H]thymidine (2 µCi/ml) for last 16 h
during 3 days of stimulation with the Ag and spleen APC or with
anti-TCR-
ß mAb and anti-CD28 mAb.
[3H]Thymidine-labeled T lymphocytes (2 x
105/100 µl/well) were applied to the confluent
layer of ECC with saturating concentration of inhibiting Abs (10
µg/ml) in RPMI 1640 with 10% FBS. After incubation for various times
in the tissue culture incubator, the wells were washed three times with
RPMI 1640 to remove nonadherent lymphocytes. NaOH, 2 N, 100 µl, was
added to lyse the cells. Adherence was quantitated by analyzing the
radioactivity in the well compared with the radioactivity from whole
lymphocytes applied to a well. Incubation for 3 min was determined to
be optimal for adhesion assessment, because a maximal 4555% of T
cells bound to the ECC. By 6 min, the T cells were beginning to extend
pseudopods beneath the ECC (see Fig. 9
l). Test and controls
were performed in triplicate in each experiment.
|
The T lymphocyte transmigration system was modified from the
method of Carr et al. (24) and performed as reported
previously (18). Briefly, a single-cell suspension of ECC
(35 x 104 cells/ml in RPMI with 10% FBS)
was applied onto 0.2% gelatin-coated cell culture inserts
(polyethylene terephthalate filter, 3-µm pore size, 9.0-mm diameter,
24-well format; Becton Dickinson) and cultured for 1 or 2 days.
Confluent ECC on a filter membrane were either cultured for 24 h
in medium alone or stimulated with recombinant rat IFN-
(1000 U/ml,
Life Technologies). T cells (2 x 105
cells/filter) in RPMI with 10% FBS were overlaid on the ECC confluent
layer with or without blocking Abs (10 µg/ml), and incubated in a
37°C, 5% CO2 atmosphere. The lymphocytes
transmigrated across the ECC (transendothelial migration) in 35 h
into the lower wells of the plate and were harvested, resuspended in 40
µl, and counted in a hemocytometer. Ethidium bromide and acridine
orange were routinely used for staining cells before counting.
Fluorescence labeling of cytoplasm and F-actin of adherent T cells on ECC
T cells were labeled with the thiol-reactive, live cell labeling
reagent, Cell Tracker Green 5-chloromethylfluorescein diacetate
(Molecular Probes, Eugene, OR). T cells (2 x
105/200 µl, in RPMI with 10% FBS) were
preincubated in the presence or absence of wortmannin (100 nM, Biomol
Research Laboratories, Plymouth Meeting, PA), epidermal cell
differentiation inhibitor (EDIN, 100 ng/ml (25)),
cytochalasin D (100 ng/ml, Sigma), or anti-CCR5 (10 µg/ml) for 30
min and washed twice. T cells were applied onto confluent
IFN-
-stimulated or unstimulated ECC on a coverglass and incubated in
a 37°C, 5% CO2 atmosphere. In some wells,
anti-RANTES was applied to the ECC together with T cells. After
incubation for 3 to 6 min, nonadherent T cells on ECC were washed off
and fixed with 2% paraformaldehyde in PBS for 10 min, and cells were
permeabilized with 0.2% Triton X-100 in PBS for 10 min. F-actin was
stained by Texas Red-conjugated phalloidin (Molecular Probes).
Immunofluorescence was analyzed by fluorescence microscopy at x400 or
x1000 magnification.
Electron microscopic analysis
The methods were modified from a previous report of Parton
(26). The clone G23 cells were incubated with unstimulated
or IFN-
-stimulated ECC on the polyethylene terephthalate filter for
8 min. This was followed by the removal of all media and gently rinsing
once with PBS to remove nonadherent cells and proteins. The membranes
were fixed in 2.5% glutaraldehyde/1% paraformaldehyde in 0.1 M sodium
cacodylate buffer (pH 7.4) for 20 min at room temperature before being
cut into small strips (2 x 4 mm), followed by 1% osmium
tetroxide in 0.1 M sodium cacodylate buffer (pH 7.4), and 1% uranyl
acetate in 0.1 M maleate buffer (pH 5.2). After dehydration with
sequential concentration of ethanol from 50 to 100%, the membranes
were immersed in 1 ml 100% propylene for 20 min. Subsequently, the
samples were incubated with Spurrs resin (Electron Microscopy
Science, Fort Washington, PA): propylene oxide, 1:3, 1:1, 3:1 for
2 h each; 100% Spurrs resin for 12 h; followed by fresh
100% Spurrs resin overnight at 60°C for polymerization.
Finally, thin sections were stained with 3% uranyl acetate in
50% methanol for 10 min and Reynolds lead citrate for 30 s.
Electron micrographs were obtained with a JEOL 100 CX transmission
electron microscope operated at an accelerating voltage of 80
kV.
| Results |
|---|
|
|
|---|
selectively enhances
transmigration of Th1-type cells
To examine Th1 or Th2 subset specific transendothelial-migration,
we developed polarized Th1 or Th2 lines by stimulation with immobilized
anti-TCR-
ß and soluble anti-CD28 mAb in the presence of
IL-12 or IL-4, respectively. The character of Th1- or Th2-type cells
was ascertained by the cytokine production pattern of IFN-
and IL-4
(Table I
). The Th1 polarized line
and clones G21, G23, and G26 produced only detectable IFN-
, whereas
the Th2 polarized line and clones F10 and F13 produced only
detectable IL-4.
|
, we tested transendothelial migration of Th1-type
clone cells and the polarized Th1 line or Th2-type clone cells and the
Th2 line, respectively (Fig. 1
enhanced transendothelial migration of
the Th1 clone cells (G21, G23, and G26) and polarized Th1 line cells.
In contrast, IFN-
treatment of ECC enhanced the transendothelial
migration of neither the Th2-type line cells nor Th2-type clone cells
(F10 and F13). These Th2 lines or clones demonstrated a modest level of
basal transmigration as opposed to naive CD4+ T
cells, which showed little basal migration and also no response to
IFN-
-simulated ECC. Although naive CD4+ T
cells did not demonstrate IFN-
-mediated enhancement of
transmigration, such enhancement was observed when these T cells were
polarized to a Th1 phenotype by stimulation with immobilized
anti-TCR-
ß and soluble anti-CD28 mAb for 3 days in the
presence of IL-12 (Fig. 1
|
Because it has been shown that CCR5 is preferentially expressed on
Th1 cells by Northern blotting (4) and flow cytometry
analysis (7), we hypothesized that CCR5 might be
responsible for Th1-specific migration induced by IFN-
-stimulated
ECC. Expression of CCR5 mRNA by T cells was first tested by RT-PCR
(Fig. 2
A). Expression of CCR5
mRNA by stimulated Th1 clone or Th1 line cells was detected. Little or
no CCR5 mRNA production was observed by unstimulated Th1 clone, naive
CD4+ T, stimulated Th2 clone, or Th2 line cells.
We further tested surface expression of CCR5 by Th1 or Th2 clone cells
by means of flow cytometric analyses (Fig. 2
B). CCR5 was
expressed only on Th1-type clone cells, but not on Th2-type cells or
naive CD4+ T cells. T cells need to receive
special signals from adhesion molecules or chemokine receptors for
transmigration after loose adhesion to endothelial cells. Thus, we also
examined adhesion molecule expression on the same battery of T cells
(Fig. 2
B). Previous studies (27) have
demonstrated the importance of adhesion interaction between ICAM-1
(CD54) and LFA-1 (CD11a/CD18) for T cell transmigration across
endothelium, and adhesion molecules may be associated with Th1-specific
transmigration. However, the expression of CD18 was similarly increased
on both Th1 and Th2 clone cells (Fig. 2
B) and on polarized
line cells (data not shown) when compared with naive T cells,
suggesting that levels of this integrin did not determine the observed
transmigration difference in Th1 as opposed to Th2 cells but could
affect differences observed between activated opposed to naive
cells.
|
-stimulated ECC
Stimulation of ECC with IFN-
induced enhanced ICAM-1 expression
(a counterligand of LFA-1 (Fig. 3
A)). IFN-
also induced
RANTES mRNA detected by RT-PCR (Fig. 3
B) and RANTES protein
expression observed by immunoprecipitation (Fig. 3
C).
Although T clone cells (G23) were not able to produce RANTES after 3
days of activation with APC and Ag, this was the time period (3 days)
when T clone cells exhibited maximal transmigration across endothelial
cells, implying that T cell production of RANTES was not a factor in T
cell transmigration. Importantly, no RANTES is produced by ECC in the
absence of IFN-
. Of the three chemokines that can bind to CCR5,
RANTES, but not MIP-1
or MIP-1ß, can be induced on endothelial
cells by IFN-
stimulation (28, 29). We also observed
that ECC stimulation with IFN-
induced the protein expression of
RANTES and MCP-1, but not MIP-1
(Fig. 3
D).
|
, or MCP-1, was
applied to the lower compartment of the unstimulated ECC confluent
layer. Then, Th1-type T clone cells (G23) or Th2-type T clone cells
(F13) were applied on top of the ECC layer (Fig. 4
, but not to MCP-1 (Fig. 4
|
The chemotactic effect of the supernatant of IFN-
-stimulated or
unstimulated ECC was examined (Fig. 5
A). The Th1-type clone G23
cells were stimulated with APC and Ag for 3 days and utilized in the
transmigration assay. Enhanced transmigration chemotaxis of G23 was
observed when the supernatant of IFN-
-stimulated ECC was applied
into the lower compartment of the transmigration system in which the
chambers were separated by an unstimulated ECC confluent layer (Fig. 5
A). This enhanced transendothelial chemotaxis was inhibited
by anti-RANTES neutralizing Abs, but not by anti-MIP-1
or
anti-MCP-1 neutralizing Abs. The supernatant of unstimulated ECC
did not enhance transendothelial migration when compared with the
medium control. Thus, the production of RANTES by IFN-
-stimulated
ECC induced the transmigration of Th1-type T cells.
|
Because the T cell chemotactic effect in IFN-
-stimulated ECC
was inhibited by Abs to RANTES, we considered that RANTES could affect
T cell adhesion to ECC. No effect on G23 adhesion to unstimulated ECC
was observed when various concentrations of recombinant RANTES or
IFN-
-stimulated ECC supernatant were added to the G23, ECC adhesion
system (Fig. 5
B). Also, no effect was observed when Th2
(F13) or polarized Th1 cells were substituted for G23 in the assay of
adhesion to unstimulated ECC (data not shown).
Inhibition of Th1-type selective migration by both anti-RANTES and anti-CCR5 Ab
Further to examine the effect of endothelial-derived RANTES on
adhesion, we tested the effects of polyclonal anti-RANTES,
monoclonal anti-CCR5, anti-CD18 (LFA-1ß), and anti-CD54
(ICAM-1) Abs on adhesion (3 min; Fig. 6
A) and transmigration (3 h;
Fig. 6B
) of Th1-type clone G23. G23 demonstrated increased adhesion to
IFN-
-stimulated ECC when compared with unstimulated ECC. Anti-CD18
mAb and anti-CD54 mAb significantly inhibited the Th1-type clone
G23 adhesion to either unstimulated or IFN-
-stimulated ECC, whereas
anti-CCR-5 or anti-RANTES had no effects on adhesion of G23 to
either unstimulated or IFN-
-stimulated ECC. Transmigration of G23
was significantly enhanced on IFN-
-stimulated ECC compared with
unstimulated ECC, and this enhanced transmigration was abolished by Abs
to CD18, CD54, CCR5, or RANTES (Fig. 6
B). In contrast,
anti-CCR5 or anti-RANTES had no effect on the basal level of
transmigration of G23 across unstimulated ECC (mean, 5684 transmigrated
cells/well (Fig. 6
B)), although this was inhibited by
anti-CD18 (mean, 2281 transmigrated cells/well (Fig. 6
B)) and anti-CD54 (mean, 3268 transmigrated cells/well
(Fig. 6
B)). These results suggested that transmigration
induced by RANTES binding to CCR5 on Th1 cells was not simply the
result of enhanced integrin-mediated adhesion and thus implied
chemokine involvement in a subsequent step after adhesion.
|
stimulation of ECC. None of the blocking
Abs reactive to CCR5, RANTES, or MCP-1 inhibited the basal Th2 line
cell transendothelial migration. Transmigration of Th1 line cells was
enhanced by IFN-
stimulation of ECC. Only the enhanced
transmigration of Th1 line cells by IFN-
-stimulated ECC was
abrogated by anti-CCR5 and anti-RANTES, but not by
anti-MIP-1
or anti-MCP-1. These reagents also did not affect
Th1 basal transendothelial migration.
|
We further explored the mechanism for the enhancement of Th1-type
cell transmigration induced by endothelial cell RANTES using
pharmacological agents known to interfere in signaling pathways
activated by chemokines. Chemokine receptors are linked to the
heterotrimeric guanine nucleotide-binding protein (G protein), which
transduces signals through activation of PI-3 kinase (31).
In addition, the coupling of Rho GTP-binding proteins to G proteins
linked to the chemokine receptor triggers integrin-mediated leukocyte
adhesion (32). This process is also thought to involve
actin rearrangement, which is necessary for cell migration
(16). Hence, we tested the hypothesis that RANTES-CCR5
interaction could activate PI-3 kinase and/or induce Rho-related actin
rearrangement. Preincubation of G23 cells with recombinant RANTES for 3
min enhanced transendothelial migration even in the absence of a
chemotactic factor in the lower compartment of the transmigration
system (Fig. 8
). This enhancement was
abolished in a dose-dependent manner by the PI-3 kinase inhibitor
wortmannin, the Staphylococcus aureus toxin EDIN which
deactivates Rho (25), and by cytochalasin D which inhibits
actin rearrangement. In contrast, the basal transmigration of G23
preincubated in medium alone was not affected by either wortmannin or
EDIN but was inhibited by cytochalasin D (Fig. 8
). This observation
suggested that RANTES enhanced T cell motility through activation of
PI-3 kinase and the Rho-related pathway during the 3 min of chemokine
pretreatment.
|
The extension of pseudopods in response to migratory stimuli is
universally coupled with local actin polymerization (16).
To investigate T cell morphology in situ, Th1-type clone G23 T cells
were visualized by live cell staining with green fluorescent dye (Figs. 9
, aj). F-actin of both T
cells and ECC was stained with Texas Red-conjugated phalloidin
(Molecular Probes). In the early 3-min incubation, the adherent G23
cells were round and formed few or no pseudopods on the
IFN-
-stimulated ECC (Fig. 9
a). However, after 6 min of
incubation, dramatic pseudopod formation was observed in G23 cells
adherent on the IFN-
-stimulated ECC (Fig. 9
b). The
pseudopod induction was arrested by anti-RANTES (Fig. 9
c) or EDIN (Fig. 9
d) and was not induced in G23
cells adherent for the same interval on unstimulated ECC (Fig. 9
e). The number of G23 cells adhering to IFN-
-stimulated
ECC (Fig. 9
, ad) was
60% greater than on unstimulated
ECC (Fig. 9
e). Also, anti-RANTES did not inhibit G23
cell adhesion to IFN-
-stimulated ECC (Fig. 9
c),
indicating that RANTES is not involved in Th1 cell adhesion to
IFN-
-stimulated ECC.
At higher magnification, no pseudopods were observed on G23 cells on
anti-RANTES treated IFN-
-stimulated ECC when the plane of focus
was either at the ECC surface (Fig. 9
g) or in the cytoplasm
of the ECC (Fig. 9
h). However, pseudopod elongation was
observed on G23 cells on the IFN-
-stimulated ECC when the focal
plane was adjusted to the cytoplasm of the ECC (Fig. 9
j), as
compared with the absence of pseudopods when the focal plane was at the
surface of the ECC (Fig. 9
i). The pseudopods exhibited a
dense uniform F-actin staining pattern in their peripheral membrane,
indicating that their formation was associated with actin rearrangement
(Fig. 9
j). The cross-sectional morphology of G23 cells on
endothelial cells was also studied by electron microscopy (Fig. 9
, k and l). G23 incubated on the IFN-
-stimulated
ECC for 8 min extended pseudopods beneath the ECC layer (Fig. 9
l), in marked contrast to the absence of pseudopod
formation by G23 incubated on unstimulated ECC for the same time period
(Fig. 9
k).
| Discussion |
|---|
|
|
|---|
-stimulated
endothelial cells enhanced the transmigration of Th1-type cells, but
not Th2 cells or naive CD4+ T cells because of
the selective expression of CCR5 on Th1 cells. Although both RANTES and
MIP-1
ß interact with CCR5 (8), only RANTES production
by ECC was induced by IFN-
stimulation in this study. This finding
is supported by reports (9, 28) indicating that human
endothelial cell production of RANTES in vitro is stimulated by IFN-
and that stimulation of endothelial cells with IFN-
mixed with
TNF-
and IL-1ß induces only RANTES production, and not MIP-1
or
-1ß (9). In clinical situations characterized by
Th1-type inflammation such as DTH granuloma lesions in lymph nodes
associated with sarcoidosis or tuberculosis, RANTES was produced in
situ by macrophages and by endothelial cells, in particular
(29). Also,
80% of T cells in rheumatoid arthritis
synovial fluid expressed CCR5, a significant enrichment over the 15%
expression in blood (6). These findings led to suggestions
that RANTES might play a role in the selective accumulation of cells
characterizing cell-mediated immune reactions (29) and
that CCR5 is a marker for T cells associated with Th1-type inflammatory
reactions (6). Here we demonstrated functional interaction
between CCR5 on Th1 cells and RANTES produced by endothelial cells in
the context of T cell transendothelial migration. Both anti-RANTES
and anti-CCR5 Ab could abrogate Th1-type selective migration in
vitro (Figs. 6Cell migration is an important process in a variety of biological phenomena, embryogenesis, angiogenesis, fibroblast migration in wound healing, metastasis, and lymphocyte immigration (16). This process is distinct from the cell to cell adhesion event, because it is characterized by simultaneous attachment at the leading edge and detachment at the rear end of the motile cell. Furthermore, diapedesis, the lymphocyte transmigration step across an endothelial cell layer, requires proteolytic remodeling of the extracellular matrix of basement membrane (33). A particularly strong signal would be expected to induce diapedesis by the adherent lymphocyte on the luminal surface of the endothelial cell layer. Cytoskeletal reconstruction by actin rearrangement is well studied in cell migration phenomena. The activation of leukocyte adhesion through integrin is induced by chemokine receptor stimulation associated with the GTP-binding protein RhoA (32). The Rho family and PI-3, PI-5 are relevant signal transduction molecules involved in the cell migration processes by activating actin rearrangement (16). In the present study, the signal from RANTES which induced pseudopod formation within 6 min was inhibited by wortmannin and EDIN, suggesting very rapid signal transduction by RANTES receptors. RANTES is a unique chemokine that activates dual T cell signaling pathways (34) by activating an initial transient (2030 s) G protein-dependent signal, and a second long-lasting (2- to 3-min) signal mediated by protein tyrosine kinase. RANTES stimulation of T lymphocytes induces the redistribution of ICAM-3 at the uropod in conjunction with the cytoskeletal protein moesin (35). These data indicate that RANTES not only up-regulates actin rearrangement for T cell locomotion, but also induces other required biological functions for transmigration.
In addition to CCR5, CXCR3 has been clinically associated with similar
types of Th1 inflammatory lesions (6). CXCR3 may be less
significant than CCR5 in Th1 cell accumulation in inflammatory lesions.
Although CCR5 and CXCR3 are expressed on human Th1-type cells (4, 6), CCR5 seems to be characteristic of Th1 lymphocytes, because
CXCR3 can be expressed on both Th1 and Th2 cells cultured with IL-2
(7). Although CXCR3 (36) is the receptor for
IP-10 (IFN-inducible protein 10), MIG (monokine induced by IFN-
),
and I-TAC (IFN-inducible T cell
chemoattractant), all inducible by
IFN-
stimulation of endothelial cells (37), it does not
appear that these chemokines are significant in transmigration. The CXC
chemokines IL-8 or IP-10 are not able to induce transendothelial
chemotaxis of memory-type CD3+ lymphocytes,
whereas RANTES can induce transendothelial chemotaxis of such
CD3+ lymphocytes in the same system
(38). Also, chemoattractant activity of recombinant RANTES
for human peripheral blood T lymphocytes is 2-fold greater than
recombinant IP-10 at the optimal concentration of each chemokine
(39). Because CXCR3 is also found on Th2 lymphocytes, if
it were significant in transmigration, we would expect that IFN-
stimulation of ECC would induce CXC chemokines which should produce Th2
transmigration. This did not occur (Fig. 1
). Therefore, although there
appears to be potential for contribution of CXC chemokines and CXCR3 to
transmigration, CCR5 which is selectively expressed on Th1 cells, is
the key to regulation of Th1 transmigration by RANTES produced by
IFN-
-stimulated endothelial cells.
RANTES or MIP-1ß does not induce rapid adhesion of lymphocytes to
ICAM-1 in 3 min compared with stromal cell-derived factor-1
which
shows dramatic adhesion to ICAM-1 during the same period of incubation
(15). The 3-min incubation reflects more the physiological
conditions of blood flow. Our results also showed that RANTES produced
by ECC was not responsible for the T cell adhesion to
IFN-
-stimulated ECC in 3 min (Figs. 5
, 6
, and 9
). Despite the lack
of responsibility for direct adhesion, RANTES induced diapedesis of T
cells within 6 min of incubation (Fig. 9
).
It has been demonstrated that T cells can produce RANTES (40, 41). However, in our experiments no detectable RANTES was
produced by Th1 clone cells during 3 days of Ag stimulation (Fig. 3
C). In contrast to many T cell products that are expressed
within hours of activation, such as IL-2, the gene encoding RANTES is
up-regulated
5 days after stimulation of T cells with Ag or mitogen
(42). Thus, RANTES produced by T cells is unlikely to have
contributed to the induction of Th1 transmigration in our system.
In general, costimulation of T cells with anti-CD28 skews the T
cell response toward Th2 type (43, 44), and in vitro T
cell stimulation with both anti-CD3 and anti-CD28 could induce
Th2-type response in which CCR4, but not CCR5, would be preferentially
expressed (4). In the present study, Th1 polarization with
anti-TCR-
ß and anti-CD28 in the presence of IL-12 induced
CCR5 expression and chemotactic response to RANTES. In contrast, Th2
polarization with anti-TCR-
ß and anti-CD28 in the presence
of IL-4 did not induce CCR5 expression or responsiveness to RANTES.
Thus, the various factors known to contribute to Th cell polarization
(TCR, CD28, IL-4, and IL-12) also appear to have important roles in the
regulation of chemokine receptors.
Naive T cells preferentially migrate into peripheral lymph nodes
(13), whereas memory T cells
(CD45RO+/CD29+) traffic
into inflamed tissue (45) or exhibit preferential
transmigration across endothelial cell layers in vitro
(46) compared with CD45RA+ (naive) T
cells. We have demonstrated that the presence of Ag in gingival tissue
can attract and retain Ag-specific T clone cells (G23 and F13) locally
(17). The Th1- and Th2-type clone cells in this study were
memory-type T cells (CD25+,
CD45RC-, very late Ag-4+),
and those Th1- and Th2-type clone cells demonstrated more
transmigration across ECC than naive T cells (Fig. 1
). Therefore, we
believe our transmigration model reflects memory-type T cell migration
into local inflammation.
Endothelial cells regulate neutrophil transmigration by endogenous IL-8 (47). Therefore, it is quite plausible that chemokines produced by endothelial cells are also significant in regulating Th1 cell transmigration from the blood stream. Chemokines appear to target distinct subsets of lymphocytes more selectively than adhesion interactions that are mediated in many cases by molecules, like LFA-1, that were distributed over the entire leukocyte population. Therefore, the study of regulatory mechanisms and the generation of appropriate inhibitors of specific chemokines could be relevant as a therapeutic approach for intervention in many types of immune-mediated diseases. Both chemokines and chemokine receptors comprise large families (8, 48), and it seems feasible that RANTES-CCR5 interaction is not the only chemokine-chemokine receptor interaction that regulates Th1-type cell transmigration. The present study demonstrates the selective activity of RANTES in Th1 transmigration and suggests an important role for the RANTES-CCR5 interaction in the induction of diapedesis by Th1 cells and their recruitment into sites of inflammation.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Current address: Mitsubishi Chemical Corp., Yokohama Research Center, Yokohama, Japan. ![]()
3 Address correspondence and reprint requests to Dr. Martin A. Taubman, Department of Immunology, The Forsyth Institute, 140 Fenway, Boston, MA 02115. E-mail address: ![]()
4 Abbreviations used in this paper: CXCR3, CXC-chemokine receptor-3; ECC, endothelial clone cells; MIP, macrophage-inflammatory protein; MCP, monocyte chemotactic protein; EDIN, epidermal cell differentiation inhibitor; PI-3 kinase, phosphoinositol 3-kinase; IP-10, IFN-inducible protein 10. ![]()
Received for publication April 9, 1999. Accepted for publication July 12, 1999.
| References |
|---|
|
|
|---|
plus TNF-
and inhibition by IL-4 and IL-13. J. Immunol. 154:1870.[Abstract]
, MIP-1ß and RANTES is associated with a type 1 immune response. J. Immunol. 157:3598.[Abstract]
This article has been cited by other articles:
![]() |
T. T. Murooka, R. Rahbar, L. C. Platanias, and E. N. Fish CCL5-mediated T-cell chemotaxis involves the initiation of mRNA translation through mTOR/4E-BP1 Blood, May 15, 2008; 111(10): 4892 - 4901. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schroder, R. N. Pierson III, B.-N. H. Nguyen, D. W. Kawka, L. B. Peterson, G. Wu, T. Zhang, M. S. Springer, S. J. Siciliano, S. Iliff, et al. CCR5 Blockade Modulates Inflammation and Alloimmunity in Primates J. Immunol., August 15, 2007; 179(4): 2289 - 2299. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Turner, E. Olivas, A. Gutierrez, G. Diaz, and P. C. Doherty Disregulated Influenza A Virus-Specific CD8+ T Cell Homeostasis in the Absence of IFN-{gamma} Signaling J. Immunol., June 15, 2007; 178(12): 7616 - 7622. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Ajuebor, Z. Wondimu, C. M. Hogaboam, T. Le, A. E.I. Proudfoot, and M. G. Swain CCR5 Deficiency Drives Enhanced Natural Killer Cell Trafficking to and Activation within the Liver in Murine T Cell-Mediated Hepatitis Am. J. Pathol., June 1, 2007; 170(6): 1975 - 1988. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Cavusoglu, C. Eng, V. Chopra, L. T. Clark, D. J. Pinsky, and J. D. Marmur Low Plasma RANTES Levels Are an Independent Predictor of Cardiac Mortality in Patients Referred for Coronary Angiography Arterioscler. Thromb. Vasc. Biol., April 1, 2007; 27(4): 929 - 935. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Schreiber, V. Shinder, D. W. Cain, R. Alon, and R. Sackstein Shear flow-dependent integration of apical and subendothelial chemokines in T-cell transmigration: implications for locomotion and the multistep paradigm Blood, February 15, 2007; 109(4): 1381 - 1386. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawai, T. Matsuyama, Y. Hosokawa, S. Makihira, M. Seki, N. Y. Karimbux, R. B. Goncalves, P. Valverde, S. Dibart, Y.-P. Li, et al. B and T Lymphocytes Are the Primary Sources of RANKL in the Bone Resorptive Lesion of Periodontal Disease Am. J. Pathol., September 1, 2006; 169(3): 987 - 998. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. T. Murooka, M. M. Wong, R. Rahbar, B. Majchrzak-Kita, A. E. I. Proudfoot, and E. N. Fish CCL5-CCR5-mediated Apoptosis in T Cells: REQUIREMENT FOR GLYCOSAMINOGLYCAN BINDING AND CCL5 AGGREGATION J. Biol. Chem., September 1, 2006; 281(35): 25184 - 25194. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zernecke, E. A. Liehn, J.-L. Gao, W. A. Kuziel, P. M. Murphy, and C. Weber Deficiency in CCR5 but not CCR1 protects against neointima formation in atherosclerosis-prone mice: involvement of IL-10 Blood, June 1, 2006; 107(11): 4240 - 4243. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Baba, A. Ishizu, S. Iwasaki, A. Suzuki, U. Tomaru, H. Ikeda, T. Yoshiki, and M. Kasahara CD4+/CD8+ macrophages infiltrating at inflammatory sites: a population of monocytes/macrophages with a cytotoxic phenotype Blood, March 1, 2006; 107(5): 2004 - 2012. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuyama, T. Kawai, Y. Izumi, and M. A Taubman Expression of Major Histocompatibility Complex Class II and CD80 by Gingival Epithelial Cells Induces Activation of CD4+ T Cells in Response to Bacterial Challenge Infect. Immun., February 1, 2005; 73(2): 1044 - 1051. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Skwor, H. Cho, C. Cassidy, T. Yoshimura, and D. N. McMurray Recombinant guinea pig CCL5 (RANTES) differentially modulates cytokine production in alveolar and peritoneal macrophages J. Leukoc. Biol., December 1, 2004; 76(6): 1229 - 1239. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sarween, A. Chodos, C. Raykundalia, M. Khan, A. K. Abbas, and L. S. K. Walker CD4+CD25+ Cells Controlling a Pathogenic CD4 Response Inhibit Cytokine Differentiation, CXCR-3 Expression, and Tissue Invasion J. Immunol., September 1, 2004; 173(5): 2942 - 2951. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Gergel and M. B. Furie Populations of Human T Lymphocytes That Traverse the Vascular Endothelium Stimulated by Borrelia burgdorferi Are Enriched with Cells That Secrete Gamma Interferon Infect. Immun., March 1, 2004; 72(3): 1530 - 1536. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Stanford and T. B. Issekutz The relative activity of CXCR3 and CCR5 ligands in T lymphocyte migration: concordant and disparate activities in vitro and in vivo J. Leukoc. Biol., November 1, 2003; 74(5): 791 - 799. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Mallat, A. Gojova, V. Sauzeau, V. Brun, J.-S. Silvestre, B. Esposito, R. Merval, H. Groux, G. Loirand, and A. Tedgui Rho-Associated Protein Kinase Contributes to Early Atherosclerotic Lesion Formation in Mice Circ. Res., October 31, 2003; 93(9): 884 - 888. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Gao, X.-Y. Zhou, Y. Yashiro-Ohtani, Y.-F. Yang, N. Sugimoto, S. Ono, T. Nakanishi, S. Obika, T. Imanishi, T. Egawa, et al. The unique target specificity of a nonpeptide chemokine receptor antagonist: selective blockade of two Th1 chemokine receptors CCR5 and CXCR3 J. Leukoc. Biol., February 1, 2003; 73(2): 273 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Poggi, M. R. Zocchi, R. Carosio, E. Ferrero, D. F. Angelini, S. Galgani, M. D. Caramia, G. Bernardi, G. Borsellino, and L. Battistini Transendothelial Migratory Pathways of V{delta}1+TCR{gamma}{delta}+ and V{delta}2+TCR{gamma}{delta}+ T Lymphocytes from Healthy Donors and Multiple Sclerosis Patients: Involvement of Phosphatidylinositol 3 Kinase and Calcium Calmodulin-Dependent Kinase II J. Immunol., June 15, 2002; 168(12): 6071 - 6077. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. Savinov, F. S. Wong, and A. V. Chervonsky IFN-{gamma} Affects Homing of Diabetogenic T Cells J. Immunol., December 1, 2001; 167(11): 6637 - 6643. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. B. Sundstrom, L. K. McMullan, C. F. Spiropoulou, W. C. Hooper, A. A. Ansari, C. J. Peters, and P. E. Rollin Hantavirus Infection Induces the Expression of RANTES and IP-10 without Causing Increased Permeability in Human Lung Microvascular Endothelial Cells J. Virol., July 1, 2001; 75(13): 6070 - 6085. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-H. Cho, S.-Y. Seong, M.-S. Choi, and I.-S. Kim Expression of Chemokine Genes in Human Dermal Microvascular Endothelial Cell Lines Infected with Orientia tsutsugamushi Infect. Immun., March 1, 2001; 69(3): 1265 - 1272. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Ding, K. Xiong, and T. B. Issekutz Chemokines stimulate human T lymphocyte transendothelial migration to utilize VLA-4 in addition to LFA-1 J. Leukoc. Biol., March 1, 2001; 69(3): 458 - 466. [Abstract] [Full Text] |
||||
![]() |
M.A. Taubman and T. Kawai Involvement of T-Lymphocytes in Periodontal Disease and in Direct and Indirect Induction of Bone Resorption Critical Reviews in Oral Biology & Medicine, January 1, 2001; 12(2): 125 - 135. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Zhang, N. W. Lukacs, V. A. Lawless, S. L. Kunkel, and M. H. Kaplan Cutting Edge: Differential Expression of Chemokines in Th1 and Th2 Cells Is Dependent on Stat6 But Not Stat4 J. Immunol., July 1, 2000; 165(1): 10 - 14. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawai, M. Seki, H. Watanabe, J. W. Eastcott, D. J. Smith, and M. A. Taubman Th1 transmigration anergy: a new concept of endothelial cell-T cell regulatory interaction Int. Immunol., June 1, 2000; 12(6): 937 - 948. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kawai, R. Eisen-Lev, M. Seki, J. W. Eastcott, M. E. Wilson, and M. A. Taubman Requirement of B7 Costimulation for Th1-Mediated Inflammatory Bone Resorption in Experimental Periodontal Disease J. Immunol., February 15, 2000; 164(4): 2102 - 2109. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |