The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerber, D. J.
Right arrow Articles by Pereira, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerber, D. J.
Right arrow Articles by Pereira, P.
The Journal of Immunology, 1999, 163: 3076-3082.
Copyright © 1999 by The American Association of Immunologists

IL-4-Producing {gamma}{delta} T Cells That Express a Very Restricted TCR Repertoire Are Preferentially Localized in Liver and Spleen1

David J. Gerber*, Véronique Azuara{dagger}, Jean-Pierre Levraud{ddagger}, Shu Ying Huang*, Marie-Pierre Lembezat{dagger} and Pablo Pereira2,{dagger}

* Howard Hughes Medical Institute, Center for Cancer Research, and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; and {dagger} Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique, URA 1961, and {ddagger} Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Medicale, Unité 277, Institut Pasteur, Paris, France


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
IL-4-producing {gamma}{delta} thymocytes in normal mice belong to a distinct subset of {gamma}{delta} T cells characterized by low expression of Thy-1. This {gamma}{delta} thymocyte subset shares a number of phenotypic and functional properties with the NK T cell population. Thy-1dull {gamma}{delta} thymocytes in DBA/2 mice express a restricted repertoire of TCRs that are composed of the V{gamma}1 gene product mainly associated with the V{delta}6.4 chain and exhibit limited junctional sequence diversity. Using mice transgenic for a rearranged V{gamma}1J{gamma}4C{gamma}4 chain and a novel mAb (9D3) specific for the V{delta}6.3 and V{delta}6.4 murine TCR{delta} chains, we have analyzed the peripheral localization and functional properties of {gamma}{delta} T cells displaying a similarly restricted TCR repertoire. In transgenic mice, IL-4 production by peripheral {gamma}{delta} T cells was confined to the {gamma}{delta}+9D3+ subset, which contains cells with a TCR repertoire similar to that found in Thy-1dull {gamma}{delta} thymocytes. In normal DBA/2 mice such cells represent close to half of the {gamma}{delta} T cells present in the liver and around 20% of the splenic {gamma}{delta} T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Most T lymphocytes in the thymus and peripheral lymphoid organs express a TCR composed of {alpha}- and ß-chains ({alpha}ß T cells) and either the CD4 or CD8 coreceptor. However, two distinct populations of T cells have received increased attention during the last few years. One is composed of cells that use {gamma}- and {delta}-chains to form their TCR ({gamma}{delta} T cells) (1). The other is composed of {alpha}ß T cells that bear markers common to NK cells and are referred to as NK T cells (2, 3, 4). Although they comprise a minor portion of T cells in the thymus and peripheral lymphoid organs, these T cell populations constitute an important fraction of T lymphocytes present in other anatomical sites. Thus, {gamma}{delta} T cells are the predominant T cell population in most epithelial surfaces (1), whereas NK T cells represent around half of the T lymphocytes found in liver and bone marrow (2, 5, 6, 7).

We have recently characterized a population of {gamma}{delta} thymocytes that shares a number of phenotypic and functional characteristics with NK T cells (8). In the thymus, this {gamma}{delta} T cell population differs from conventional {gamma}{delta} T cells in its low expression of Thy-1, and thus, we referred to it as the Thy-1dull {gamma}{delta} T cell population. Similar to NK T cells, most Thy-1dull {gamma}{delta} thymocytes express a phenotype usually associated with activated or memory T cells, and approximately half of them express the NK1.1 cell marker (a member of the NKR-P1 gene family) and/or the CD4 coreceptor (8). Upon activation in vitro, both NK T cells and Thy-1dull {gamma}{delta} T cells produce large amounts of various cytokines, including IL-4, IFN-{gamma}, IL-3, IL-5, IL-10, and GM-CSF (8, 9, 10, 11, 12). Finally, both cell populations have been shown to express a highly restricted TCR repertoire (8, 13, 14, 15). The skewed TCR repertoire expressed by NK T cells is selected by the MHC class-I like molecule CD1d (16, 17, 18, 19). The identity of the putative endogenous molecule selecting the TCR repertoire of the Thy-1dull {gamma}{delta} T cell population (20) is not known.

The physiological functions of NK T cells and Thy-1dull {gamma}{delta} T cells remain unknown. However, recent experiments have shown that NK T cells mediate IL-12-induced tumor cell killing in vivo (21, 22, 23), and several independent lines of evidence suggest that NK T cells may be involved in regulating autoimmunity (24, 25, 26, 27). Despite their ability to promptly produce large amounts of IL-4 upon stimulation in vivo (28), the role of NK T cells in the induction of Th2 responses has been questioned (29, 30, 31). In contrast, a major role of {gamma}{delta} T cells has been demonstrated in the early production of IL-4, which is required for the development of specific IgE responses in the periphery and for subsequent airway inflammation upon intranasal Ag challenge (32). This led to the suggestion that IL-4 production by {gamma}{delta} T cells in the periphery could be important for the development of certain Th2 responses to protein Ags, and thus focused attention on the Thy-1dull {gamma}{delta} T cell population.

An important step in understanding the physiological function of the Thy-1dull {gamma}{delta} T cells is the characterization of their peripheral localization. In this report we have used mice transgenic (Tg)3 for a rearranged V{gamma}1J{gamma}4C{gamma}4 chain and a novel mAb (9D3) specific for the V{delta}6.3 and V{delta}6.4 murine TCR{delta} chains to analyze this issue. Our results show that {gamma}{delta} T cells expressing functional abilities and TCR repertoire similar to those described for the Thy-1dull {gamma}{delta} thymocytes are mainly present in liver and spleen. In normal DBA/2 mice, these {gamma}{delta} T cells are found in the thymus, liver, and spleen at a level of 1–4 x 105 cells/organ.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Mice

C57BL/6 (B6) mice Tg for a rearranged V{gamma}1J{gamma}4C{gamma}4 chain (V{gamma}1Tg) and TCR{delta} knockout mice were maintained in our animal facilities. DBA/2 and (B6 x DBA/2)F1 (B6D2F1) mice were obtained from Iffa Credo (L’Abresle, France). (DBA/2 x B6)F1 (D2B6F1) V{gamma}1Tg were produced by mating DBA/2 females with B6 V{gamma}1Tg males. F1 mice were typed for the presence of the transgene by PCR analysis on tail DNA using primers specific for the V{gamma}1 gene and for the V{gamma}1J{gamma}4 junction (see below). Mice were used between 7–15 wk of age.

Antibodies

Anti-CD4 (RL.174), anti-CD8 (HO-2.2), anti-heat-stable Ag (anti-HSA; J11d), anti-Cß (H57-597), anti-C{delta} (3A10), anti-V{gamma}1 (2.11), and anti-V{delta}6.4/V{delta}6.3 (9D3) were prepared and used as previously described (33). PE-labeled anti-C{delta} (GL3), FITC- or PE-labeled anti-HSA, anti-Thy-1, anti-CD62 ligand (anti-CD62L), anti-CD44, anti-CD69, anti-CD3{epsilon}, anti-CD45RB, anti-NK1.1, anti-CD4, and anti-CD8 were purchased from PharMingen (San Diego, CA). Goat anti-mouse IgM was purchased from Sigma (St. Louis, MO). For the cytokine-specific ELISA we used the following mAb: anti-IFN-{gamma} (clones R46A2, and AN18) and anti-IL-4 (clones BVD4 and BVD6; a gift from Dr. P. Minoprio, Unité d’Immunoparasitologie, Institut Pasteur, Paris, France).

Immunofluorescence staining and FACS

Cells (105-106) were incubated in staining buffer (PBS, 3% FCS, and 0.1%NaN3) with the indicated labeled mAbs for 30 min on ice and washed twice. When biotin-conjugated mAbs were used, the cells were further incubated with either PE-labeled streptavidin (Southern Biotechnology Associates, Birmingham, AL) or streptavidin Tricolor (Caltag, South San Francisco, CA) for 15 min on ice. After another wash, cells were resuspended in staining buffer containing 1 µg/ml propidium iodide and analyzed using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA). Dead cells were gated out either by their staining with PI or by their forward and angle light scatter profile. Data were analyzed using the CellQuest program.

For FACS sorting, cell suspensions were prepared as indicated above and incubated with the appropriate mAb at a concentration of 30 x 106 cells/ml for 30 min on ice. After two washes, cells were resuspended in PBS-10% FCS and sorted in a FACStarPlus cell sorter (Becton Dickinson). The purity of the sorted populations was >95%.

Cell purification, cell culture, and cytokine-specific ELISA

Single-cell suspensions were prepared from the thymus, spleen, lymph nodes, and liver according to standard procedures. CD4-CD8- (DN) and CD8-HSA- thymocytes were prepared by complement-mediated killing as previously described (8). Liver mononuclear cells were isolated by centrifugation in a discontinuous gradient of Percoll (Pharmacia, Uppsala, Sweden). Briefly, total liver cells were resuspended in 100% isotonic Percoll solution and overlaid with 70 and 40% isotonic Percoll solutions. After centrifugation for 30 min at 500 x g, cells at the 40–70% interface were collected, washed twice, and further purified from contaminating RBC by density gradient centrifugation using Lympholyte M (Cedarlane, Hornby, Canada). The cells were washed twice in medium containing 5% FCS. Splenic RBC were lysed by incubating spleen cells for 2 min in 5 ml of NH4Cl solution. Lymph node cells and RBC-depleted spleen cells were resuspended in medium containing 10% FCS at a concentration of 2.5–10 x 106 cells/ml and incubated for 90 min in petri dishes (Optilux, Falcon 1005, Oxnard, CA) previously coated with anti-Cß and anti-IgM Ab (each at 5 µg/ml in PBS), with sporadic agitation. Nonadherent cells were recovered and washed twice before use.

FACS-sorted cells (1.5 x 105 cells/ml) were cultured in flat-bottom microtiter plates previously coated with 10 µg/ml anti-C{delta} mAb (3A10) in complete medium, i.e., DMEM with Glutamax-I medium (Life Technologies, Gaithersburg, MD) supplemented with sodium pyruvate, 5 x 10-5 M 2-ME, nonessential amino acids, and antibiotics (all from Life Technologies) and 10% FCS (Boehringer Mannheim, Meylan, Germany). Mouse rIL-2 was added at a final concentration of 100 U/ml. Supernatants from 3-day cultures were tested for the presence of IL-4 and IFN-{gamma} by ELISA as previously described (34).

Production of the 9D3 mAb

TCR{delta} KO mice were immunized i.p. twice at 2-wk intervals with 5 x 106 DTN40 (V{gamma}1/V{delta}6.4) hybridoma cells and once i.v. with 106 DTN40 hybridoma cells resuspended in PBS. The DTN40 hybridoma was obtained by fusing Thy-1dull {gamma}{delta} thymocytes of DBA/2 origin with BW5147 thymoma cells (8). Three days after the last injection, spleen cells were fused with SP2/0 cells as described previously (33). The cells were then distributed in 96-well flat-bottom plates in complete medium supplemented with hypoxanthine-aminopterin-thymidine. Culture supernatants from growth-positive wells were tested for their ability to bind to the immunizing hybridoma cell but not to a TCR-negative variant of the same hybridoma. Binding of the Ab to the hybridoma cells was detected with FITC-labeled goat anti-mouse Ig (Caltag) and analyzed with a FACScan. The fine specificities of the selected Ab were determined by their ability to stain {gamma}{delta} T cell hybridomas that express different TCR{gamma} and TCR{delta} chains.

Oligonucleotide primers and PCR conditions

The following oligonucleotide primers were used: V{delta}6, TCTGTAGTCTTCCAGAAATCA; V{delta}6.4, GTTTTCCTTATTCGACAAACA; C{delta}, CGAATTCCACAATCTTCTTG; JS1, GTTCCTTGTCCAAAGACGAG; V{gamma}1, CCGGCAAAAAGCAAAAAAGTT; and V{gamma}1J{gamma}4Tg junction, CCCATGATGTGCCTGACCAG. PCR was performed using a GeneAmp PCR system 9600 (Perkin-Elmer/Cetus, Norwalk, CT). Each cycle consisted of incubation at 92°C for 20 s, followed by 55°C for 30 s and 72°C for 30 s. Before the first cycle, a 2-min 94°C denaturation step was included, and after the 35th cycle the extension at 72°C was prolonged for 4 min.

Nucleic acid preparation and population analysis of TCR{delta} rearrangements

Total cellular RNA from sorted cells was extracted with RNA-B (Bioprobe Systems, Montreuil, France). Before RNA extraction, sorted cells were mixed with 106 SP2/0 cells as a carrier. cDNA was synthesized with oligo(dT) (Pharmacia) using superscript reverse transcriptase (Life Technologies) according to the manufacturer’s instructions. The population analysis of TCR{delta} rearrangements has been previously described in detail (8, 20).


    Results and Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
V{gamma}1J{gamma}4C{gamma}4 Tg animals of appropriate genetic background contain a population of Thy-1dull. {gamma}{delta} thymocytes

Given the paucity of {gamma}{delta} cells in the peripheral lymphoid organs in the mouse, it was difficult to study the peripheral representation of the Thy-1dull {gamma}{delta} population in normal mice. To overcome this problem we took advantage of the availability of a mouse Tg for a rearranged V{gamma}1J{gamma}4C{gamma}4 chain that we produced previously (35). The DNA inserted to produce this Tg line consisted of a 45-kb cosmid containing the rearranged V{gamma}1J{gamma}4C{gamma}4 gene flanked by 10 kb of sequence upstream of the V{gamma}1 segment and 26 kb of sequence downstream of the last C{gamma}4 exon (Fig. 1GoA). Thus, this construct should contain all the regulatory elements required to ensure normal expression of the transgene. The cosmid clone was isolated from a T cell hybridoma of B6 origin (T3.13.1) (33), and the V{gamma}1J{gamma}4 junctional sequence is identical with one of the two more common V{gamma}1J{gamma}4 junctional sequences found among the Thy-1dull {gamma}{delta} thymocytes in DBA/2 mice (8). {alpha}ß T cell development in these mice appears quite normal, as indicated by the similar number of total thymocytes (not shown) and of the major thymocyte populations defined by double staining with CD4 and CD8 mAbs in Tg animals and littermate controls (Fig. 1GoB). In contrast, a 3- to 10-fold increase in the number of {gamma}{delta} thymocytes is present in Tg mice compared with littermates, and most of these cells express the transgenic chain (Fig. 1GoC). This increase in the absolute numbers of {gamma}{delta} T cells in the Tg mice is also evident in the periphery, where Tg animals contain 3- to 10-fold more {gamma}{delta} T cells than control littermates; here again, most of the {gamma}{delta} T cells in Tg mice express the V{gamma}1 chain (Fig. 1GoC).



View larger version (39K):
[in this window]
[in a new window]
 
FIGURE 1. A, Restriction map of the {gamma}2F construct used to generate V{gamma}1Tg mice. Variable and constant regions are indicated beneath the map. The sizes of the variable and constant regions are approximate. Not all the restriction sites are necessarily shown. A, ApaI; F, FspI; K, KpnI; N, NotI; R, EcoRI; S, SnaBI. B, Expression of CD4 and CD8 in the thymus of V{gamma}1Tg mice and non-Tg littermates. Thymocytes from the indicated mice were stained with FITC-labeled anti-CD4 and PE-labeled anti-CD8 mAb and analyzed with a FACScan. Numbers indicate the percentage of positive cells in each quadrant. C, Expression of the {gamma}{delta} TCR and the V{gamma}1 chain in different organs of V{gamma}1Tg mice and non-Tg littermates. Cells isolated from the indicated organs were stained with FITC-labeled anti-CD3 and biotin-labeled anti-{delta} mAb (left panels) or with FITC-labeled anti-{delta} and biotin-labeled anti-V{gamma}1 Ab (right panels) followed by streptavidin-PE. Dot plots show the log10 of fluorescence intensity and were produced with the CellQuest program. Numbers indicate the percentages of CD3+{gamma}{delta}+ and CD3+{gamma}{delta}- (left panels) and of {gamma}{delta}+V{gamma}1+ and {gamma}{delta}+V{gamma}1- among total cells present in the lymphocyte gate. Some 20,000 to 100,000 cells were analyzed in each panel.

 
Before performing phenotypic, functional, and TCR repertoire analysis in the periphery of the Tg mice, we first established that the introduction of the transgene did not modify the representation of the Thy-1dull {gamma}{delta} thymocytes. As shown in Fig. 2Go, around 50 and 8% of the {gamma}{delta} thymocytes expressed low levels of Thy-1 in B6D2F1 and B6 Tg animals, respectively. These numbers correlate well with those previously found in normal B6D2F1 and B6 mice (8). The somewhat higher percentages of Thy-1dull {gamma}{delta} thymocytes found in Tg mice are probably due to the fact that virtually all {gamma}{delta} T cells in these mice express the V{gamma}1 gene product. Furthermore, most of the Thy-1dull {gamma}{delta} thymocytes isolated from B6D2F1 Tg mice express a HSA- CD62L- CD44+ phenotype (Fig. 2GoB), characteristic of the Thy-1dull {gamma}{delta} thymocytes in normal animals (8).



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2. V{gamma}1Tg mice of D2B6F1 genetic background contain a major population of Thy-1dull thymocytes. DN thymocytes from the indicated V{gamma}1Tg mice were stained with PE-labeled anti-Thy-1, biotin-labeled anti-{delta}, and FITC-labeled anti-HSA, anti-CD62L, or anti CD44 mAb, followed by streptavidin-Tricolor and analyzed in a FACScan. A, Dot plots of {gamma}{delta} vs Thy-1 staining in B6 and D2B6F1 V{gamma}1Tg mice. Numbers indicate the percentage of Thy-1dull {gamma}{delta} thymocytes among total {gamma}{delta}+ cells (mean ± 1 SD of 10 animals analyzed individually). B, Profiles of expression of the indicated marker on {gamma}{delta}+Thy-1bright (upper panels) and {gamma}{delta}+Thy-1dull (lower panels) thymocytes from D2B6F1 V{gamma}1Tg mice.

 
When we analyzed the periphery of B6D2F1 Tg mice for the presence of Thy-1dull {gamma}{delta} T cells, we found that only around 10% of the {gamma}{delta} T cells present in the spleen, lymph nodes, liver, and bone marrow expressed low levels of Thy-1 (not shown). These data could imply that cells expressing similar phenotypic and functional properties as the Thy-1dull {gamma}{delta} thymocytes rarely seed the periphery. Alternatively, this could also indicate that Thy-1dull {gamma}{delta} thymocytes modulate their levels of Thy-1 in the periphery. To distinguish between these two possibilities we sought an independent marker that could specifically identify the Thy-1dull {gamma}{delta} thymocyte population and putative peripheral descendents. Because the most characteristic feature of this population is the expression of a very restricted TCR repertoire, with almost exclusive utilization of the V{gamma}1 chain together with certain members of the V{delta}6 subfamily (8), we decided to produce an Ab able to recognize these V{delta}6 subfamily members.

The 9D3 mAb recognizes V{delta}6.3 and V{delta}6.4 chains

To produce such an mAb we immunized {gamma}{delta}-deficient mice with a Thy-1dull {gamma}{delta} T cell hybridoma of DBA/2 origin. Spleen cells from immunized mice were fused with SP2/0 cells, and the resulting hybridomas were tested for their ability to bind to the immunizing cells but not to a TCR-negative variant of the same hybridoma. The fine specificities of the selected mAbs were analyzed by staining a large panel of T cell hybridomas of B6 and DBA/2 origin previously characterized for their V{gamma} and V{delta} usage (P. Pereira, unpublished observations). One hybridoma, termed 9D3, specifically stained some {gamma}{delta} T cell hybridomas expressing a V{delta}6 chain but did not stain {gamma}{delta} T cell hybridomas expressing other V{delta} chains, including V{delta}2, V{delta}4, V{delta}5, and V{delta}7 (not shown). Further analyses with {gamma}{delta} T cell hybridomas expressing different members of the V{delta}6 subfamily showed that 9D3 stained all {gamma}{delta} T cell hybridomas of B6 origin expressing the V{delta}6.3 chain (36) and all {gamma}{delta} T cell hybridomas of DBA/2 origin expressing the V{delta}6.4 (8) chain but not hybridomas expressing any other member of the V{delta}6 subfamily, including the related B6 V{delta}6.1 (37) chain and the DBA/2 V{delta}6.5 and V{delta}6.6 chains (8) (Table IGo). Furthermore, 9D3 stained a sizable proportion of {gamma}{delta} thymocytes, splenocytes, and intestinal intraepithelial lymphocytes in DBA/2 and B6 strains as well as in B10 and B10.D2 mice that share the same TCR{alpha}/{delta} haplotype as B6 mice (39, 40, 41), but did not stain any {gamma}{delta} T cells in BALB/c, C3H, CBA, or 129/Sv strains of mice, which share a different TCR{alpha}/{delta} haplotype (39, 40, 41), suggesting that the 9D3 mAb does not recognize the V{delta}6.2 chain (37) (not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Specificity of the 9D3 mAb1

 
Three-color staining of DN thymocytes from D2B6F1 Tg mice with anti-{gamma}{delta}, anti-Thy-1, and 9D3 mAb showed that 80–90% of Thy-1dull {gamma}{delta} thymocytes were 9D3+, consistent with the predicted specificity of the 9D3 mAb. Conversely, around 90% of the {gamma}{delta}+9D3+ thymocytes expressed low levels of Thy-1 (Fig. 3Go). These data indicated that it would be possible to enrich for Thy-1dull {gamma}{delta} T cells by separating the cells on the basis of 9D3 expression.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 3. Correlation between 9D3 expression and low levels of Thy-1. DN thymocytes from D2B6F1 V{gamma}1Tg mice were stained with FITC-labeled anti-{delta}, PE-labeled anti-Thy-1, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor and analyzed in a FACScan. A dot plot of {gamma}{delta} vs 9D3 staining in total DN cells (left) and Thy-1 expression by {gamma}{delta}+9D3+ (R2) and {gamma}{delta}+9D3- (R3) populations is shown. R2 and R3 denote the electronic gates used for the analysis.

 
Frequency of {gamma}{delta}+9D3+ cells in different organs

We next analyzed the frequency of 9D3+ cells among {gamma}{delta} lymphocytes in different organs in D2B6F1 Tg mice. As shown in Table IIGo, 9D3+ cells represent roughly 50, 30, and 20% of the {gamma}{delta} T cells in liver, spleen, and peripheral lymph nodes, respectively. In other sites, such as bone marrow and peritoneal cavity, the frequency of {gamma}{delta} T cells was too low to allow accurate quantification even in Tg mice, although {gamma}{delta}+9D3+ cells were present at those sites.


View this table:
[in this window]
[in a new window]
 
Table II. Representation of {gamma}{delta}+9D3+ T cells in different organs from D2B6F1 V{gamma}1Tg mice

 
{gamma}{delta}+9D3+ cells in different organs express a restricted TCR{delta} repertoire

One of the characteristics of the Thy-1dull {gamma}{delta} thymocytes is their very restricted TCR repertoire. Besides their almost exclusive use of the V{gamma}1 chain and one or two members of the V{delta}6 chain subfamily, their V{delta}D{delta}J{delta} junctional sequences show limited diversity, and the great majority of them show identical length (8, 20). To investigate the putative relationship between the Thy-1dull {gamma}{delta} thymocytes and the {gamma}{delta}+9D3+ cells in the periphery we examined the junctional length of the V{delta}6 transcripts present in sorted {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- cells isolated from thymus, spleen, liver, and peripheral lymph nodes as well as from a Thy-1dull {gamma}{delta} hybridoma (DTN40). RT-PCR reactions with V{delta}6- and C{delta}-specific primers on cDNA isolated from all sorted populations were performed. An aliquot of each amplification product was submitted to a run-off reaction in the presence of a 6-carboxy-fluorescein (FAM)-labeled J{delta}1 primer, and the fluorescent products were resolved on a denaturing acrylamide gel cast on an automated sequencer.

Typical of polyclonal V{delta}D{delta}J{delta} junctions, the profiles obtained from sorted {gamma}{delta}+9D3- populations isolated from different organs showed 11–15 defined peaks that form a Gaussian-type curve (Fig. 4Go). All adjacent peaks differ in size by three nucleotides, and thus, the profiles show mainly in-frame junctions. In contrast, the profiles obtained for the sorted {gamma}{delta}+9D3+ populations showed a prominent peak at a CDR3 length identical with that displayed by the DTN40 hybridoma cell line, although the relative representation of this peak varied depending on the organ from which the cells were isolated. Calculation of the area of this peak relative to the area of all peaks in each organ indicated that 70, 35, 50, and 25% of the V{delta}6(D)J{delta}1 rearrangements present in {gamma}{delta}+9D3+ populations isolated from thymus, spleen, liver, and lymph nodes, respectively, showed this particular CDR3 size.



View larger version (34K):
[in this window]
[in a new window]
 
FIGURE 4. Population analysis of V{delta}6(D)J{delta}1 rearrangements expressed by {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations isolated from different anatomical sites. Total RNA samples isolated from sorted {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations isolated from the indicated anatomical sites and from the DTN40 hybridoma cells were converted to cDNA and amplified with V{delta}6- and C{delta}-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled J{delta}1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells

 
{gamma}{delta}+9D3+ cells in the periphery produce IL-4 and IFN-{gamma} upon activation with anti-{gamma}{delta} mAbs and IL-2

We have previously shown that Thy-1dull {gamma}{delta} thymocytes secrete high levels of IL-4 and IFN-{gamma} upon activation in vitro with coated anti-{gamma}{delta} mAbs and IL-2 (8). To investigate whether {gamma}{delta}+9D3+ cells in the periphery have the same functional abilities as the Thy-1dull {gamma}{delta} thymocyte population, sorted {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- cells from thymus, spleen, lymph nodes, and liver of D2B6F1 Tg mice were cultured in anti-{gamma}{delta} mAb-coated plates in the presence of IL-2, and the levels of IL-4 and IFN-{gamma} present in the culture supernatants were quantitated (Table IIIGo). Regardless of the organ from which they were isolated, {gamma}{delta} T cells secreted substantial amounts of IFN-{gamma}, although 2- to 4-fold higher levels were detected in {gamma}{delta}+9D3- cells than in {gamma}{delta}+9D3+ cells. In contrast, larger differences were observed in the levels of IL-4 produced by these two {gamma}{delta} T cell subsets in the different organs. Thus, in thymus, spleen, and lymph nodes, {gamma}{delta}+9D3+ cells secreted 10- to 20-fold higher levels of IL-4 than {gamma}{delta}+9D3- cells, while the difference was only 2-fold in the liver. It is likely that in the thymus, the low levels of IL-4 detected in the {gamma}{delta}+9D3- cultures arise from the roughly 10% of Thy-1dull {gamma}{delta} thymocytes in D2B6F1 animals, which express the V{delta}6.6 gene product and are not recognized by the 9D3 mAb. Similarly, the low levels of IL-4 detected in the {gamma}{delta}+9D3- cultures from spleen and lymph nodes could arise from V{delta}6.6-bearing cells, although we do not have direct evidence for this interpretation. Taken together, these experiments suggest that the production of IL-4 by peripheral {gamma}{delta} T cells is primarily accomplished by cells expressing the V{delta}6 chain and a restricted TCR repertoire.


View this table:
[in this window]
[in a new window]
 
Table III. Cytokine production by sorted {gamma}{delta}+9D3+ (+) and {gamma}{delta}+9D3- (-) cells in D2B6F1 V{gamma}1Tg mice

 
Phenotypic analysis of {gamma}{delta}+9D3+ cells at different anatomical sites.

We then investigated the surface phenotype of the {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- cells present at different anatomical sites, and their FACS profiles in thymus, spleen, and liver are illustrated in Fig. 5Go. Invariably, most {gamma}{delta}+9D3+ cells showed an HSAlow CD44bright CD62Llow CD45RBint CD69+ phenotype, similar to that of NK T cells and activated T cells. However, none of these markers could unambiguously define the {gamma}{delta}+9D3+ population. In fact, the same activated phenotype is expressed by the vast majority of {gamma}{delta} T cells in the liver, and CD44bright cells represent an important fraction of the {gamma}{delta}+9D3- cells in thymus and spleen.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 5. Phenotypic analysis of {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations. Cells were prepared as described in Materials and Methods and three color stained as described in Fig. 2Go. Shown are the profiles of the indicated Ab in {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations isolated from the indicated organs. Staining results of lymph node cells were similar to those presented for spleen cells.

 
{gamma}{delta}+9D3+ cells are heterogeneous with regard to the expression of other cell surface markers (Fig. 6Go). Thus, approximately half these cells express the NK1.1 marker in every organ tested. However, a similar proportion of the {gamma}{delta}+9D3- cells present in the liver are also NK1.1+. We have previously shown that, unlike other {gamma}{delta} thymocytes, around half the Thy-1dull {gamma}{delta} thymocytes express the CD4 coreceptor (8). Similarly, a fraction of the {gamma}{delta}+9D3+ cells present in the spleen and liver expresses the CD4 molecule, although the fraction of CD4+{gamma}{delta}+ cells appears to be lower in the liver than in the spleen. Finally, most {gamma}{delta}+9D3+ cells are negative for the expression of CD8, even though CD8+{gamma}{delta}+ cells can be readily detected among the {gamma}{delta}+9D3- cells in liver and spleen, confirming previous results (42).



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 6. CD4, CD8, and NK1.1 expression by {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations. A, D2B6F1 Tg thymocytes treated with anti-HSA and anti-CD8 mAbs and complement were stained with FITC-labeled anti-CD4, PE-labeled anti-{delta}, and biotin-labeled 9D3 followed by streptavidin-Tricolor. The histogram shows CD4 expression in {gamma}{delta}+9D3+ cells. B, DN thymocytes from D2B6F1 Tg mice were stained with FITC-labeled anti-NK1.1, PE-labeled anti-{delta}, and biotin-labeled 9D3 mAb followed by streptavidin-Tricolor. Histograms show NK1.1 expression in {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations. C, Cells were prepared as described in Materials and Methods and three color stained as described above. Shown are the profiles of the indicated Ab in {gamma}{delta}+9D3+ and {gamma}{delta}+9D3- populations isolated from the indicated organs. All cells were analyzed with a FACScan. Staining results of lymph node cells were similar to those shown for spleen cells.

 
{gamma}{delta}+9D3+ cells expressing a restricted TCR{delta} repertoire exist in the periphery of normal mice

Two types of experiments were performed to investigate the presence of this type of {gamma}{delta} T cells in the periphery of normal mice and to estimate their numbers. First we performed RT-PCR reactions on total RNA isolated from different organs of DBA/2 mice with primers specific for the V{delta}6.4 and C{delta} gene segments. Because most {alpha}ß T cells have deleted the TCR{delta} locus in both chromosomes, this PCR is expected to mainly, if not exclusively, amplify transcripts expressed by {gamma}{delta} T cells. The PCR amplifications were submitted to run-off reactions with a FAM-conjugated J{delta}1 primer, and the labeled fragments were separated on a sequencing gel. The profiles obtained from one such experiment are shown in Fig. 7Go. As can be seen, a major peak protruding from the Gaussian-type curve and corresponding to a CDR3 length identical with that of the DTN40 hybridoma cell line is evident in thymus, spleen, and liver. The same peak is also evident, although to a lesser extent, in the lymph nodes and in the peritoneal cavity. These experiments suggested that cells expressing a restricted TCR{delta} repertoire are present in these organs in normal mice.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 7. Cells with a restricted TCR{delta} repertoire exist in the periphery of normal mice. RNA isolated from the indicated organs of DBA/2 mice was amplified by RT-PCR with V{delta}6.4- and C{delta}-specific primers. An aliquot of the amplified products was submitted to a run-off reaction with a FAM-labeled J{delta}1 primer, and the final products were resolved with an automated sequencer. Plots show the profile of fluorescence intensity vs the length of the fragments. LN, lymph node cells; PC, peritoneal cavity cells.

 
The second set of experiments concerned the quantification of {gamma}{delta}+9D3+ cells by FACS analysis in different anatomical sites, and the results are presented in Table IVGo. The proportion of 9D3+ cells among {gamma}{delta} T cells in different organs in normal mice compared well with those found in Tg mice, keeping in mind that all {gamma}{delta} T cells in the Tg mice express the V{gamma}1 gene product. From this and the previous set of experiments we estimate that in normal DBA2 mice, roughly 2–4 x 105 thymocytes, and between 0.5 and 2 x 105 cells in the spleen and liver share the characteristics previously described for the Thy-1dull {gamma}{delta} thymocytes.


View this table:
[in this window]
[in a new window]
 
Table IV. Representation of {gamma}{delta}+9D3+ and {gamma}{delta}+V{gamma}1+ T cells in different organs from normal DBA/2 mice

 
In conclusion, our studies have shown that {gamma}{delta} T cells able to simultaneously produce IL-4 and IFN-{gamma} upon activation in vitro exist in the periphery of mice Tg for a rearranged V{gamma}1 chain. These cells, which are found predominantly in spleen and liver, express a restricted repertoire of TCR composed of the V{gamma}1 gene product mainly associated with the V{delta}6.4 chain and exhibit limited junctional sequence diversity. {gamma}{delta} T cells with a similarly restricted TCR repertoire are present in the same organs in normal DBA/2 mice. These cells probably represent the descendants of the previously described Thy-1dull {gamma}{delta} thymocytes (8), although they seem to up-regulate Thy-1 expression upon seeding the periphery. Our experiments, however, did not directly address this issue, and such a relation between Thy-1dull {gamma}{delta} thymocytes and the cells studied here is, therefore, not formally established. Although this {gamma}{delta} T cell subset expresses an activated/memory phenotype, none of a variety of markers tested could unambiguously define this T cell population.

The phenotype, TCR diversity level, and functional properties found in this {gamma}{delta} T cell subset are also characteristic of the T NK population, and both T cell populations seem to home preferentially to liver and spleen. These common properties may reflect a similar differentiation program and/or a related function. However, the likely difference in their specificities implies separate aspects of function. Additional experiments will aim at characterizing the specific ligands recognized by this {gamma}{delta} T cell population.


    Acknowledgments
 
We thank P. Minoprio for providing the anti-cytokine mAb. The Tg mice used here were produced in the laboratory of Prof. S. Tonegawa.


    Footnotes
 
1 This work was supported by institutional grants and grants from the Association pour la Recherche sur le Cancer, Fondation pour la Recherche Medicale, and Association Nationale pour la Recherche contre le Sida. Back

2 Address correspondence and reprint requests to Dr. Pablo Pereira, Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique, URA 1961, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: Back

3 Abbreviations used in this paper: Tg, transgenic; CD62L, CD62 ligand; DN, double negative; FAM, 6-carboxy-fluorescein; HSA, heat-stable Ag. Back

Received for publication May 4, 1999. Accepted for publication June 30, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Haas, W., P. Pereira, S. Tonegawa. 1993. {gamma}/{delta} cells. Annu. Rev. Immunol. 11:637.[Medline]
  2. Bendelac, A., M. N. Rivera, S.-H. Park, J. H. Roark. 1997. Mouse CD1-specific NK1 T cells: development, specificity, and function. Annu. Rev. Immunol. 15:535.[Medline]
  3. MacDonald, H. R.. 1995. NK1.1+ T cell receptor-{alpha}ß+ cells: new clues to their origin, specificity, and function. J. Exp. Med. 182:633.[Free Full Text]
  4. Vicari, A. P., A. Zlotnik. 1996. Mouse NK1.1+ cells: a new family of T cells. Immunol. Today 17:71.[Medline]
  5. Ohteki, T., H. R. MacDonald. 1994. Major histocompatibility complex class I related molecules control the development of CD4+8+ and CD4-8- subsets of natural killer 1.1+ T cell receptor-{alpha}+ cells in the liver of mice. J. Exp. Med. 180:699.[Abstract/Free Full Text]
  6. Sykes, M.. 1990. Unusual T cell populations in adult murine bone marrow: prevalence of CD3+CD4+CD8+ and {alpha}ß TCR+NK1.1+ cells. J. Immunol. 145:3209.[Abstract]
  7. Yankelevich, B., C. Knobloch, M. Nowicki, G. Dennert. 1989. A novel cell type responsible for marrow graft rejection in mice: cells with NK phenotype cause acute rejection of marrow grafts. J. Immunol. 142:3423.[Abstract]
  8. Azuara, V., J. P. Levraud, M. P. Lembezat, P. Pereira. 1997. A novel subset of adult {gamma}{delta} thymocytes that secretes a distinct pattern of cytokines and expresses a very restricted T cell receptor repertoire. Eur. J. Immunol. 27:544.[Medline]
  9. Zlotnik, A., D. I. Godfrey, M. Fischer, T. Suda. 1992. Cytokine production by mature and immature CD4-CD8- T cells: {alpha}ß-T cell receptor+ CD4-CD8- T cells produce IL-4. J. Immunol. 149:1211.[Abstract]
  10. Hayakawa, K., B. T. Lin, R. R. Hardy. 1992. Murine thymic CD4+ T cell subsets: a subset (Thy0) that secretes diverse cytokines and overexpresses the Vß8 T cell receptor gene family. J. Exp. Med. 176:269.[Abstract/Free Full Text]
  11. Vicari, A. P., S. Mocci, P. Openshaw, A. O’Garra, A. Zlotnik. 1996. Mouse {gamma}{delta} TCR+NK1.1+ thymocytes specifically produce interleukin-4, are major histocompatibility complex class I independent, and are developmentally related to {alpha}ß TCR+NK1.1+ thymocytes. Eur. J. Immunol. 26:1424.[Medline]
  12. Arase, H., N. Arase, K. Nakagawa, R. A. Good, K. Onoe. 1993. NK1.1+ CD4+CD8- thymocytes with specific lymphokine secretion. Eur. J. Immunol. 23:307.[Medline]
  13. Arase, H., N. Arase, K. Ogasawara, R. A. Good, K. Onoe. 1992. An NK1.1+ CD4+CD8- single-positive thymocyte subpopulation that expresses a highly skewed T-cell antigen receptor Vß family. Proc. Natl. Acad. Sci. USA 89:6506.[Abstract/Free Full Text]
  14. Lantz, O., A. Bendelac. 1994. An invariant T cell receptor {alpha} chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.[Abstract/Free Full Text]
  15. Ohteki, T., H. R. MacDonald. 1996. Stringent Vß requirement for the development of NK1.1+ T cell receptor-{alpha}+ cells in mouse liver. J. Exp. Med. 183:1277.[Abstract/Free Full Text]
  16. Bendelac, A.. 1995. Positive selection of mouse NK1+ T cells by CD1-expressing cortical thymocytes. J. Exp. Med. 182:2091.[Abstract/Free Full Text]
  17. Chen, Y.-H., N. M. Chiu, M. Mandal, N. Wang, C.-R. Wang. 1997. Impaired NK1+ T cell development and early IL-4 production in CD1-deficient mice. Immunity 6:459.[Medline]
  18. Mendiratta, S. K., W. D. Martin, S. Hong, A. Boesteanu, S. Joyce, L. V. Kaer. 1997. CD1d1 mutant mice are deficient in natural T cells that promptly produce IL-4. Immunity 6:469.[Medline]
  19. Smiley, S. T., M. H. Kaplan, M. J. Grusby. 1997. Immunoglobulin E production in the absence of interleukin-4-secreting CD1-dependent cells. Science 275:977.[Abstract/Free Full Text]
  20. Azuara, V., M. P. Lembezat, P. Pereira. 1998. The homogeneity of the TCR{delta} repertoire expressed by the Thy-1dull {gamma}{delta} T cell population is due to cellular selection. Eur. J. Immunol. 28:3456.[Medline]
  21. Hashimoto, W., K. Takeda, R. Anzai, K. Ogasawara, H. Sakihara, K. Sugiura, S. Seki, K. Kumagai. 1995. Cytotoxic NK1.1 Ag+ {alpha}ß T cells with intermediate TCR induced in the liver of mice by IL-12. J. Immunol. 154:4333.[Abstract]
  22. Takeda, K., S. Seki, K. Ogasawara, R. Anzai, W. Hashimoto, K. Sugiura, M. Takahashi, M. Satoh, K. Kumagai. 1996. Liver NK1.1+ CD4+ {alpha}ß T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J. Immunol. 156:3366.[Abstract]
  23. Cui, J., T. Shin, T. Kawano, H. Sato, E. Kondo, I. Toura, Y. Kaneko, H. Koseki, M. Kanno, M. Taniguchi. 1997. Requirement for V{alpha}14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.[Abstract/Free Full Text]
  24. Mieza, M. A., T. Itoh, J. Q. Cui, Y. Makino, T. Kawano, K. Tsuchida, T. Koike, T. Shirai, H. Yagita, A. Matsuzawa, et al 1996. Selective reduction of V{alpha}14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
  25. Sumida, T., A. Sakamoto, H. Murata, Y. Makino, H. Takahashi, S. Yoshida, K. Nishioka, I. Iwamoto, M. Taniguchi. 1995. Selective reduction of T cells bearing invariant V{alpha}24J{alpha}Q antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.[Abstract/Free Full Text]
  26. Hammond, K. J. L., L. D. Poulton, L. J. Palmisano, P. A. Silveira, D. I. Godfrey, A. G. Baxter. 1998. {alpha}/ß-T cell receptor (TCR)+ CD4-CD8- (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047.[Abstract/Free Full Text]
  27. Wilson, S. B., S. C. Kent, K. T. Patton, T. Orban, R. A. Jackson, M. Exley, S. Porcelli, D. A. Schatz, M. A. Atkinson, S. P. Balk, et al 1998. Extreme Th1 bias of invariant V{alpha}24J{alpha}Q T cells in type 1 diabetes. Nature 391:177.[Medline]
  28. Yoshimoto, T., W. E. Paul. 1994. CD4pos, NK1.1pos T cells promptly produce interleukin 4 in response to in vivo challenge with anti-CD3. J. Exp. Med. 179:1285.[Abstract/Free Full Text]
  29. Launois, P., I. Maillard, S. Pingel, K. G. Swihart, I. Xenarios, H. Acha-Orbea, H. Diggelmann, R. M. Locksley, H. R. MacDonald, J. A. Louis. 1997. IL-4 rapidly produced by Vß4 V{alpha}8 CD4+ T cells instructs Th2 development and susceptibility to Leishmania major in BALB/c mice. Immunity 6:541.[Medline]
  30. Brown, D. R., D. J. Fowell, D. B. Corry, T. A. Wynn, N. H. Moskowitz, A. W. Cheever, R. M. Locksley, S. L. Reiner. 1996. ß2-microglobulin-dependent NK1.1+ T cells are not essential for T helper cell 2 immune responses. J. Exp. Med. 184:1295.[Abstract/Free Full Text]
  31. Zhang, Y., K. H. Rogers, D. B. Lewis. 1996. ß2-microglobulin-dependent T cells are dispensable for allergen-induced T helper 2 responses. J. Exp. Med. 7184:1507.
  32. Zuany-Amorim, C., C. Ruffie, S. Haile, B. B. Vargaftig, P. Pereira, M. Pretolani. 1998. Requirement for {gamma}{delta} T cells in allergic airway inflammation. Science 280:1265.[Abstract/Free Full Text]
  33. Pereira, P., D. Gerber, S. Y. Huang, S. Tonegawa. 1995. Ontogenic development and tissue distribution of V{gamma}1 expressing {gamma}/{delta} T lymphocytes in normal mice. J. Exp. Med. 182:1921.[Abstract/Free Full Text]
  34. Gueirard, P., P. Minoprio, N. Guiso. 1996. Intranasal inoculation of Bordetella bronchiseptica in mice induces long lasting antibody and T-cell mediated immune responses. Scand. J. Immunol. 43:181.[Medline]
  35. Malissen, M., P. Pereira, D. J. Gerber, B. Malissen, J. P. DiSanto. 1997. The common cytokine receptor {gamma} chain controls survival of {gamma}/{delta} T cells. J. Exp. Med. 186:1277.[Abstract/Free Full Text]
  36. Happ, M. P., R. T. Kubo, E. Palmer, W. K. Born, R. L. O’Brien. 1989. Limited receptor repertoire in a mycobacteria-reactive subset of {gamma}{delta} T cells. Nature 342:696.[Medline]
  37. McConnell, T. J., W. M. Yokoyama, G. E. Kikuchi, G. P. Einhorn, G. Stingl, E. M. Shevach, J. E. Coligan. 1989. {delta}-Chain of dendritic epidermal T cell receptors are diverse but pair with {gamma}-chains in a restricted manner. J. Immunol. 142:2924.[Abstract]
  38. Chien, Y. H., M. Iwashima, K. B. Kaplan, J. F. Elliott, M. M. David. 1987. A new T-cell receptor gene located within the {alpha} locus and expressed early in T-cell differentiation. Nature 327:677.[Medline]
  39. Singer, P. A., R. J. McEvilly, R. S. Balderas, F. J. Dixon, A. N. Theofilopoulos. 1988. T-cell receptor {alpha}-chain variable region haplotypes of normal and autoimmune laboratory mouse strains. Proc. Natl. Acad. Sci. USA 85:7729.[Abstract/Free Full Text]
  40. Klotz, J. L., R. K. Barth, G. L. Kiser, L. E. Hood, M. Kronenberg. 1989. Restriction fragment length polymorphisms of the mouse T-cell receptor gene families. Immunogenetics 29:191.[Medline]
  41. Jouvin-Marche, E., M. G. Morgado, N. Trede, P. N. Marche, D. Couez, I. Hue, C. Gris, M. Malissen, P. A. Cazenave. 1989. Complexity, polymorphism and recombination of mouse T-cell receptor {alpha} gene families. Immunogenetics 30:99.[Medline]
  42. Ohteki, T., T. Abo, S. Seki, T. Kobata, H. Yagita, K. Okumura, K. Kumagai. 1991. Predominant appearance of {gamma}{delta} T lymphocytes in the liver of mice after birth. Eur. J. Immunol. 21:1733.[Medline]



This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Kreslavsky, A. K. Savage, R. Hobbs, F. Gounari, R. Bronson, P. Pereira, P. P. Pandolfi, A. Bendelac, and H. von Boehmer
TCR-inducible PLZF transcription factor required for innate phenotype of a subset of {gamma}{delta} T cells with restricted TCR diversity
PNAS, July 28, 2009; 106(30): 12453 - 12458.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Jin, C. L. Roark, N. Miyahara, C. Taube, M. K. Aydintug, J. M. Wands, Y. Huang, Y.-S. Hahn, E. W. Gelfand, R. L. O'Brien, et al.
Allergic Airway Hyperresponsiveness-Enhancing {gamma}{delta} T Cells Develop in Normal Untreated Mice and Fail to Produce IL-4/13, Unlike Th2 and NKT Cells
J. Immunol., February 15, 2009; 182(4): 2002 - 2010.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Boucontet, N. Sepulveda, J. Carneiro, and P. Pereira
Mechanisms Controlling Termination of V-J Recombination at the TCR{gamma} Locus: Implications for Allelic and Isotypic Exclusion of TCR{gamma} Chains
J. Immunol., April 1, 2005; 174(7): 3912 - 3919.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y.-S. Hahn, C. Taube, N. Jin, L. Sharp, J. M. Wands, M. K. Aydintug, M. Lahn, S. A. Huber, R. L. O'Brien, E. W. Gelfand, et al.
Different Potentials of {gamma}{delta} T Cell Subsets in Regulating Airway Responsiveness: V{gamma}1+ Cells, but Not V{gamma}4+ Cells, Promote Airway Hyperreactivity, Th2 Cytokines, and Airway Inflammation
J. Immunol., March 1, 2004; 172(5): 2894 - 2902.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
C. L. Roark, M. K. Aydintug, J. Lewis, X. Yin, M. Lahn, Y.-S. Hahn, W. K. Born, R. E. Tigelaar, and R. L. O'Brien
Subset-specific, uniform activation among V{gamma}6/V{delta}1+ {gamma}{delta} T cells elicited by inflammation
J. Leukoc. Biol., January 1, 2004; 75(1): 68 - 75.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. F. Hedges, J. C. Graff, and M. A. Jutila
Transcriptional Profiling of {gamma}{delta} T Cells
J. Immunol., November 15, 2003; 171(10): 4959 - 4964.
[Full Text] [PDF]


Home page
J. Immunol.Home page
K. Grigoriadou, L. Boucontet, and P. Pereira
Most IL-4-Producing {gamma}{delta} Thymocytes of Adult Mice Originate from Fetal Precursors
J. Immunol., September 1, 2003; 171(5): 2413 - 2420.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Grigoriadou, L. Boucontet, and P. Pereira
T Cell Receptor-{gamma} Allele-Specific Selection of V{gamma}1/V{delta}4 Cells in the Intestinal Epithelium
J. Immunol., October 1, 2002; 169(7): 3736 - 3743.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. A. Huber, D. Graveline, W. K. Born, and R. L. O'Brien
Cytokine Production by V{gamma}+-T-Cell Subsets Is an Important Factor Determining CD4+-Th-Cell Phenotype and Susceptibility of BALB/c Mice to Coxsackievirus B3-Induced Myocarditis
J. Virol., July 1, 2001; 75(13): 5860 - 5869.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S.-H. Park, A. Weiss, K. Benlagha, T. Kyin, L. Teyton, and A. Bendelac
The Mouse Cd1d-Restricted Repertoire Is Dominated by a Few Autoreactive T Cell Receptor Families
J. Exp. Med., April 16, 2001; 193(8): 893 - 904.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
S. Elahi, G. Pang, R. Clancy, and R. B. Ashman
Cellular and Cytokine Correlates of Mucosal Protection in Murine Model of Oral Candidiasis
Infect. Immun., October 1, 2000; 68(10): 5771 - 5777.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
J. D. Rempel, M. Wang, and K. T. HayGlass
Failure of rIL-12 administration to inhibit established IgE responses in vivo is associated with enhanced IL-4 synthesis by non-B/non-T cells
Int. Immunol., July 1, 2000; 12(7): 1025 - 1034.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Azuara and P. Pereira
Genetic Mapping of Two Murine Loci that Influence the Development of IL-4-Producing Thy-1dull {gamma}{delta} Thymocytes
J. Immunol., July 1, 2000; 165(1): 42 - 48.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gerber, D. J.
Right arrow Articles by Pereira, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gerber, D. J.
Right arrow Articles by Pereira, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS