|
|
||||||||

T Cells That Express a Very Restricted TCR Repertoire Are Preferentially Localized in Liver and Spleen1




*
Howard Hughes Medical Institute, Center for Cancer Research, and Department of Biology, Massachusetts Institute of Technology, Cambridge, MA 02139; and
Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique, URA 1961, and
Unité de Biologie Moléculaire du Gène, Institut National de la Santé et de la Recherche Medicale, Unité 277, Institut Pasteur, Paris, France
| Abstract |
|---|
|
|
|---|

thymocytes in normal mice belong to a
distinct subset of 
T cells characterized by low expression of
Thy-1. This 
thymocyte subset shares a number of phenotypic and
functional properties with the NK T cell population.
Thy-1dull 
thymocytes in DBA/2 mice express a
restricted repertoire of TCRs that are composed of the V
1 gene
product mainly associated with the V
6.4 chain and exhibit limited
junctional sequence diversity. Using mice transgenic for a rearranged
V
1J
4C
4 chain and a novel mAb (9D3) specific for the V
6.3
and V
6.4 murine TCR
chains, we have analyzed the peripheral
localization and functional properties of 
T cells displaying a
similarly restricted TCR repertoire. In transgenic mice, IL-4
production by peripheral 
T cells was confined to the

+9D3+ subset, which contains cells with a
TCR repertoire similar to that found in Thy-1dull 
thymocytes. In normal DBA/2 mice such cells represent close to half of
the 
T cells present in the liver and around 20% of the splenic

T cells. | Introduction |
|---|
|
|
|---|
- and ß-chains (
ß T cells) and either the CD4
or CD8 coreceptor. However, two distinct populations of T cells have
received increased attention during the last few years. One is composed
of cells that use
- and
-chains to form their TCR (
T
cells) (1). The other is composed of
ß T cells that
bear markers common to NK cells and are referred to as NK T cells
(2, 3, 4). Although they comprise a minor portion of T cells
in the thymus and peripheral lymphoid organs, these T cell populations
constitute an important fraction of T lymphocytes present in other
anatomical sites. Thus, 
T cells are the predominant T cell
population in most epithelial surfaces (1), whereas NK T
cells represent around half of the T lymphocytes found in liver and
bone marrow (2, 5, 6, 7).
We have recently characterized a population of 
thymocytes that
shares a number of phenotypic and functional characteristics with NK T
cells (8). In the thymus, this 
T cell population
differs from conventional 
T cells in its low expression of
Thy-1, and thus, we referred to it as the
Thy-1dull 
T cell population. Similar to NK
T cells, most Thy-1dull 
thymocytes express
a phenotype usually associated with activated or memory T cells, and
approximately half of them express the NK1.1 cell marker (a member of
the NKR-P1 gene family) and/or the CD4 coreceptor (8).
Upon activation in vitro, both NK T cells and
Thy-1dull 
T cells produce large amounts of
various cytokines, including IL-4, IFN-
, IL-3, IL-5, IL-10, and
GM-CSF (8, 9, 10, 11, 12). Finally, both cell populations have been
shown to express a highly restricted TCR repertoire (8, 13, 14, 15). The skewed TCR repertoire expressed by NK T cells is
selected by the MHC class-I like molecule CD1d (16, 17, 18, 19).
The identity of the putative endogenous molecule selecting the TCR
repertoire of the Thy-1dull 
T cell
population (20) is not known.
The physiological functions of NK T cells and
Thy-1dull 
T cells remain unknown. However,
recent experiments have shown that NK T cells mediate IL-12-induced
tumor cell killing in vivo (21, 22, 23), and several
independent lines of evidence suggest that NK T cells may be involved
in regulating autoimmunity (24, 25, 26, 27). Despite their ability
to promptly produce large amounts of IL-4 upon stimulation in vivo
(28), the role of NK T cells in the induction of Th2
responses has been questioned (29, 30, 31). In contrast, a
major role of 
T cells has been demonstrated in the early
production of IL-4, which is required for the development of specific
IgE responses in the periphery and for subsequent airway inflammation
upon intranasal Ag challenge (32). This led to the
suggestion that IL-4 production by 
T cells in the periphery
could be important for the development of certain Th2 responses to
protein Ags, and thus focused attention on the
Thy-1dull 
T cell population.
An important step in understanding the physiological function of the
Thy-1dull 
T cells is the characterization
of their peripheral localization. In this report we have used mice
transgenic (Tg)3 for a
rearranged V
1J
4C
4 chain and a novel mAb (9D3) specific for the
V
6.3 and V
6.4 murine TCR
chains to analyze this issue. Our
results show that 
T cells expressing functional abilities and
TCR repertoire similar to those described for the
Thy-1dull 
thymocytes are mainly present in
liver and spleen. In normal DBA/2 mice, these 
T cells are found
in the thymus, liver, and spleen at a level of 14 x
105 cells/organ.
| Materials and Methods |
|---|
|
|
|---|
C57BL/6 (B6) mice Tg for a rearranged V
1J
4C
4 chain
(V
1Tg) and TCR
knockout mice were maintained in our animal
facilities. DBA/2 and (B6 x DBA/2)F1
(B6D2F1) mice were obtained from Iffa Credo
(LAbresle, France). (DBA/2 x B6)F1
(D2B6F1) V
1Tg were produced by mating DBA/2
females with B6 V
1Tg males. F1 mice were typed
for the presence of the transgene by PCR analysis on tail DNA using
primers specific for the V
1 gene and for the V
1J
4 junction
(see below). Mice were used between 715 wk of age.
Antibodies
Anti-CD4 (RL.174), anti-CD8 (HO-2.2),
anti-heat-stable Ag (anti-HSA; J11d), anti-Cß (H57-597),
anti-C
(3A10), anti-V
1 (2.11), and
anti-V
6.4/V
6.3 (9D3) were prepared and used as previously
described (33). PE-labeled anti-C
(GL3), FITC- or
PE-labeled anti-HSA, anti-Thy-1, anti-CD62 ligand
(anti-CD62L), anti-CD44, anti-CD69, anti-CD3
,
anti-CD45RB, anti-NK1.1, anti-CD4, and anti-CD8 were
purchased from PharMingen (San Diego, CA). Goat anti-mouse
IgM was purchased from Sigma (St. Louis, MO). For the cytokine-specific
ELISA we used the following mAb: anti-IFN-
(clones R46A2, and
AN18) and anti-IL-4 (clones BVD4 and BVD6; a gift from Dr. P.
Minoprio, Unité dImmunoparasitologie, Institut Pasteur, Paris,
France).
Immunofluorescence staining and FACS
Cells (105-106) were incubated in staining buffer (PBS, 3% FCS, and 0.1%NaN3) with the indicated labeled mAbs for 30 min on ice and washed twice. When biotin-conjugated mAbs were used, the cells were further incubated with either PE-labeled streptavidin (Southern Biotechnology Associates, Birmingham, AL) or streptavidin Tricolor (Caltag, South San Francisco, CA) for 15 min on ice. After another wash, cells were resuspended in staining buffer containing 1 µg/ml propidium iodide and analyzed using a FACScan flow cytometer (Becton Dickinson, Mountain View, CA). Dead cells were gated out either by their staining with PI or by their forward and angle light scatter profile. Data were analyzed using the CellQuest program.
For FACS sorting, cell suspensions were prepared as indicated above and incubated with the appropriate mAb at a concentration of 30 x 106 cells/ml for 30 min on ice. After two washes, cells were resuspended in PBS-10% FCS and sorted in a FACStarPlus cell sorter (Becton Dickinson). The purity of the sorted populations was >95%.
Cell purification, cell culture, and cytokine-specific ELISA
Single-cell suspensions were prepared from the thymus, spleen, lymph nodes, and liver according to standard procedures. CD4-CD8- (DN) and CD8-HSA- thymocytes were prepared by complement-mediated killing as previously described (8). Liver mononuclear cells were isolated by centrifugation in a discontinuous gradient of Percoll (Pharmacia, Uppsala, Sweden). Briefly, total liver cells were resuspended in 100% isotonic Percoll solution and overlaid with 70 and 40% isotonic Percoll solutions. After centrifugation for 30 min at 500 x g, cells at the 4070% interface were collected, washed twice, and further purified from contaminating RBC by density gradient centrifugation using Lympholyte M (Cedarlane, Hornby, Canada). The cells were washed twice in medium containing 5% FCS. Splenic RBC were lysed by incubating spleen cells for 2 min in 5 ml of NH4Cl solution. Lymph node cells and RBC-depleted spleen cells were resuspended in medium containing 10% FCS at a concentration of 2.510 x 106 cells/ml and incubated for 90 min in petri dishes (Optilux, Falcon 1005, Oxnard, CA) previously coated with anti-Cß and anti-IgM Ab (each at 5 µg/ml in PBS), with sporadic agitation. Nonadherent cells were recovered and washed twice before use.
FACS-sorted cells (1.5 x 105 cells/ml) were
cultured in flat-bottom microtiter plates previously coated with 10
µg/ml anti-C
mAb (3A10) in complete medium, i.e., DMEM with
Glutamax-I medium (Life Technologies, Gaithersburg, MD) supplemented
with sodium pyruvate, 5 x 10-5 M 2-ME,
nonessential amino acids, and antibiotics (all from Life Technologies)
and 10% FCS (Boehringer Mannheim, Meylan, Germany). Mouse rIL-2 was
added at a final concentration of 100 U/ml. Supernatants from 3-day
cultures were tested for the presence of IL-4 and IFN-
by ELISA as
previously described (34).
Production of the 9D3 mAb
TCR
KO mice were immunized i.p. twice at 2-wk intervals with
5 x 106 DTN40 (V
1/V
6.4) hybridoma
cells and once i.v. with 106 DTN40 hybridoma
cells resuspended in PBS. The DTN40 hybridoma was obtained by fusing
Thy-1dull 
thymocytes of DBA/2 origin with
BW5147 thymoma cells (8). Three days after the last
injection, spleen cells were fused with SP2/0 cells as described
previously (33). The cells were then distributed in
96-well flat-bottom plates in complete medium supplemented with
hypoxanthine-aminopterin-thymidine. Culture supernatants from
growth-positive wells were tested for their ability to bind to the
immunizing hybridoma cell but not to a TCR-negative variant of the same
hybridoma. Binding of the Ab to the hybridoma cells was detected with
FITC-labeled goat anti-mouse Ig (Caltag) and analyzed with a
FACScan. The fine specificities of the selected Ab were determined by
their ability to stain 
T cell hybridomas that express different
TCR
and TCR
chains.
Oligonucleotide primers and PCR conditions
The following oligonucleotide primers were used:
V
6, TCTGTAGTCTTCCAGAAATCA; V
6.4, GTTTTCCTTATTCGACAAACA; C
,
CGAATTCCACAATCTTCTTG; JS1, GTTCCTTGTCCAAAGACGAG; V
1,
CCGGCAAAAAGCAAAAAAGTT; and V
1J
4Tg junction,
CCCATGATGTGCCTGACCAG. PCR was performed using a GeneAmp
PCR system 9600 (Perkin-Elmer/Cetus, Norwalk, CT). Each cycle consisted
of incubation at 92°C for 20 s, followed by 55°C for 30 s
and 72°C for 30 s. Before the first cycle, a 2-min 94°C
denaturation step was included, and after the 35th cycle the extension
at 72°C was prolonged for 4 min.
Nucleic acid preparation and population analysis of TCR
rearrangements
Total cellular RNA from sorted cells was extracted with RNA-B
(Bioprobe Systems, Montreuil, France). Before RNA extraction, sorted
cells were mixed with 106 SP2/0 cells as a
carrier. cDNA was synthesized with oligo(dT) (Pharmacia) using
superscript reverse transcriptase (Life Technologies) according to the
manufacturers instructions. The population analysis of TCR
rearrangements has been previously described in detail (8, 20).
| Results and Discussion |
|---|
|
|
|---|
1J
4C
4 Tg animals of appropriate genetic background
contain a population of Thy-1dull. 
thymocytes
Given the paucity of 
cells in the peripheral lymphoid
organs in the mouse, it was difficult to study the peripheral
representation of the Thy-1dull 
population
in normal mice. To overcome this problem we took advantage of the
availability of a mouse Tg for a rearranged V
1J
4C
4 chain that
we produced previously (35). The DNA inserted to produce
this Tg line consisted of a 45-kb cosmid containing the rearranged
V
1J
4C
4 gene flanked by 10 kb of sequence upstream of the V
1
segment and 26 kb of sequence downstream of the last C
4 exon (Fig. 1
A). Thus, this construct
should contain all the regulatory elements required to ensure normal
expression of the transgene. The cosmid clone was isolated from a T
cell hybridoma of B6 origin (T3.13.1) (33), and the
V
1J
4 junctional sequence is identical with one of the two more
common V
1J
4 junctional sequences found among the
Thy-1dull 
thymocytes in DBA/2 mice
(8).
ß T cell development in these mice appears quite
normal, as indicated by the similar number of total thymocytes (not
shown) and of the major thymocyte populations defined by double
staining with CD4 and CD8 mAbs in Tg animals and littermate controls
(Fig. 1
B). In contrast, a 3- to 10-fold increase in the
number of 
thymocytes is present in Tg mice compared with
littermates, and most of these cells express the transgenic chain (Fig. 1
C). This increase in the absolute numbers of 
T cells
in the Tg mice is also evident in the periphery, where Tg animals
contain 3- to 10-fold more 
T cells than control littermates;
here again, most of the 
T cells in Tg mice express the V
1
chain (Fig. 1
C).
|

thymocytes. As shown in Fig. 2
thymocytes expressed low levels of Thy-1 in
B6D2F1 and B6 Tg animals, respectively. These
numbers correlate well with those previously found in normal
B6D2F1 and B6 mice (8). The somewhat
higher percentages of Thy-1dull 
thymocytes
found in Tg mice are probably due to the fact that virtually all 
T cells in these mice express the V
1 gene product. Furthermore, most
of the Thy-1dull 
thymocytes isolated from
B6D2F1 Tg mice express a
HSA- CD62L-
CD44+ phenotype (Fig. 2
thymocytes
in normal animals (8).
|

T cells, we
found that only around 10% of the 
T cells present in the
spleen, lymph nodes, liver, and bone marrow expressed low levels of
Thy-1 (not shown). These data could imply that cells expressing similar
phenotypic and functional properties as the
Thy-1dull 
thymocytes rarely seed the
periphery. Alternatively, this could also indicate that
Thy-1dull 
thymocytes modulate their levels
of Thy-1 in the periphery. To distinguish between these two
possibilities we sought an independent marker that could specifically
identify the Thy-1dull 
thymocyte
population and putative peripheral descendents. Because the most
characteristic feature of this population is the expression of a very
restricted TCR repertoire, with almost exclusive utilization of the
V
1 chain together with certain members of the V
6 subfamily
(8), we decided to produce an Ab able to recognize these
V
6 subfamily members.
The 9D3 mAb recognizes V
6.3 and V
6.4 chains
To produce such an mAb we immunized 
-deficient mice with a
Thy-1dull 
T cell hybridoma of DBA/2
origin. Spleen cells from immunized mice were fused with SP2/0 cells,
and the resulting hybridomas were tested for their ability to bind to
the immunizing cells but not to a TCR-negative variant of the same
hybridoma. The fine specificities of the selected mAbs were analyzed by
staining a large panel of T cell hybridomas of B6 and DBA/2 origin
previously characterized for their V
and V
usage (P. Pereira,
unpublished observations). One hybridoma, termed 9D3, specifically
stained some 
T cell hybridomas expressing a V
6 chain but did
not stain 
T cell hybridomas expressing other V
chains,
including V
2, V
4, V
5, and V
7 (not shown). Further analyses
with 
T cell hybridomas expressing different members of the V
6
subfamily showed that 9D3 stained all 
T cell hybridomas of B6
origin expressing the V
6.3 chain (36) and all 
T
cell hybridomas of DBA/2 origin expressing the V
6.4 (8)
chain but not hybridomas expressing any other member of the V
6
subfamily, including the related B6 V
6.1 (37) chain and
the DBA/2 V
6.5 and V
6.6 chains (8) (Table I
). Furthermore, 9D3 stained a sizable
proportion of 
thymocytes, splenocytes, and intestinal
intraepithelial lymphocytes in DBA/2 and B6 strains as well as in B10
and B10.D2 mice that share the same TCR
/
haplotype as B6 mice
(39, 40, 41), but did not stain any 
T cells in BALB/c,
C3H, CBA, or 129/Sv strains of mice, which share a different TCR
/
haplotype (39, 40, 41), suggesting that the 9D3 mAb does not
recognize the V
6.2 chain (37) (not shown).
|

, anti-Thy-1, and 9D3 mAb showed that
8090% of Thy-1dull 
thymocytes were
9D3+, consistent with the predicted specificity
of the 9D3 mAb. Conversely, around 90% of the

+9D3+ thymocytes
expressed low levels of Thy-1 (Fig. 3
T cells by separating the cells
on the basis of 9D3 expression.
|

+9D3+ cells in different
organs
We next analyzed the frequency of 9D3+ cells
among 
lymphocytes in different organs in
D2B6F1 Tg mice. As shown in Table II
, 9D3+ cells
represent roughly 50, 30, and 20% of the 
T cells in liver,
spleen, and peripheral lymph nodes, respectively. In other sites, such
as bone marrow and peritoneal cavity, the frequency of 
T cells
was too low to allow accurate quantification even in Tg mice, although

+9D3+ cells were
present at those sites.
|

+9D3+ cells in different organs
express a restricted TCR
repertoire
One of the characteristics of the Thy-1dull

thymocytes is their very restricted TCR repertoire. Besides
their almost exclusive use of the V
1 chain and one or two members of
the V
6 chain subfamily, their V
D
J
junctional sequences show
limited diversity, and the great majority of them show identical length
(8, 20). To investigate the putative relationship between
the Thy-1dull 
thymocytes and the

+9D3+ cells in the
periphery we examined the junctional length of the V
6 transcripts
present in sorted

+9D3+ and

+9D3- cells isolated
from thymus, spleen, liver, and peripheral lymph nodes as well as from
a Thy-1dull 
hybridoma (DTN40). RT-PCR
reactions with V
6- and C
-specific primers on cDNA isolated from
all sorted populations were performed. An aliquot of each amplification
product was submitted to a run-off reaction in the presence of a
6-carboxy-fluorescein (FAM)-labeled J
1 primer, and the fluorescent
products were resolved on a denaturing acrylamide gel cast on an
automated sequencer.
Typical of polyclonal V
D
J
junctions, the profiles obtained
from sorted 
+9D3-
populations isolated from different organs showed 1115 defined peaks
that form a Gaussian-type curve (Fig. 4
).
All adjacent peaks differ in size by three nucleotides, and thus, the
profiles show mainly in-frame junctions. In contrast, the profiles
obtained for the sorted

+9D3+ populations
showed a prominent peak at a CDR3 length identical with that displayed
by the DTN40 hybridoma cell line, although the relative representation
of this peak varied depending on the organ from which the cells were
isolated. Calculation of the area of this peak relative to the area of
all peaks in each organ indicated that 70, 35, 50, and 25% of the
V
6(D)J
1 rearrangements present in

+9D3+ populations
isolated from thymus, spleen, liver, and lymph nodes, respectively,
showed this particular CDR3 size.
|

+9D3+ cells in the periphery produce
IL-4 and IFN-
upon activation with anti-
mAbs and IL-2
We have previously shown that Thy-1dull

thymocytes secrete high levels of IL-4 and IFN-
upon
activation in vitro with coated anti-
mAbs and IL-2
(8). To investigate whether

+9D3+ cells in the
periphery have the same functional abilities as the
Thy-1dull 
thymocyte population, sorted

+9D3+ and

+9D3- cells from
thymus, spleen, lymph nodes, and liver of D2B6F1
Tg mice were cultured in anti-
mAb-coated plates in the
presence of IL-2, and the levels of IL-4 and
IFN-
present in the culture supernatants were quantitated (Table III
). Regardless of the organ from which
they were isolated, 
T cells secreted substantial amounts of
IFN-
, although 2- to 4-fold higher levels were detected in

+9D3- cells than in

+9D3+ cells. In
contrast, larger differences were observed in the levels of IL-4
produced by these two 
T cell subsets in the different organs.
Thus, in thymus, spleen, and lymph nodes,

+9D3+ cells secreted
10- to 20-fold higher levels of IL-4 than

+9D3- cells, while
the difference was only 2-fold in the liver. It is likely that in the
thymus, the low levels of IL-4 detected in the

+9D3- cultures arise
from the roughly 10% of Thy-1dull 
thymocytes in D2B6F1 animals, which express the
V
6.6 gene product and are not recognized by the 9D3 mAb. Similarly,
the low levels of IL-4 detected in the

+9D3- cultures from
spleen and lymph nodes could arise from V
6.6-bearing cells, although
we do not have direct evidence for this interpretation. Taken together,
these experiments suggest that the production of IL-4 by peripheral

T cells is primarily accomplished by cells expressing the V
6
chain and a restricted TCR repertoire.
|

+9D3+ cells at
different anatomical sites.
We then investigated the surface phenotype of the

+9D3+ and

+9D3- cells present
at different anatomical sites, and their FACS profiles in thymus,
spleen, and liver are illustrated in Fig. 5
. Invariably, most

+9D3+ cells showed an
HSAlow CD44bright
CD62Llow CD45RBint
CD69+ phenotype, similar to that of NK T cells
and activated T cells. However, none of these markers could
unambiguously define the

+9D3+ population. In
fact, the same activated phenotype is expressed by the vast majority of

T cells in the liver, and CD44bright cells
represent an important fraction of the

+9D3- cells in
thymus and spleen.
|

+9D3+ cells are
heterogeneous with regard to the expression of other cell surface
markers (Fig. 6
+9D3- cells present
in the liver are also NK1.1+. We have previously
shown that, unlike other 
thymocytes, around half the
Thy-1dull 
thymocytes express the CD4
coreceptor (8). Similarly, a fraction of the

+9D3+ cells present
in the spleen and liver expresses the CD4 molecule, although the
fraction of CD4+
+
cells appears to be lower in the liver than in the spleen. Finally,
most 
+9D3+ cells are
negative for the expression of CD8, even though
CD8+
+ cells can be
readily detected among the

+9D3- cells in liver
and spleen, confirming previous results (42).
|

+9D3+ cells expressing a restricted
TCR
repertoire exist in the periphery of normal mice
Two types of experiments were performed to investigate the
presence of this type of 
T cells in the periphery of normal mice
and to estimate their numbers. First we performed RT-PCR reactions on
total RNA isolated from different organs of DBA/2 mice with primers
specific for the V
6.4 and C
gene segments. Because most
ß T
cells have deleted the TCR
locus in both chromosomes, this PCR is
expected to mainly, if not exclusively, amplify transcripts expressed
by 
T cells. The PCR amplifications were submitted to run-off
reactions with a FAM-conjugated J
1 primer, and the labeled fragments
were separated on a sequencing gel. The profiles obtained from one such
experiment are shown in Fig. 7
. As can be
seen, a major peak protruding from the Gaussian-type curve
and corresponding to a CDR3 length identical with that of the DTN40
hybridoma cell line is evident in thymus, spleen, and liver. The same
peak is also evident, although to a lesser extent, in the lymph nodes
and in the peritoneal cavity. These experiments suggested that cells
expressing a restricted TCR
repertoire are present in these organs
in normal mice.
|

+9D3+ cells by FACS
analysis in different anatomical sites, and the results are presented
in Table IV
T cells in different
organs in normal mice compared well with those found in Tg mice,
keeping in mind that all 
T cells in the Tg mice express the
V
1 gene product. From this and the previous set of
experiments we estimate that in normal DBA2 mice, roughly
24 x 105 thymocytes, and between 0.5 and
2 x 105 cells in the spleen and liver share
the characteristics previously described for the
Thy-1dull 
thymocytes.
|

T cells able to
simultaneously produce IL-4 and IFN-
upon activation in vitro exist
in the periphery of mice Tg for a rearranged V
1 chain. These cells,
which are found predominantly in spleen and liver, express a restricted
repertoire of TCR composed of the V
1 gene product mainly associated
with the V
6.4 chain and exhibit limited junctional sequence
diversity. 
T cells with a similarly restricted TCR repertoire
are present in the same organs in normal DBA/2 mice. These cells
probably represent the descendants of the previously described
Thy-1dull 
thymocytes (8),
although they seem to up-regulate Thy-1 expression upon seeding the
periphery. Our experiments, however, did not directly address this
issue, and such a relation between Thy-1dull

thymocytes and the cells studied here is, therefore, not
formally established. Although this 
T cell subset expresses an
activated/memory phenotype, none of a variety of markers tested could
unambiguously define this T cell population.
The phenotype, TCR diversity level, and functional properties found in
this 
T cell subset are also characteristic of the T NK
population, and both T cell populations seem to home preferentially to
liver and spleen. These common properties may reflect a similar
differentiation program and/or a related function. However, the likely
difference in their specificities implies separate aspects of function.
Additional experiments will aim at characterizing the specific ligands
recognized by this 
T cell population.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Pablo Pereira, Unité du Développement des Lymphocytes, Centre National de la Recherche Scientifique, URA 1961, Institut Pasteur, 25 rue du Dr. Roux, 75724 Paris Cedex 15, France. E-mail address: ![]()
3 Abbreviations used in this paper: Tg, transgenic; CD62L, CD62 ligand; DN, double negative; FAM, 6-carboxy-fluorescein; HSA, heat-stable Ag. ![]()
Received for publication May 4, 1999. Accepted for publication June 30, 1999.
| References |
|---|
|
|
|---|
/
cells. Annu. Rev. Immunol. 11:637.[Medline]
ß+ cells: new clues to their origin, specificity, and function. J. Exp. Med. 182:633.
/ß+ cells in the liver of mice. J. Exp. Med. 180:699.
ß TCR+NK1.1+ cells. J. Immunol. 145:3209.[Abstract]

thymocytes that secretes a distinct pattern of cytokines and expresses a very restricted T cell receptor repertoire. Eur. J. Immunol. 27:544.[Medline]
ß-T cell receptor+ CD4-CD8- T cells produce IL-4. J. Immunol. 149:1211.[Abstract]

TCR+NK1.1+ thymocytes specifically produce interleukin-4, are major histocompatibility complex class I independent, and are developmentally related to
ß TCR+NK1.1+ thymocytes. Eur. J. Immunol. 26:1424.[Medline]
chain is used by a unique subset of major histocompatibility complex class I-specific CD4+ and CD4-8- T cells in mice and humans. J. Exp. Med. 180:1097.
/ß+ cells in mouse liver. J. Exp. Med. 183:1277.
repertoire expressed by the Thy-1dull 
T cell population is due to cellular selection. Eur. J. Immunol. 28:3456.[Medline]
ß T cells with intermediate TCR induced in the liver of mice by IL-12. J. Immunol. 154:4333.[Abstract]
ß T cells activated by IL-12 as a major effector in inhibition of experimental tumor metastasis. J. Immunol. 156:3366.[Abstract]
14 NKT cells in IL-12-mediated rejection of tumors. Science 278:1623.
14+ NK T cells associated with disease development in autoimmune-prone mice. J. Immunol. 156:4035.[Abstract]
24J
Q antigen receptor in patients with systemic sclerosis. J. Exp. Med. 182:1163.
/ß-T cell receptor (TCR)+ CD4-CD8- (NKT) thymocytes prevent insulin-dependent diabetes mellitus in nonobese diabetic (NOD)/Lt mice by the influence of interleukin (IL)-4 and/or IL-10. J. Exp. Med. 187:1047.
24J
Q T cells in type 1 diabetes. Nature 391:177.[Medline]
8 CD4+ T cells instructs Th2 development and susceptibility to Leishmania major in BALB/c mice. Immunity 6:541.[Medline]

T cells in allergic airway inflammation. Science 280:1265.
1 expressing
/
T lymphocytes in normal mice. J. Exp. Med. 182:1921.
chain controls survival of
/
T cells. J. Exp. Med. 186:1277.
T cells. Nature 342:696.[Medline]
-Chain of dendritic epidermal T cell receptors are diverse but pair with
-chains in a restricted manner. J. Immunol. 142:2924.[Abstract]
locus and expressed early in T-cell differentiation. Nature 327:677.[Medline]
-chain variable region haplotypes of normal and autoimmune laboratory mouse strains. Proc. Natl. Acad. Sci. USA 85:7729.
gene families. Immunogenetics 30:99.[Medline]

T lymphocytes in the liver of mice after birth. Eur. J. Immunol. 21:1733.[Medline]
This article has been cited by other articles:
![]() |
T. Kreslavsky, A. K. Savage, R. Hobbs, F. Gounari, R. Bronson, P. Pereira, P. P. Pandolfi, A. Bendelac, and H. von Boehmer TCR-inducible PLZF transcription factor required for innate phenotype of a subset of {gamma}{delta} T cells with restricted TCR diversity PNAS, July 28, 2009; 106(30): 12453 - 12458. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Jin, C. L. Roark, N. Miyahara, C. Taube, M. K. Aydintug, J. M. Wands, Y. Huang, Y.-S. Hahn, E. W. Gelfand, R. L. O'Brien, et al. Allergic Airway Hyperresponsiveness-Enhancing {gamma}{delta} T Cells Develop in Normal Untreated Mice and Fail to Produce IL-4/13, Unlike Th2 and NKT Cells J. Immunol., February 15, 2009; 182(4): 2002 - 2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Boucontet, N. Sepulveda, J. Carneiro, and P. Pereira Mechanisms Controlling Termination of V-J Recombination at the TCR{gamma} Locus: Implications for Allelic and Isotypic Exclusion of TCR{gamma} Chains J. Immunol., April 1, 2005; 174(7): 3912 - 3919. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-S. Hahn, C. Taube, N. Jin, L. Sharp, J. M. Wands, M. K. Aydintug, M. Lahn, S. A. Huber, R. L. O'Brien, E. W. Gelfand, et al. Different Potentials of {gamma}{delta} T Cell Subsets in Regulating Airway Responsiveness: V{gamma}1+ Cells, but Not V{gamma}4+ Cells, Promote Airway Hyperreactivity, Th2 Cytokines, and Airway Inflammation J. Immunol., March 1, 2004; 172(5): 2894 - 2902. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Roark, M. K. Aydintug, J. Lewis, X. Yin, M. Lahn, Y.-S. Hahn, W. K. Born, R. E. Tigelaar, and R. L. O'Brien Subset-specific, uniform activation among V{gamma}6/V{delta}1+ {gamma}{delta} T cells elicited by inflammation J. Leukoc. Biol., January 1, 2004; 75(1): 68 - 75. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F. Hedges, J. C. Graff, and M. A. Jutila Transcriptional Profiling of {gamma}{delta} T Cells J. Immunol., November 15, 2003; 171(10): 4959 - 4964. [Full Text] [PDF] |
||||
![]() |
K. Grigoriadou, L. Boucontet, and P. Pereira Most IL-4-Producing {gamma}{delta} Thymocytes of Adult Mice Originate from Fetal Precursors J. Immunol., September 1, 2003; 171(5): 2413 - 2420. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Grigoriadou, L. Boucontet, and P. Pereira T Cell Receptor-{gamma} Allele-Specific Selection of V{gamma}1/V{delta}4 Cells in the Intestinal Epithelium J. Immunol., October 1, 2002; 169(7): 3736 - 3743. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Huber, D. Graveline, W. K. Born, and R. L. O'Brien Cytokine Production by V{gamma}+-T-Cell Subsets Is an Important Factor Determining CD4+-Th-Cell Phenotype and Susceptibility of BALB/c Mice to Coxsackievirus B3-Induced Myocarditis J. Virol., July 1, 2001; 75(13): 5860 - 5869. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Park, A. Weiss, K. Benlagha, T. Kyin, L. Teyton, and A. Bendelac The Mouse Cd1d-Restricted Repertoire Is Dominated by a Few Autoreactive T Cell Receptor Families J. Exp. Med., April 16, 2001; 193(8): 893 - 904. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Elahi, G. Pang, R. Clancy, and R. B. Ashman Cellular and Cytokine Correlates of Mucosal Protection in Murine Model of Oral Candidiasis Infect. Immun., October 1, 2000; 68(10): 5771 - 5777. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Rempel, M. Wang, and K. T. HayGlass Failure of rIL-12 administration to inhibit established IgE responses in vivo is associated with enhanced IL-4 synthesis by non-B/non-T cells Int. Immunol., July 1, 2000; 12(7): 1025 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Azuara and P. Pereira Genetic Mapping of Two Murine Loci that Influence the Development of IL-4-Producing Thy-1dull {gamma}{delta} Thymocytes J. Immunol., July 1, 2000; 165(1): 42 - 48. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |