|
|
||||||||

*
Max-Planck-Institut für Immunbiologie, Freiburg, Germany; and
Fakultät für Biologie, Universität Freiburg, Freiburg, Germany
| Abstract |
|---|
|
|
|---|
- and ß-chains of VB17+ Ni-reactive T
cell clones were functionally expressed together with the human CD4
coreceptor in a mouse T cell hybridoma. Loss of CD4 revealed complete
CD4 independence for one of the TCR studied. Putative TCR/Ni contact
points were tested by pairing of TCR chains from different clones, also
with different specificity. TCRBV17 chains with different J regions,
but similar CDR3 regions, could be functionally exchanged. Larger
differences in the CDR3 region were not tolerated. Specific
combinations of
- and ß-chains were required, excluding a
superantigen-like activation by Ni. Mutation of amino acids in CDR1 of
TCRBV17 did not affect Ag recognition, superantigen activation, or HLA
restriction. In contrast, mutation of Arg95 or
Asp96, conserved in many CDR3B sequences of Ni-specific,
VB17+ TCR, abrogated Ni recognition. These results define
specific amino acids in the CDR3B region of a VB17+ TCR to
be crucial for human nickel recognition. CD4 independence implies a
high affinity of such receptor types for the Ni/MHC complex. This may
point to a dominant role of T cells bearing such receptors in the
pathology of contact dermatitis. | Introduction |
|---|
|
|
|---|
-
and a ß-chain (1, 2). The high diversity of these Ag
receptors is caused by the rearrangement of distinct gene elements
during T cell ontogeny (3). The
complementarity-determining regions
(CDRs)5 CDR1, CDR2,
and CDR3, located in the variable parts of the TCR
- and ß-chains
are essential for the recognition of antigenic determinants presented
to T lymphocytes (4, 5). These determinants are often
recognized by the TCR in the form of peptides bound to the Ag binding
grooves of MHC class I and class II molecules (6).
Mutational analyses have allowed the characterization of distinct
interaction sites of the TCR, not only for peptide Ags, but also for
superantigens (7, 8, 9, 10). Crystallographic studies of human
and mouse TCR in complex with peptide or with superantigen and MHC
molecules have confirmed the specific contacts made by the CDR1, CDR2,
CDR3, and also hypervariable (HV) 4 regions of the TCR
- or
ß-chains (11, 12, 13, 14). In these complexes the CDR3s of both
TCR chains are located mainly over the central part of the peptide,
whereas CDR1 and CDR2 of the two chains may contact both peptide- and
MHC-defined determinants. Activation of TCR by superantigens, in
contrast, occurs mainly through the CDR1, CDR2, and HV4 regions of the
TCR ß-chain (14).
During recent years, more and more reports have described TCR with
specificities for nonpeptidic Ags such as carbohydrates, lipids, or
reactive chemicals known as haptens (15, 16). Another
example of nonclassical Ags is represented by metals that can induce
contact hypersensitivities by activation of
ß T cells in humans
(17, 18). Ni, as a typical representative for metal Ags,
forms mainly square-planar coordination complexes with side-chain or
main-chain atoms of amino acids in peptides or proteins (19, 20). These coordination complexes are rather stable and,
therefore, a noncovalent interaction of Ni2+ ions
with MHC-embedded peptides was suggested as a hapten-like epitope for
Ni-reactive T cells (21, 22). However, the definitive
structure of the antigenic determinants created by
Ni2+ ions remains unknown (23). One
way to address this question is to identify prominent TCR structures in
allergic individuals, assuming that they interact with dominant
allergenic epitopes. In previous studies, we demonstrated an
overrepresentation of VA1+ and
VB17+ TCR chains in Ni-specific T cell lines of
strongly allergic patients (24). In addition, an amino
acid motif in the CDR1B region was found to be unique for the TCRBV17
element and another in the CDR3B region to be conserved among the
VB17+ TCR of one donor, indicating their possible
involvement in direct contacts to MHC-Ni epitopes.
In this study, we have investigated the importance of several elements
of these Ni-specific TCR and their contribution to the recognition of
Ni2+ ions as representatives of metal Ags.
Distinct human Ni-reactive TCR were expressed on mouse hybridoma T
cells and functionally studied by TCR-mediated IL-2 release. To
identify regions involved in Ag contact,
- and ß-chains of
different TCR with or without specificity for Ni were paired, and
individual amino acids within the CDR1B and CDR3B regions were
mutated.
| Materials and Methods |
|---|
|
|
|---|
Metal salts and other reagents were used at the following concentrations, if not otherwise specified: NiSO4 x 6H2O, 10-4 M; CuSO4 x 5H2O, 5 x 10-5 M (both from Sigma, Deisenhofen, Germany); PHA, 1 µg/ml (Murex, Dartford, U.K.); staphylococcal enterotoxin B (SEB), 20 ng/ml (Serva, Heidelberg, Germany); tetanus toxoid peptide TT830-843 (QYIKANSKFIGITE), 5 µg/ml; Con A-induced rat spleen supernatant (10%) served as source of IL-2 to maintain CTL line (CTLL) cells. Growth medium for T cell hybridomas (RPMI-FCS) contained RPMI 1640 supplemented with 2 mM L-glutamine, 100 µg/ml kanamycin (all from Life Technologies/BRL, Eggenstein, Germany), 5 x 10-5 M 2-ME (Roth, Karlsruhe, Germany), and 10% heat-inactivated FCS. Culture of human T cell clones was described previously (25).
Cell lines and T cell clones
The Ni-specific T cell clones 4.13, ANi1.3, and ANi2.3 were
obtained from the Ni-allergic donor IF and have been previously
described (24). Donor IF had been HLA typed
(24) as follows: HLA-A1, A26, B35, DRB1*1302, DRB1*0401,
DR52, DR53, DQ6 (1), and DQ7 (3). The murine
T cell hybridomas 54
17 (26) and T
8.1 were a kind
gift of Dr. O. Acuto (Institut Pasteur, Paris, France). For APC, we
used either autologous EBV-transformed B cells of donor IF or HLA-DR
homozygous B cell lines, originating from the International
Histocompatibility Workshop (IHW), WT47 (IHW No. 9063) (DRB1*1302,
DR52), BSM (IHW No. 9032) (DRB1*0401, DR53), PLH (IHW No. 9047)
(DRB1*07, DR53), SWEIG (IHW No. 9037) (DRB1*1101, DR52), and EK (IHW
No. 9054) (DRB1*1401, DR52). The EBV-B cell line APD (DRB1*1301) was
obtained from Dr. F. Koning, Leiden University Medical Center, Leiden,
The Netherlands.
Proliferation assay
The T cell clone 4.13 (4 x 104 cells) was cocultured in triplicate with 4 x 104 irradiated (6000 rad) EBV-B cells of donor IF in 200 µl of complete RPMI 1640 with or without NiSO4 (10-4 M). After 48 h at 37°C, cultures were incubated with 0.5 µCi [3H]thymidine (Amersham Buchler, Braunschweig, Germany), and incorporation of radioactivity was measured in a beta counter (INOTECH, Asbach, Germany) after another 18 h. To assess the requirement of the T cell clone for CD4, the T cell clone was cultured with B cells, 10-4 M NiSO4, and either anti-CD4 (13B8.2) (5 µg/ml) or anti-CD8 mAb (B9.11) (5 µg/ml) (both mAb were obtained from Immunotech, Marseille-Luminy, France).
IL-2 secretion assay
Transfectants (5 x 104 cells) were
cocultured in duplicate or in triplicate in 200 µl RPMI-FCS with
5 x 104 irradiated B cells in the presence
or absence of Ag. After 20 h at 37°C, 100 µl of the
supernatant was used for a CTLL assay as described in Grabstein et al.
(27). Stimulation with immobilized purified
anti-CD3
mAb (145-2C11) (PharMingen, San Diego, CA) or
anti-VB17 mAb (E17.5F3.15.13, Immunotech) was described previously
(28). APC were fixed according to the method of
Shimonkevitz et al. (29). Briefly, B cells were
resuspended at room temperature in 1 ml of PBS containing 0.05%
glutaraldehyde (Life Technologies/BRL). After 45 s, 1 ml of 0.2 M
L-lysine (Life Technologies/BRL) was added for an
additional 45 s. Cells were then washed. To assess class
specificity of HLA restriction, T cells were cultured with B cells,
10-4 M NiSO4, and either
anti-DR (L243, American Type Culture Collection, Manassas, VA
(ATCC)), anti-DP (B7.21, ATCC), or anti-DQ (SPVL3, ATCC) mAb
(1:10 diluted culture supernatant). IL-2 secretion was determined as
above.
Abs and flow cytometry
Hamster anti-murine CD3
mAb (145-2C11) (30)
was used with FITC-conjugated rabbit anti-hamster Ig (Dianova,
Hamburg, Germany). Mouse anti-human mAb used included
FITC-conjugated and nonconjugated TCRBV17 (E17.5F3.15.13) and
FITC-conjugated CD4 (13B8.2) (all from Immunotech). FITC-conjugated
mouse IgG1 (MOPC-21) (Sigma) was used as isotype control. For flow
cytometric analysis, 2 x 105 cells were
stained at 4°C in 96-well round-bottom plates either directly with
FITC-labeled or with unlabeled mAb, followed by staining with the
secondary mAb. Fluorescence was determined in a FACScan instrument
(Becton Dickinson, Mountain View, CA).
Construction of TCR expression vectors
Total RNA of human T cell clones 4.13, ANi1.3, and ANi2.3 was
extracted from 5 x 106 cells using the TRI
reagent RNA/DNA/protein isolation reagent (Molecular Research Center,
Cincinnati, OH). Transcription into cDNA and analysis of TCR
- and
ß-chains were done as previously described (24).
Nomenclature used for TCR gene segments is according to Arden et al.
(31), and CDR3 regions were defined according to Moss and
Bell (32). Functionally rearranged human TCR
and ß
genes were used for construction of mouse-human hybrid TCR expression
vectors (consisting of mouse constant regions and human rearranged
variable regions) as described in Vollmer et al. (28).
Briefly, full-length rearranged TCRV regions of the TCR
- and
ß-chains of clones 4.13, ANi1.3, and ANi2.3 were amplified from cDNA
with the primers listed in Table I
.
Standard PCR procedures were used, including 5 cycles of 30 s at
95°C, 40 s at 60°C, and 40 s at 72°C, followed by 30
cycles of 30 s at 94°C, 40 s at 57°C, and 40 s at
72°C. The primer pair mut13AV3S1 sense and mut13AV3S1 antisense
(Table I
) was used to eliminate an endogenous BamHI site in
the TCRAV3S1 element without altering the amino acid sequence. The
final PCR products were cloned into the pCR-Script vector (Stratagene,
Heidelberg, Germany) and sequenced using the Big Dye sequencing kit
(Applied Biosystems, Foster City, CA) according to the manufacturers
instructions. Sequences were read on a 310 Genetic Analyzer (Applied
Biosystems). Primers used for sequencing were humanLVß17
(ATGAGCAACCAGGTGCTCTGC), humanVß17 (TTTCAGAAAGGAGATATAGCT),
humanV
1 (TTGCCCTGAGAGATGCCAGAG), humanV
3
(GGTGAACAGTCAACAGGGAGA), and a universal and reverse primer
(Pharmacia, Freiburg, Germany). The rearranged human TCRV regions were
then cloned into the TCR expression vectors pV2-15
(conferring
resistance to mycophenolic acid) and pV2-15ß (conferring resistance
to G418) (33), so that they contained the rearranged human
variable parts joined to the complete constant regions of the mouse
TCR. Vectors were linearized with ClaI and EcoRI,
respectively, and used for transfection.
|
The rearranged TCRBV17 chain of 4.13 cloned into the pCR Script
vector was used as a template for subsequent site-directed mutagenesis.
Amino acids in CDR1B (His in position 27) and CDR3B (Arg and Asp in
positions 95 and 96, respectively) were mutated into Ala. The Asp at
position 28 in CDR1B was mutated into Gly (CDR1D-G), as Gly is located
at this position in other human TCRBV chains exhibiting high homology
to TCRBV17S1. This should avoid possible alterations of the TCR
structure due to the mutations (34, 35). Introduction of
point mutations was performed using the QuickChange site-directed
mutagenesis kit (Stratagene) according to the manufacturers
instructions. Primers used are listed in Table I
. Mutated TCR
ß-chains were sequenced as described above and cloned into the TCR
ß-chain expression vector pV2-15ß.
Transfection of TCR expression vectors into mouse hybridoma cells
The murine TCR-negative hybridoma T cell line 54
17,
expressing a human CD4 molecule, was used as recipient cell for
transfection of TCR
- and ß-chain expression vectors. Recipient
cells (8 x 106) were transfected by
electroporation as described previously (28). Cultures
resistant for G418 (Life Technologies/BRL) were analyzed by FACS for
surface expression of TCR, CD3
, and CD4, and expression of the
correct TCR
- or ß-chains was confirmed by PCR and/or TCR
sequencing. Briefly, total RNA was extracted and transcribed into cDNA.
PCR amplifications were performed as above using the primers
humanLVß17, humanV
1, and humanV
3 (for primer sequences see
above) together with mouseC
int (TGTCCTGAGACCGAGGATCT);
mouseCßint (TGATGGCTCAAACAAGGAGAC); or
413JB1S6Splice/SalI, 23JB2S2Splice/SalI, and
13JB1S2Splice/SalI (Table I
). PCR products were purified
with the Qiagen gel extraction kit (Qiagen, Hilden, Germany) and
sequenced using the Big Dye sequencing kit as described above. TCR- and
CD4-positive transfected hybridoma cell lines homogeneously expressing
the chimeric TCR as well as the human coreceptor CD4 were used for
subsequent analyses of T cell responses to Ag, superantigen, and mAb as
described above. Transfectants that had poor or nonhomogeneous TCR
expression were cloned by limiting dilution, and clones were again
tested for Ag responses. Representative lines or clones were used for
all additional experiments.
| Results |
|---|
|
|
|---|
In a previous study, we observed an overrepresentation of the
TCRBV17 element among CD4+ T cell lines raised
from donors with strong hyperreactivity to Ni (24). TCR
sequencing of a panel of Ni-specific T cell clones for one of these
donors revealed interesting features of these TCRBV17 chains. In many
cases, the amino acid Arg is conserved in position 95 of the CDR3B
region and is frequently accompanied by an Asp in position 96. We
wanted to further examine the role of these specific Ag receptors in Ni
recognition, using our previously described method to express
Ni-reactive human TCR together with the human CD4 coreceptor in the
mouse hybridoma cell line 54
17 (28). The amino acid
sequences of the CDR1, CDR2, and CDR3 regions of TCR
- and
ß-chains of three CD4+ human T cell clones
under investigation are shown in Table II
. All three clones were obtained from
the Ni-allergic patient IF. Two of these clones, namely, 4.13 and
ANi2.3, contained very similar TCR
-chains (VA1, JA37) exhibiting
99% similarity. In contrast, clone ANi1.3 expressed VA3 and JA56 and
exhibited only
35% similarity to the other two clones. Concerning
their ß-chains, clones 4.13 and ANi2.3 possess identical TCRBV17
alleles and highly similar CDR3B sequences, including an
Arg95-Asp96 amino acid
motif, but different TCRBJ elements. In contrast, the TCRBV17 chain of
ANi1.3 differed from the other two TCR ß-chains not only in the TCRBJ
region, but also by a different CDR3B sequence and in a slightly
different allele of the TCRBV17 segment (Table II
).
|
17 cells. The resulting TCR transfectants, T413,
T23, and T13, respectively, were analyzed for TCR and CD4 cell surface
expression by FACS analysis. These data are summarized in Table III
17. Table III
|
|
Shuffling of TCR
- and ß-chains between different
DR13-restricted human TCRs
One possibility for the overrepresentation of
VB17+ TCR in NiSO4-induced
human T cell cultures might be a superantigen-like interaction of
Ni2+ ions with amino acids specific for this
TCRBV region. In this case, the TCRBV17 sequence alone might dominate
the recognition of Ni epitopes and might even be sufficient for Ag
recognition. To test this hypothesis, we introduced the TCR ß-chain
of the Ni-reactive T cell clone 4.13 into a transfectant (T
8.1)
containing the
-chain of the unrelated human T cell clone AL8.1
(Table II
). The TCR of clone AL8.1 has been previously described to
react to the tetanus toxoid peptide TT830-843 presented by either
HLA-DRB1*1102 or DRB1*1302 (26), i.e., the same HLA-DR13
allele to which T413 was restricted (Fig. 1
B). The resulting
transfectant TAL8.1A/413B expressed both TCR and CD4 (not shown).
However, TAL8.1A/413B could be stimulated neither by
NiSO4 nor by TT830-843 presented by the
HLA-DRB1*1302-positive B cell line WT47, but could be activated by SEB
and anti-TCR mAb (not shown). This indicates that Ni does not act
in a superantigen-like fashion, but that the structural elements of
both chains of the Ni-specific TCR are needed to create a functional Ag
recognition site. In a subsequent analysis, we tested the combination
of the TCR
- and ß-chains of the two Ni-specific
HLA-DR13-restricted T cell clones 4.13 and ANi1.3. The resulting TCR
transfectants were designated as T413A/13B (TCR
-chain of clone 4.13
and ß-chain of clone ANi1.3) and T13A/413B (reverse combination). The
comparable responses of the two hybrid TCR and of their original TCR in
T413 and T13 to mAb and SEB (Fig. 2
A) reflect the structural and
functional integrity of these Ag receptors. However, neither of the two
hybrid TCR was activated in the presence of NiSO4
(Fig. 2
B). The same result was obtained for the
cross-reactive Ag Cu SO4 (not shown). These data confirm,
in addition to transfectant TAL8.1A/413B, the contribution of both TCR
chains to Ni and Cu specificity and highlight the possible importance
of the Arg95-Asp96 motif in
the CDR3B region in mediating Ni recognition for the transfectants T413
and T23.
|
- and ß-chains by transfection into 54
17 cells.
The resulting TCR transfectants T413A/23B (TCR
-chain of clone 4.13
and ß-chain of clone ANi2.3) and the reverse T23A/413B expressed TCR
and human CD4 (Table III
mAb-mediated
activation (Fig. 2Mutational analysis of single amino acids in the CDR1 and CDR3 regions of a Ni-specific human TCRBV17 chain
One peculiarity of the TCRBV17 element is the amino acid sequence
His-Asp-Ala in positions 27 to 29 of its CDR1 loop. Although
His27 is highly conserved among various TCRBV
seg- ments (30, 38, 39), the combination
His-Asp-Ala is rather unique. These amino acids have been identified as
participating in the Ni binding sites of several Ni-complexing proteins
(40, 41, 42). Although the above experiments excluded that the
motif HDA in the CDR1 region of TCRBV17 itself was sufficient to
mediate Ni reactivity, the motif might still participate in the
interaction with Ni epitopes. A second possible point of contact
between VB17+ TCR ß-chains and Ni antigenic
determinants has been indicated to be represented by the amino acids
Arg95 and Asp96 in the
CDR3B region of the Ni-reactive T cell clones 4.13 and ANi2.3. For
further investigations of TCR contacts with Ni, we therefore mutated
each of the four amino acids, i.e., His27 and
Asp28 in CDR1 and Arg95 and
Asp96 in CDR3 of the TCRBV17 chain of clone 4.13
individually into Ala or Gly. The positions of the mutated amino acids
in the CDR1B and CDR3B regions are indicated in Table II
. The mutated
TCR ß-chains were transfected together with the nonmutated 4.13
-chain into 54
17 cells, resulting in the transfectants CDR1H-A,
CDR1D-G, CDR3R-A, and CDR3D-A. Surface expression of TCR and CD4 on
these transfectants is summarized in Table III
. All four mutated TCR
were effectively activated by anti-TCR mAbs (Fig. 3
, A and B) and SEB
(Fig. 3
, C and D), demonstrating their integrity
and capacity to signal.
|
The reactivity to mAb (Fig. 3
B)- or SEB (Fig. 3
D)-mediated triggering of the CDR3 mutants was also
unaffected by the introduced mutations. However, in contrast to the
CDR1 mutants, the reactivity of the two CDR3 mutants to Ni-induced
epitopes in the presence of autologous APC of donor IF was completely
abrogated (Fig. 3
F). The same loss of activation was also
true for the cross-reactivity to Cu (not shown). These data complete
the observations made by shuffling of the TCR chains of clones 4.13 and
ANi2.3. They allow us to conclude that the Ni-mediated activation of
those two T cell clones is independent of the TCRJB region but directly
involves the Arg95-Asp96
motif of their CDR3B sequences. We have also produced more conservative
mutations in positions 95 and 96 by replacing
Arg95 with Lys and Asp96
with Glu. Preliminary data (not shown) revealed that Asp-Glu exchange
also abrogated Ni reactivity, whereas the Arg-Lys replacement had no
effect; i.e., antigen contacts mediated by position 95 appear more
flexible than those by position 96.
| Discussion |
|---|
|
|
|---|
ß T lymphocytes in an HLA-restricted manner (18).
Although these reactions form the basis for occasionally severe contact
hypersensitivities in a large proportion of the caucasian population
(45), the precise structure of the allergenic determinants
involved and the mode of Ni-induced TCR activation remain poorly
understood (22, 23). One way to address these questions is
to study the major structural features of Ni-reactive TCR.
We have previously described an overrepresentation of
VB17+ TCR among CD4+ (not
CD8+) Ni-induced T cell lines from the peripheral
blood of patients with particularly severe contact hypersensitivity to
Ni (24). Furthermore, others have reported the detection
of elevated numbers of TCRBV17+ Ni-reactive T
cells in skin lesions (46). We took this to indicate an
important role of so-far-unknown properties of this
VB17+ T helper population in mediating and
defining the severity of Ni contact dermatitis. To study the influence
of certain structural features of such TCR, we used our recently
described system to express human-mouse hybrid TCR in the
receptor-deficient mouse hybridoma 54
17 together with human CD4
(28). Such hybridomas have two advantages over T cell
clones: they clearly link recognition specificity to the transfected
TCR and they lack the expression of MHC class II and, hence, the
possibility of "self-presentation" of Ni.
A first experiment (Fig. 1
E) revealed a complete CD4
independence of Ni recognition by at least one of the
VB17+ TCR transfectants studied. In addition, the
parent T cell clone (4.13) was inhibited only to a minor degree by mAb
to the CD4 coreceptor (Fig. 1
F), confirming that this
Ni-specific TCR is independent of CD4 signaling. This may indicate a
high TCR affinity for the DR13-Ni combination and/or that
Ni2+ ions, in addition to conferring specificity,
may be involved in an aggregation of TCR-MHC-Ni complexes. This CD4
independence resembles exceptional TCR interactions with peptide Ags
(47) but also with superantigens. It is not yet clear
whether this effect is restricted to VB17+ TCR,
but earlier data concerning a DQ-restricted,
VB13+ TCR revealed some CD4 dependence of Ni
reactivity (28). Different TCR might, therefore, recognize
the Ni-induced antigenic determinant with distinct affinities. Thus,
VB17+ T cells might possess a higher affinity to
the MHC-Ag complex in Ni recognition than most other TCRBV
elements.
We also examined a potential TCRBV17-dependent superantigen-like T cell
activation by Ni. It has indeed been previously reported in another
hapten-mediated system of T cell activation that a transfer of Ag
specificity (to p-azobenzenearsonate) could be obtained
alone by the TCR
-chain of the original TCR (48). From
control experiments (not shown), we already knew that tetanus
toxoid-specific CD4+,
TCRBV17+ T cells (from the same donor, IF,
providing the Ni-reactive clones) did not cross-react with Ni.
Moreover, pairing of the TCRBV17 chain of an HLA-DR13-restricted
Ni-reactive T cell clone with the
-chain of a DR13-restricted
TT-specific clone abolished reactivity to Ni, but not to superantigen.
Even the crosswise combination of TCR
- and ß-chains of the two
DR13-restricted, TCRBV17+, Ni-reactive T cell
clones ANi1.3 and 4.13 (Fig. 2
, A and B) could
not restore Ni reactivity. Hence, TCRBV17 chains alone, even if derived
from Ni-specific TCR, are not sufficient to create a functional Ni
binding site, and, therefore, Ni does not activate the TCR in a
superantigen-like fashion. Similar to nominal peptide Ags (26, 49, 50) and nonclassical Ags (51), interactions
with Ni for VB17+ TCR also clearly depend on
properties provided only by the specific combination of
- and
ß-chains.
Clones 4.13 and ANi1.3, the TCR of which were used in the above
experiment, possessed different
-chains and also revealed large
sequence differences in the CDR3 and J regions of their ß-chains
(Table II
). In contrast, clone ANi2.3 expressed an
-chain differing
from clone 4.13 by only one conservative amino acid exchange in its
CDR3 loop. The ß-chains of the two TCR differed in the J-proximal
half of their CDR3 sequence as well as in the TCRBJ elements used, but
exhibited the same TCRBV17 sequence and very similar amino acids in
positions 9398 of their CDR3 sequences (Table II
). Both T cell clones
revealed HLA-DR13-restricted specificity for Ni and Cu. The crosswise
combination of their TCR
- and ß-chains did not alter their
recognition specificities (Fig. 2
, C and D). Such
TCR, therefore, might adopt the same or very similar orientations in
the TCR-Ag-MHC complex as proposed for TCR recognizing classical
peptide Ags (52). However, our data are in contrast to
other studies identifying the J region to be responsible for a
heterogeneous pattern of recognition (53, 54).
The different results obtained for the shuffling of the TCR
- and
ß-chains of clones 4.13, ANi1.3, and ANi2.3 might be explained by a
difference in CDR3 length, leading to different TCR orientations above
the antigenic determinant, as suggested for peptide Ags (13, 55). On the other hand, this puts into focus the V-proximal
sequence of CDR3B, which is identical or very similar between the
ß-chains of clones 4.13 and ANi2.3. Those amino acids are located at
or near the tip of the CDR3B loops in a variety of peptide- or
hapten-specific TCR (10, 35, 56, 57, 58), indicating TCR
contact sites with Ni determinants to be represented by the HV regions
comparable with classical peptide Ags (5, 59).
Crystallographic analysis of TCR even showed intimate contact of these
amino acids in the CDR3B region to MHC-bound antigenic peptides
(12, 37).
In this CDR3B region, we previously noticed a particular conservation
of an Arg95-Asp96 motif in
Ni-reactive TCRBV17 chains of donor IF (24). Here we show
that mutation of either of these two amino acids to Ala resulted in
complete loss of Ni specificity (Fig. 3
, D and
F). This underlines the importance of these amino acids in
HLA-DR-restricted Ni recognition and, again, stresses the similarity
between the reactivity of Ni- and peptide-specific TCR. Indeed, for
peptide-specific T cells, positions 95 and 96 in the ß-chain CDR3
have repeatedly been shown to be involved in major contacts with
MHC-associated antigenic peptides (6, 10, 56, 57, 60, 61).
As Arg and Asp have been demonstrated to be involved in binding of Ni
in peptides or in proteins such as arginase (42, 62),
direct interactions with Ni2+ ions are
conceivable. Therefore, one could imagine the nucleophilic nitrogen
groups of Arg and/or the negatively charged oxygen group of Asp as
contributing one or two coordination bonds to a Ni complex. This would
make Ni-mediated activation similar to hapten recognition by T cells of
hapten-peptide-MHC complexes (15). Moreover, the fact that
the same results were obtained for Cu2+ ions
clearly demonstrates that cross-reactive TCR adopt the same molecular
interactions with Cu- as with Ni-induced antigenic determinants.
We have also compared the TCRBV17 sequence with other human TCRBV
segments, particularly with regard to their CDR1 and CDR2 regions.
Although His in position 27 is highly conserved in human CDR1B
sequences (31, 38, 39), the amino acid motif
His27-Asp28-Ala29
is unique for TCRBV17. This is interesting, as these same amino acids
have been reported to participate in the complexing of Ni in several
Ni-binding proteins such as human serum albumin or urease (40, 41, 63). The conservation of His27 in
CDR1B led several authors to the conclusion that this amino acid might
participate in conserved MHC-contacts or might be important for the
overall structure of the TCR (38, 39, 64). Therefore, we
assumed that the CDR1 of TCRBV17 might supply a second important site
for Ni recognition and, thus, might explain the correlation of the
TCRBV17 element with the severity of Ni hyperreactivity. However,
mutation of neither His27 nor
Asp28 interfered in any way with the reactivity
of the 4.13 TCR with Ni or with SEB (Fig. 3
, C and
E). It thus appears that the CDR1 loop of TCRBV17 in the
receptor studied does not contribute significantly to the TCR-Ag,
TCR-HLA, or TCR-SEB contacts. This is in contrast to several studies
describing the involvement of especially the amino acids in positions
27 and 28 of CDR1B in hapten (35, 58), peptide (10, 35, 44, 65, 66), or MHC (38, 44) contact.
In conclusion, we were able to define the amino acids
Arg95 and Asp96 in the
non-template-encoded region of the CDR3B loop as playing a crucial role
in Ni recognition. We cannot exclude the possibility that amino acids
other than the herein described Arg and Asp are involved in the
recognition of Ni-induced antigenic determinants. Further mutational
analysis of putative contact points in the TCR
as well as
ß-chains of Ni-specific T cell clones might clarify this point. In
addition, we cannot yet explain which structural features of the human
TCRBV17 element favor its preferred usage in Ni-reactive TCR of highly
allergic individuals. However, a superantigen-like activation of
VB17+ TCR mediated by Ni2+
ions could be excluded. The finding that TCR specificity and the
sensitivity of its activation was untouched by removal of CD4 implies a
particularly high affinity of such receptor types for the Ni-MHC
complex. This, in turn, may point to a dominant role of T cells bearing
such receptors in the pathogenesis of contact dermatitis. In this
respect, it should be recalled that overrepresentation of TCRBV17
among Ni-reactive TCR is restricted to CD4+ T
cells and was not observed for CD8+ T cells of
the same individual (24).
| Acknowledgments |
|---|
17 and T
8.1, and H. Ruh for expert technical
assistance. We also thank Dr. E. Padovan for helpful
discussion and Dr. I. Haidl for critically revising the
manuscript. | Footnotes |
|---|
2 Current address: CpG ImmunoPharmaceuticals GmbH, c/o Qiagen GmbH, Hilden, Germany. ![]()
3 Address correspondence and reprint requests to Dr. H. U. Weltzien, Max-Planck-Institut für Immunbiologie, Stübeweg 51, 79108 Freiburg, Germany. E-mail address: ![]()
4 Current address: Department of Immunology, IR Jouveinal/Parke Davis, Fresnes, France. ![]()
5 Abbreviations used in this paper: CDR, complementarity-determining region; HV, hypervariable; SEB, staphylococcal enterotoxin B; CTLL, CTL line; IHW, International Histocompatibility Workshop. ![]()
Received for publication December 22, 1998. Accepted for publication June 25, 1999.
| References |
|---|
|
|
|---|
ß receptor. EMBO J. 7:3745.[Medline]
ß T-cell receptors see peptide/MHC complexes. Immunol. Today 14:597.[Medline]
ß T cell receptor: mapping the energy of antigen recognition. Immunity 8:413.[Medline]
ß T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.
Vß heterodimer reveals a novel arrangement of the Vß domain. EMBO J. 16:4205.[Medline]
ß T-cell receptor CDR3 region. Immunogenetics 42:10.
ß V-J shuffling shows lack of autonomy between the combining site and the constant domain of the receptor chains. Eur. J. Immunol. 23:586.[Medline]
chain. J. Exp. Med. 187:367.
3 gene segment is associated with reactivity to p-azobenzenearsonate. Cell 54:247.[Medline]
chain variable domain. Cell 69:999.[Medline]
-chain junctional region in prenyl pyrophosphate antigen recognition by 
T cells. J. Immunol. 161:286.
homodimer: implications for variability in V
Vß domain association. J. Mol. Biol. 269:385.[Medline]
This article has been cited by other articles:
![]() |
H.-J. Thierse, C. Moulon, Y. Allespach, B. Zimmermann, A. Doetze, S. Kuppig, D. Wild, F. Herberg, and H. U. Weltzien Metal-Protein Complex-Mediated Transport and Delivery of Ni2+ to TCR/MHC Contact Sites in Nickel-Specific Human T Cell Activation J. Immunol., February 1, 2004; 172(3): 1926 - 1934. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Dornmair, N. Goebels, H.-U. Weltzien, H. Wekerle, and R. Hohlfeld T-Cell-Mediated Autoimmunity: Novel Techniques to Characterize Autoreactive T-Cell Receptors Am. J. Pathol., October 1, 2003; 163(4): 1215 - 1226. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Gamerdinger, C. Moulon, D. R. Karp, J. van Bergen, F. Koning, D. Wild, U. Pflugfelder, and H. U. Weltzien A New Type of Metal Recognition by Human T Cells: Contact Residues for Peptide-independent Bridging of T Cell Receptor and Major Histocompatibility Complex by Nickel J. Exp. Med., May 19, 2003; 197(10): 1345 - 1353. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Loh and J. Fraser Metal-derivatized Major Histocompatibility Complex: Zeroing in on Contact Hypersensitivity J. Exp. Med., March 3, 2003; 197(5): 549 - 552. [Full Text] [PDF] |
||||
![]() |
L. Lu, J. Vollmer, C. Moulon, H. U. Weltzien, P. Marrack, and J. Kappler Components of the Ligand for a Ni++ Reactive Human T Cell Clone J. Exp. Med., March 3, 2003; 197(5): 567 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Budinger, N. Neuser, U. Totzke, H. F. Merk, and M. Hertl Preferential Usage of TCR-V{beta}17 by Peripheral and Cutaneous T Cells in Nickel-Induced Contact Dermatitis J. Immunol., November 15, 2001; 167(10): 6038 - 6044. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Honda, W. Zhang, A. M. Kalergis, T. P. DiLorenzo, F. Wang, and S. G. Nathenson Hapten Addition to an MHC Class I-Binding Peptide Causes Substantial Adjustments of the TCR Structure of the Responding CD8+ T Cells J. Immunol., October 15, 2001; 167(8): 4276 - 4285. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hallab, K. Merritt, and J. J. Jacobs Metal Sensitivity in Patients with Orthopaedic Implants J. Bone Joint Surg. Am., March 1, 2001; 83(3): 428 - 428. [Full Text] |
||||
![]() |
J. Vollmer, H. U. Weltzien, K. Gamerdinger, S. Lang, Y. Choleva, and C. Moulon Antigen contacts by Ni-reactive TCR: typical {alpha}{beta} chain cooperation versus {alpha} chain-dominated specificity Int. Immunol., December 1, 2000; 12(12): 1723 - 1731. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. L. Kotzin, M. T. Falta, F. Crawford, E. F. Rosloniec, J. Bill, P. Marrack, and J. Kappler Use of soluble peptide-DR4 tetramers to detect synovial T cells specific for cartilage antigens in patients with rheumatoid arthritis PNAS, January 4, 2000; 97(1): 291 - 296. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |