The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vollmer, J.
Right arrow Articles by Moulon, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vollmer, J.
Right arrow Articles by Moulon, C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NICKEL, ELEMENTAL
The Journal of Immunology, 1999, 163: 2723-2731.
Copyright © 1999 by The American Association of Immunologists

TCR Reactivity in Human Nickel Allergy Indicates Contacts with Complementarity-Determining Region 3 but Excludes Superantigen-Like Recognition1

Jörg Vollmer2,*,{dagger}, Hans Ulrich Weltzien3,* and Corinne Moulon4,*

* Max-Planck-Institut für Immunbiologie, Freiburg, Germany; and {dagger} Fakultät für Biologie, Universität Freiburg, Freiburg, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nickel is the most common inducer of contact sensitivity in humans. We previously found that overrepresentation of the TCRBV17 element in Ni-induced CD4+ T cell lines of Ni-allergic patients relates to the severity of the disease. Amino acid sequences of these ß-chains suggested hypothetical contact points for Ni2+ ions in complementarity-determining region (CDR) 1 and CDR3. To specifically address the molecular requirements for Ni recognition by TCR, human TCR {alpha}- and ß-chains of VB17+ Ni-reactive T cell clones were functionally expressed together with the human CD4 coreceptor in a mouse T cell hybridoma. Loss of CD4 revealed complete CD4 independence for one of the TCR studied. Putative TCR/Ni contact points were tested by pairing of TCR chains from different clones, also with different specificity. TCRBV17 chains with different J regions, but similar CDR3 regions, could be functionally exchanged. Larger differences in the CDR3 region were not tolerated. Specific combinations of {alpha}- and ß-chains were required, excluding a superantigen-like activation by Ni. Mutation of amino acids in CDR1 of TCRBV17 did not affect Ag recognition, superantigen activation, or HLA restriction. In contrast, mutation of Arg95 or Asp96, conserved in many CDR3B sequences of Ni-specific, VB17+ TCR, abrogated Ni recognition. These results define specific amino acids in the CDR3B region of a VB17+ TCR to be crucial for human nickel recognition. CD4 independence implies a high affinity of such receptor types for the Ni/MHC complex. This may point to a dominant role of T cells bearing such receptors in the pathology of contact dermatitis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The heterodimeric TCR of most human and mouse T cells consists of an {alpha}- and a ß-chain (1, 2). The high diversity of these Ag receptors is caused by the rearrangement of distinct gene elements during T cell ontogeny (3). The complementarity-determining regions (CDRs)5 CDR1, CDR2, and CDR3, located in the variable parts of the TCR {alpha}- and ß-chains are essential for the recognition of antigenic determinants presented to T lymphocytes (4, 5). These determinants are often recognized by the TCR in the form of peptides bound to the Ag binding grooves of MHC class I and class II molecules (6). Mutational analyses have allowed the characterization of distinct interaction sites of the TCR, not only for peptide Ags, but also for superantigens (7, 8, 9, 10). Crystallographic studies of human and mouse TCR in complex with peptide or with superantigen and MHC molecules have confirmed the specific contacts made by the CDR1, CDR2, CDR3, and also hypervariable (HV) 4 regions of the TCR {alpha}- or ß-chains (11, 12, 13, 14). In these complexes the CDR3s of both TCR chains are located mainly over the central part of the peptide, whereas CDR1 and CDR2 of the two chains may contact both peptide- and MHC-defined determinants. Activation of TCR by superantigens, in contrast, occurs mainly through the CDR1, CDR2, and HV4 regions of the TCR ß-chain (14).

During recent years, more and more reports have described TCR with specificities for nonpeptidic Ags such as carbohydrates, lipids, or reactive chemicals known as haptens (15, 16). Another example of nonclassical Ags is represented by metals that can induce contact hypersensitivities by activation of {alpha}ß T cells in humans (17, 18). Ni, as a typical representative for metal Ags, forms mainly square-planar coordination complexes with side-chain or main-chain atoms of amino acids in peptides or proteins (19, 20). These coordination complexes are rather stable and, therefore, a noncovalent interaction of Ni2+ ions with MHC-embedded peptides was suggested as a hapten-like epitope for Ni-reactive T cells (21, 22). However, the definitive structure of the antigenic determinants created by Ni2+ ions remains unknown (23). One way to address this question is to identify prominent TCR structures in allergic individuals, assuming that they interact with dominant allergenic epitopes. In previous studies, we demonstrated an overrepresentation of VA1+ and VB17+ TCR chains in Ni-specific T cell lines of strongly allergic patients (24). In addition, an amino acid motif in the CDR1B region was found to be unique for the TCRBV17 element and another in the CDR3B region to be conserved among the VB17+ TCR of one donor, indicating their possible involvement in direct contacts to MHC-Ni epitopes.

In this study, we have investigated the importance of several elements of these Ni-specific TCR and their contribution to the recognition of Ni2+ ions as representatives of metal Ags. Distinct human Ni-reactive TCR were expressed on mouse hybridoma T cells and functionally studied by TCR-mediated IL-2 release. To identify regions involved in Ag contact, {alpha}- and ß-chains of different TCR with or without specificity for Ni were paired, and individual amino acids within the CDR1B and CDR3B regions were mutated.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Ags, reagents, and media

Metal salts and other reagents were used at the following concentrations, if not otherwise specified: NiSO4 x 6H2O, 10-4 M; CuSO4 x 5H2O, 5 x 10-5 M (both from Sigma, Deisenhofen, Germany); PHA, 1 µg/ml (Murex, Dartford, U.K.); staphylococcal enterotoxin B (SEB), 20 ng/ml (Serva, Heidelberg, Germany); tetanus toxoid peptide TT830-843 (QYIKANSKFIGITE), 5 µg/ml; Con A-induced rat spleen supernatant (10%) served as source of IL-2 to maintain CTL line (CTLL) cells. Growth medium for T cell hybridomas (RPMI-FCS) contained RPMI 1640 supplemented with 2 mM L-glutamine, 100 µg/ml kanamycin (all from Life Technologies/BRL, Eggenstein, Germany), 5 x 10-5 M 2-ME (Roth, Karlsruhe, Germany), and 10% heat-inactivated FCS. Culture of human T cell clones was described previously (25).

Cell lines and T cell clones

The Ni-specific T cell clones 4.13, ANi1.3, and ANi2.3 were obtained from the Ni-allergic donor IF and have been previously described (24). Donor IF had been HLA typed (24) as follows: HLA-A1, A26, B35, DRB1*1302, DRB1*0401, DR52, DR53, DQ6 (1), and DQ7 (3). The murine T cell hybridomas 54{zeta}17 (26) and T{alpha}8.1 were a kind gift of Dr. O. Acuto (Institut Pasteur, Paris, France). For APC, we used either autologous EBV-transformed B cells of donor IF or HLA-DR homozygous B cell lines, originating from the International Histocompatibility Workshop (IHW), WT47 (IHW No. 9063) (DRB1*1302, DR52), BSM (IHW No. 9032) (DRB1*0401, DR53), PLH (IHW No. 9047) (DRB1*07, DR53), SWEIG (IHW No. 9037) (DRB1*1101, DR52), and EK (IHW No. 9054) (DRB1*1401, DR52). The EBV-B cell line APD (DRB1*1301) was obtained from Dr. F. Koning, Leiden University Medical Center, Leiden, The Netherlands.

Proliferation assay

The T cell clone 4.13 (4 x 104 cells) was cocultured in triplicate with 4 x 104 irradiated (6000 rad) EBV-B cells of donor IF in 200 µl of complete RPMI 1640 with or without NiSO4 (10-4 M). After 48 h at 37°C, cultures were incubated with 0.5 µCi [3H]thymidine (Amersham Buchler, Braunschweig, Germany), and incorporation of radioactivity was measured in a beta counter (INOTECH, Asbach, Germany) after another 18 h. To assess the requirement of the T cell clone for CD4, the T cell clone was cultured with B cells, 10-4 M NiSO4, and either anti-CD4 (13B8.2) (5 µg/ml) or anti-CD8 mAb (B9.11) (5 µg/ml) (both mAb were obtained from Immunotech, Marseille-Luminy, France).

IL-2 secretion assay

Transfectants (5 x 104 cells) were cocultured in duplicate or in triplicate in 200 µl RPMI-FCS with 5 x 104 irradiated B cells in the presence or absence of Ag. After 20 h at 37°C, 100 µl of the supernatant was used for a CTLL assay as described in Grabstein et al. (27). Stimulation with immobilized purified anti-CD3{epsilon} mAb (145-2C11) (PharMingen, San Diego, CA) or anti-VB17 mAb (E17.5F3.15.13, Immunotech) was described previously (28). APC were fixed according to the method of Shimonkevitz et al. (29). Briefly, B cells were resuspended at room temperature in 1 ml of PBS containing 0.05% glutaraldehyde (Life Technologies/BRL). After 45 s, 1 ml of 0.2 M L-lysine (Life Technologies/BRL) was added for an additional 45 s. Cells were then washed. To assess class specificity of HLA restriction, T cells were cultured with B cells, 10-4 M NiSO4, and either anti-DR (L243, American Type Culture Collection, Manassas, VA (ATCC)), anti-DP (B7.21, ATCC), or anti-DQ (SPVL3, ATCC) mAb (1:10 diluted culture supernatant). IL-2 secretion was determined as above.

Abs and flow cytometry

Hamster anti-murine CD3{epsilon} mAb (145-2C11) (30) was used with FITC-conjugated rabbit anti-hamster Ig (Dianova, Hamburg, Germany). Mouse anti-human mAb used included FITC-conjugated and nonconjugated TCRBV17 (E17.5F3.15.13) and FITC-conjugated CD4 (13B8.2) (all from Immunotech). FITC-conjugated mouse IgG1 (MOPC-21) (Sigma) was used as isotype control. For flow cytometric analysis, 2 x 105 cells were stained at 4°C in 96-well round-bottom plates either directly with FITC-labeled or with unlabeled mAb, followed by staining with the secondary mAb. Fluorescence was determined in a FACScan instrument (Becton Dickinson, Mountain View, CA).

Construction of TCR expression vectors

Total RNA of human T cell clones 4.13, ANi1.3, and ANi2.3 was extracted from 5 x 106 cells using the TRI reagent RNA/DNA/protein isolation reagent (Molecular Research Center, Cincinnati, OH). Transcription into cDNA and analysis of TCR {alpha}- and ß-chains were done as previously described (24). Nomenclature used for TCR gene segments is according to Arden et al. (31), and CDR3 regions were defined according to Moss and Bell (32). Functionally rearranged human TCR {alpha} and ß genes were used for construction of mouse-human hybrid TCR expression vectors (consisting of mouse constant regions and human rearranged variable regions) as described in Vollmer et al. (28). Briefly, full-length rearranged TCRV regions of the TCR {alpha}- and ß-chains of clones 4.13, ANi1.3, and ANi2.3 were amplified from cDNA with the primers listed in Table IGo. Standard PCR procedures were used, including 5 cycles of 30 s at 95°C, 40 s at 60°C, and 40 s at 72°C, followed by 30 cycles of 30 s at 94°C, 40 s at 57°C, and 40 s at 72°C. The primer pair mut13AV3S1 sense and mut13AV3S1 antisense (Table IGo) was used to eliminate an endogenous BamHI site in the TCRAV3S1 element without altering the amino acid sequence. The final PCR products were cloned into the pCR-Script vector (Stratagene, Heidelberg, Germany) and sequenced using the Big Dye sequencing kit (Applied Biosystems, Foster City, CA) according to the manufacturer’s instructions. Sequences were read on a 310 Genetic Analyzer (Applied Biosystems). Primers used for sequencing were humanLVß17 (ATGAGCAACCAGGTGCTCTGC), humanVß17 (TTTCAGAAAGGAGATATAGCT), humanV{alpha}1 (TTGCCCTGAGAGATGCCAGAG), humanV{alpha}3 (GGTGAACAGTCAACAGGGAGA), and a universal and reverse primer (Pharmacia, Freiburg, Germany). The rearranged human TCRV regions were then cloned into the TCR expression vectors pV2-15{alpha} (conferring resistance to mycophenolic acid) and pV2-15ß (conferring resistance to G418) (33), so that they contained the rearranged human variable parts joined to the complete constant regions of the mouse TCR. Vectors were linearized with ClaI and EcoRI, respectively, and used for transfection.


View this table:
[in this window]
[in a new window]
 
Table I. Nucleotide sequences of primers used for construction of TCR expression vectors and mutation of TCR {alpha}- or ß-chains

 
Mutations of CDR1B and CDR3B regions

The rearranged TCRBV17 chain of 4.13 cloned into the pCR Script vector was used as a template for subsequent site-directed mutagenesis. Amino acids in CDR1B (His in position 27) and CDR3B (Arg and Asp in positions 95 and 96, respectively) were mutated into Ala. The Asp at position 28 in CDR1B was mutated into Gly (CDR1D-G), as Gly is located at this position in other human TCRBV chains exhibiting high homology to TCRBV17S1. This should avoid possible alterations of the TCR structure due to the mutations (34, 35). Introduction of point mutations was performed using the QuickChange site-directed mutagenesis kit (Stratagene) according to the manufacturer’s instructions. Primers used are listed in Table IGo. Mutated TCR ß-chains were sequenced as described above and cloned into the TCR ß-chain expression vector pV2-15ß.

Transfection of TCR expression vectors into mouse hybridoma cells

The murine TCR-negative hybridoma T cell line 54{zeta}17, expressing a human CD4 molecule, was used as recipient cell for transfection of TCR {alpha}- and ß-chain expression vectors. Recipient cells (8 x 106) were transfected by electroporation as described previously (28). Cultures resistant for G418 (Life Technologies/BRL) were analyzed by FACS for surface expression of TCR, CD3{epsilon}, and CD4, and expression of the correct TCR {alpha}- or ß-chains was confirmed by PCR and/or TCR sequencing. Briefly, total RNA was extracted and transcribed into cDNA. PCR amplifications were performed as above using the primers humanLVß17, humanV{alpha}1, and humanV{alpha}3 (for primer sequences see above) together with mouseC{alpha}int (TGTCCTGAGACCGAGGATCT); mouseCßint (TGATGGCTCAAACAAGGAGAC); or 413JB1S6Splice/SalI, 23JB2S2Splice/SalI, and 13JB1S2Splice/SalI (Table IGo). PCR products were purified with the Qiagen gel extraction kit (Qiagen, Hilden, Germany) and sequenced using the Big Dye sequencing kit as described above. TCR- and CD4-positive transfected hybridoma cell lines homogeneously expressing the chimeric TCR as well as the human coreceptor CD4 were used for subsequent analyses of T cell responses to Ag, superantigen, and mAb as described above. Transfectants that had poor or nonhomogeneous TCR expression were cloned by limiting dilution, and clones were again tested for Ag responses. Representative lines or clones were used for all additional experiments.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of Ni-specific human TCR transfectants and role of the CD4 coreceptor in Ni recognition

In a previous study, we observed an overrepresentation of the TCRBV17 element among CD4+ T cell lines raised from donors with strong hyperreactivity to Ni (24). TCR sequencing of a panel of Ni-specific T cell clones for one of these donors revealed interesting features of these TCRBV17 chains. In many cases, the amino acid Arg is conserved in position 95 of the CDR3B region and is frequently accompanied by an Asp in position 96. We wanted to further examine the role of these specific Ag receptors in Ni recognition, using our previously described method to express Ni-reactive human TCR together with the human CD4 coreceptor in the mouse hybridoma cell line 54{zeta}17 (28). The amino acid sequences of the CDR1, CDR2, and CDR3 regions of TCR {alpha}- and ß-chains of three CD4+ human T cell clones under investigation are shown in Table IIGo. All three clones were obtained from the Ni-allergic patient IF. Two of these clones, namely, 4.13 and ANi2.3, contained very similar TCR {alpha}-chains (VA1, JA37) exhibiting 99% similarity. In contrast, clone ANi1.3 expressed VA3 and JA56 and exhibited only ~35% similarity to the other two clones. Concerning their ß-chains, clones 4.13 and ANi2.3 possess identical TCRBV17 alleles and highly similar CDR3B sequences, including an Arg95-Asp96 amino acid motif, but different TCRBJ elements. In contrast, the TCRBV17 chain of ANi1.3 differed from the other two TCR ß-chains not only in the TCRBJ region, but also by a different CDR3B sequence and in a slightly different allele of the TCRBV17 segment (Table IIGo).


View this table:
[in this window]
[in a new window]
 
Table II. TCRV and TCRJ usage and amino acid sequences of hypervariable TCR{alpha} and/or TCRß regions of T cell clones AL8.1, ANi1.3, ANi2.3, and 4.13

 
Expression vectors for the TCR of clones 4.13, ANi2.3, and ANi1.3 were constructed as described in Materials and Methods and transfected into 54{zeta}17 cells. The resulting TCR transfectants, T413, T23, and T13, respectively, were analyzed for TCR and CD4 cell surface expression by FACS analysis. These data are summarized in Table IIIGo and compared with the TCR-negative recipient cell line 54{zeta}17. Table IIIGo also shows data for several other TCR transfectants, which will be discussed later. The reactivities of the TCR transfectants are shown in Fig. 1Go. For T413, Fig. 1GoA reveals that, as for the corresponding T cell clone 4.13 (not shown), the activation by NiSO4 is inhibited by anti-HLA-DR but not by anti-HLA-DP or anti-HLA-DQ mAbs. HLA-DR restriction was also observed for the other two transfectants (not shown). Consistent with clone 4.13, the TCR transfectant T413 also cross-reacted with Cu (Fig. 1GoA). This cross-reactivity, which was also observed for T23 and T13 (data not shown), proves that both metal reactivities are mediated by the same TCR. It is also important to note that all three transfectants reacted to NiSO4 in the presence of glutaraldehyde-fixed autologous B cells (not shown). This implies that Ag processing is not required and that the epitopes for all three TCR might include Ni2+ ions as essential components.


View this table:
[in this window]
[in a new window]
 
Table III. TCR and CD4 surface expression of TCR transfectants

 


View larger version (42K):
[in this window]
[in a new window]
 
FIGURE 1. Characterization of Ni-specific TCR transfectants and influence of the CD4 coreceptor on Ni recognition. A, Stimulation of the transfectant T413 with (Ni) or without (Ctrl.) 10-4 M NiSO4 in the presence of the autologous B cell line IF. HLA restriction was determined by adding mAb against HLA-DR (DR), HLA-DP (DP), or HLA-DQ (DQ) as described in Materials and Methods. Cross-reactivity to Cu was assessed by incubation with APC and 5 x 10-5 M CuSO4. B through D, Incubation of TCR transfectants T413 (B), T13 (C), and T23 (D) with (Ni) or without (Ctrl.) 10-4 M NiSO4 in the presence of APC BSM (HLA-DRB1*0401, DR53), WT47 (HLA-DRB1*1302, DR52), and PLH (HLA-DRB1*07, DR53). E, Comparison of CD4+ transfectant T413 and CD4- transfectant T413CD4- upon culturing on immobilized anti-VB17 mAb (10-3 µg/well) (Ab) or by stimulation with (Ni) or without (Ctrl.) 2 x 10-4 M NiSO4 or with SEB (20ng/ml) in the presence of APC WT47. Production of IL-2 was determined by [3H]thymidine incorporation of CTLL cells, and results are expressed as cpm ± SD. F, Proliferative response of the T cell clone 4.13 to 10-4 M NiSO4 (Ni) or PHA (1 µg/ml) was assessed in the presence of autologous B cells from donor IF. CD4 dependence was determined by adding mAb (5 µg/ml) against the human CD4 (CD4) coreceptor or the CD8 (CD8) coreceptor as control. Proliferation was determined by incorporation of [3H]thymidine as described in Materials and Methods. Results are expressed as cpm ± SD.

 
The HLA-DR restriction of T413, T23, and T13 was further defined by using HLA-DR homozygous B cell lines matching the HLA-DR haplotype of donor IF. IF was typed as expressing HLA-DRB1*0401, DRB1*1302, DR52, and DR53. Attempts to activate the transfectants in the presence of the B cell lines BSM (HLA-DRB1*0401, DR53), WT47 (HLA-DRB1*1302, DR52), or PLH (HLA-DRB1*07, DR53) are shown in Fig. 1Go, B to D. Only the cell line WT47 effectively presented Ni to all of the transfectants, revealing a HLA-DRB1*1302 restriction. HLA-DR52 restriction was excluded using the B cell line SWEIG, homozygous for HLA-DRB1*1101 and DR52 (not shown). As the Ni-specific TCR of these transfectants originate from CD4+ T cell clones, we have also studied the role of the human CD4 coreceptor in Ni-specific TCR activation. A CD4-negative variant of T413 (T413CD4-) was selected by cloning of T413 (see Table IIIGo for phenotyping). As shown in Fig. 1GoE, there was no decrease in the reactivity of T413CD4- in response to anti-TCR mAb, superantigen, or NiSO4. In addition, we assessed the CD4 dependence of the parent CD4 T cell clone 4.13. As shown in Fig. 1GoF, the activation by NiSO4 is only slightly inhibited by anti-CD4 mAb. The recognition of Ni by the TCR of clone 4.13 thus appears to be independent of the engagement of CD4 coreceptors.

Shuffling of TCR {alpha}- and ß-chains between different DR13-restricted human TCRs

One possibility for the overrepresentation of VB17+ TCR in NiSO4-induced human T cell cultures might be a superantigen-like interaction of Ni2+ ions with amino acids specific for this TCRBV region. In this case, the TCRBV17 sequence alone might dominate the recognition of Ni epitopes and might even be sufficient for Ag recognition. To test this hypothesis, we introduced the TCR ß-chain of the Ni-reactive T cell clone 4.13 into a transfectant (T{alpha}8.1) containing the {alpha}-chain of the unrelated human T cell clone AL8.1 (Table IIGo). The TCR of clone AL8.1 has been previously described to react to the tetanus toxoid peptide TT830-843 presented by either HLA-DRB1*1102 or DRB1*1302 (26), i.e., the same HLA-DR13 allele to which T413 was restricted (Fig. 1GoB). The resulting transfectant TAL8.1A/413B expressed both TCR and CD4 (not shown). However, TAL8.1A/413B could be stimulated neither by NiSO4 nor by TT830-843 presented by the HLA-DRB1*1302-positive B cell line WT47, but could be activated by SEB and anti-TCR mAb (not shown). This indicates that Ni does not act in a superantigen-like fashion, but that the structural elements of both chains of the Ni-specific TCR are needed to create a functional Ag recognition site. In a subsequent analysis, we tested the combination of the TCR {alpha}- and ß-chains of the two Ni-specific HLA-DR13-restricted T cell clones 4.13 and ANi1.3. The resulting TCR transfectants were designated as T413A/13B (TCR {alpha}-chain of clone 4.13 and ß-chain of clone ANi1.3) and T13A/413B (reverse combination). The comparable responses of the two hybrid TCR and of their original TCR in T413 and T13 to mAb and SEB (Fig. 2GoA) reflect the structural and functional integrity of these Ag receptors. However, neither of the two hybrid TCR was activated in the presence of NiSO4 (Fig. 2GoB). The same result was obtained for the cross-reactive Ag Cu SO4 (not shown). These data confirm, in addition to transfectant TAL8.1A/413B, the contribution of both TCR chains to Ni and Cu specificity and highlight the possible importance of the Arg95-Asp96 motif in the CDR3B region in mediating Ni recognition for the transfectants T413 and T23.



View larger version (49K):
[in this window]
[in a new window]
 
FIGURE 2. Shuffling of TCR chains between DR13-restricted Ni-specific T cell clones. A, Stimulation of transfectants T13A/413B and T413A/13B (combination of TCR {alpha}-chain of clone ANi1.3 with ß-chain of 4.13 and vice versa) and original transfectants T13 and T413 by culture on immobilized anti-VB17 mAb (10-3 µg/well) (shaded bars) or with different concentrations of SEB with autologous APC IF. IL-2 secretion was determined by [3H]thymidine incorporation of CTLL cells (for details, see Materials and Methods), and results are expressed as cpm ± SD. B, Incubation of transfectants T13A/413B, T413A/13B, T13, and T413 with graded concentrations of NiSO4 in the presence of IF APC. C, Incubation of transfectants T23A/413B and T413A/23B (TCR combination of clones ANi2.3 and 4.13) in comparison with original transfectants T23 and T413 with SEB and APC WT47 or with immobilized anti-CD3{epsilon} mAb (10-3 µg/well) (shaded bars) as described in Fig. 3GoA. D, IL-2 responses of T23A/413B, T413A/23B, T23, and T413 in the presence of graded concentrations of NiSO4. For details, see Materials and Methods.

 
As the two TCR of clones 4.13 and ANi2.3 primarily differ in their CDR3B and TCRBJ regions (Table IIGo), we produced hybrid receptors of their TCR {alpha}- and ß-chains by transfection into 54{zeta}17 cells. The resulting TCR transfectants T413A/23B (TCR {alpha}-chain of clone 4.13 and ß-chain of clone ANi2.3) and the reverse T23A/413B expressed TCR and human CD4 (Table IIIGo) and compared well with the original TCR transfectants, T23 and T413, in SEB- and anti-CD3{epsilon} mAb-mediated activation (Fig. 2GoC). However, unlike the T413/T13 hybrids (Fig. 2GoB), both T413/T23 hybrids were stimulated by NiSO4 in a manner comparable with that of the parental TCR (Fig. 2GoD). This result was also observed for Cu-specific TCR responses (not shown). It implies that a significant part of the CDR3B and the complete TCRBJ regions do not interfere with Ag and restriction specificity. This, in turn, puts into focus those amino acids of the CDR3B region that are identical or highly similar between the TCR ß-chains of clones 4.13 and ANi2.3 and differ between those and clone ANi1.3. These are the amino acids in positions 93–98 (Table IIGo), and particularly those in positions 95 and 96 (Arg and Asp), which, in several TCR crystals, were shown to be most closely in contact with MHC-associated peptide determinants (12, 37).

Mutational analysis of single amino acids in the CDR1 and CDR3 regions of a Ni-specific human TCRBV17 chain

One peculiarity of the TCRBV17 element is the amino acid sequence His-Asp-Ala in positions 27 to 29 of its CDR1 loop. Although His27 is highly conserved among various TCRBV seg- ments (30, 38, 39), the combination His-Asp-Ala is rather unique. These amino acids have been identified as participating in the Ni binding sites of several Ni-complexing proteins (40, 41, 42). Although the above experiments excluded that the motif HDA in the CDR1 region of TCRBV17 itself was sufficient to mediate Ni reactivity, the motif might still participate in the interaction with Ni epitopes. A second possible point of contact between VB17+ TCR ß-chains and Ni antigenic determinants has been indicated to be represented by the amino acids Arg95 and Asp96 in the CDR3B region of the Ni-reactive T cell clones 4.13 and ANi2.3. For further investigations of TCR contacts with Ni, we therefore mutated each of the four amino acids, i.e., His27 and Asp28 in CDR1 and Arg95 and Asp96 in CDR3 of the TCRBV17 chain of clone 4.13 individually into Ala or Gly. The positions of the mutated amino acids in the CDR1B and CDR3B regions are indicated in Table IIGo. The mutated TCR ß-chains were transfected together with the nonmutated 4.13 {alpha}-chain into 54{zeta}17 cells, resulting in the transfectants CDR1H-A, CDR1D-G, CDR3R-A, and CDR3D-A. Surface expression of TCR and CD4 on these transfectants is summarized in Table IIIGo. All four mutated TCR were effectively activated by anti-TCR mAbs (Fig. 3Go, A and B) and SEB (Fig. 3Go, C and D), demonstrating their integrity and capacity to signal.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 3. Characterization of TCR ß-chain mutants of Ni-specific T cell clone 4.13. The mutated TCR ß-chains of clone 4.13 were transfected together with the 4.13 {alpha}-chain into hybridoma cells, and the resulting transfectants were CDR1D-G, CDR1H-A (mutation of Asp28 and His27 in CDR1B to Gly and Ala, respectively) or CDR3R-A, CDR3D-A (mutation of Arg95 or Asp96 in CDR3B to Ala). A and B, IL-2 responses of these transfectants and the nonmutated transfectant T413 after culturing on immobilized anti-VB17 (10-1 µg/well) (gray bars) or anti-CD3{epsilon} (10-1 µg/well) mAb (hatched bars). C and D, Incubation of the TCR transfectants with different concentrations of SEB in the presence of autologous IF APC. E and F, Stimulation of the CDRB mutants with graded concentrations of NiSO4 and APC IF. Production of IL-2 was determined by [3H]thymidine incorporation of CTLL cells, and results are expressed as cpm ± SD. For details, see Materials and Methods.

 
The reactivity of the CDR1B mutants to SEB is of particular interest, because amino acids in positions 27 and 28 have been shown for several other TCR to be involved in superantigen contact, including SEB (14, 43, 44). When tested for reactivity to Ni on autologous APC, both CDR1 mutants were indistinguishable from the original T413 transfectant (Fig. 3GoE). The same result was obtained for stimulation with Cu (not shown). Some authors have proposed a role for the conserved His27 and adjacent amino acids in defining MHC restriction (38). Therefore, we tested the ability of the CDR1 mutants to be activated by NiSO4 in the presence of APC expressing nonmatching HLA-DR alleles such as HLA-DRB1*1301, DRB1*1401, or DRB1*1101. Although these HLA-DR molecules exhibit the highest similarities to the restricting HLA-DRB1*1302 molecule and all of them mediated SEB activation, none of them was able to present Ni to T413 or the two CDR1 mutants (data not shown).

The reactivity to mAb (Fig. 3GoB)- or SEB (Fig. 3GoD)-mediated triggering of the CDR3 mutants was also unaffected by the introduced mutations. However, in contrast to the CDR1 mutants, the reactivity of the two CDR3 mutants to Ni-induced epitopes in the presence of autologous APC of donor IF was completely abrogated (Fig. 3GoF). The same loss of activation was also true for the cross-reactivity to Cu (not shown). These data complete the observations made by shuffling of the TCR chains of clones 4.13 and ANi2.3. They allow us to conclude that the Ni-mediated activation of those two T cell clones is independent of the TCRJB region but directly involves the Arg95-Asp96 motif of their CDR3B sequences. We have also produced more conservative mutations in positions 95 and 96 by replacing Arg95 with Lys and Asp96 with Glu. Preliminary data (not shown) revealed that Asp-Glu exchange also abrogated Ni reactivity, whereas the Arg-Lys replacement had no effect; i.e., antigen contacts mediated by position 95 appear more flexible than those by position 96.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nickel ions are nonclassical Ags that specifically activate human {alpha}ß T lymphocytes in an HLA-restricted manner (18). Although these reactions form the basis for occasionally severe contact hypersensitivities in a large proportion of the caucasian population (45), the precise structure of the allergenic determinants involved and the mode of Ni-induced TCR activation remain poorly understood (22, 23). One way to address these questions is to study the major structural features of Ni-reactive TCR.

We have previously described an overrepresentation of VB17+ TCR among CD4+ (not CD8+) Ni-induced T cell lines from the peripheral blood of patients with particularly severe contact hypersensitivity to Ni (24). Furthermore, others have reported the detection of elevated numbers of TCRBV17+ Ni-reactive T cells in skin lesions (46). We took this to indicate an important role of so-far-unknown properties of this VB17+ T helper population in mediating and defining the severity of Ni contact dermatitis. To study the influence of certain structural features of such TCR, we used our recently described system to express human-mouse hybrid TCR in the receptor-deficient mouse hybridoma 54{zeta}17 together with human CD4 (28). Such hybridomas have two advantages over T cell clones: they clearly link recognition specificity to the transfected TCR and they lack the expression of MHC class II and, hence, the possibility of "self-presentation" of Ni.

A first experiment (Fig. 1GoE) revealed a complete CD4 independence of Ni recognition by at least one of the VB17+ TCR transfectants studied. In addition, the parent T cell clone (4.13) was inhibited only to a minor degree by mAb to the CD4 coreceptor (Fig. 1GoF), confirming that this Ni-specific TCR is independent of CD4 signaling. This may indicate a high TCR affinity for the DR13-Ni combination and/or that Ni2+ ions, in addition to conferring specificity, may be involved in an aggregation of TCR-MHC-Ni complexes. This CD4 independence resembles exceptional TCR interactions with peptide Ags (47) but also with superantigens. It is not yet clear whether this effect is restricted to VB17+ TCR, but earlier data concerning a DQ-restricted, VB13+ TCR revealed some CD4 dependence of Ni reactivity (28). Different TCR might, therefore, recognize the Ni-induced antigenic determinant with distinct affinities. Thus, VB17+ T cells might possess a higher affinity to the MHC-Ag complex in Ni recognition than most other TCRBV elements.

We also examined a potential TCRBV17-dependent superantigen-like T cell activation by Ni. It has indeed been previously reported in another hapten-mediated system of T cell activation that a transfer of Ag specificity (to p-azobenzenearsonate) could be obtained alone by the TCR {alpha}-chain of the original TCR (48). From control experiments (not shown), we already knew that tetanus toxoid-specific CD4+, TCRBV17+ T cells (from the same donor, IF, providing the Ni-reactive clones) did not cross-react with Ni. Moreover, pairing of the TCRBV17 chain of an HLA-DR13-restricted Ni-reactive T cell clone with the {alpha}-chain of a DR13-restricted TT-specific clone abolished reactivity to Ni, but not to superantigen. Even the crosswise combination of TCR {alpha}- and ß-chains of the two DR13-restricted, TCRBV17+, Ni-reactive T cell clones ANi1.3 and 4.13 (Fig. 2Go, A and B) could not restore Ni reactivity. Hence, TCRBV17 chains alone, even if derived from Ni-specific TCR, are not sufficient to create a functional Ni binding site, and, therefore, Ni does not activate the TCR in a superantigen-like fashion. Similar to nominal peptide Ags (26, 49, 50) and nonclassical Ags (51), interactions with Ni for VB17+ TCR also clearly depend on properties provided only by the specific combination of {alpha}- and ß-chains.

Clones 4.13 and ANi1.3, the TCR of which were used in the above experiment, possessed different {alpha}-chains and also revealed large sequence differences in the CDR3 and J regions of their ß-chains (Table IIGo). In contrast, clone ANi2.3 expressed an {alpha}-chain differing from clone 4.13 by only one conservative amino acid exchange in its CDR3 loop. The ß-chains of the two TCR differed in the J-proximal half of their CDR3 sequence as well as in the TCRBJ elements used, but exhibited the same TCRBV17 sequence and very similar amino acids in positions 93–98 of their CDR3 sequences (Table IIGo). Both T cell clones revealed HLA-DR13-restricted specificity for Ni and Cu. The crosswise combination of their TCR {alpha}- and ß-chains did not alter their recognition specificities (Fig. 2Go, C and D). Such TCR, therefore, might adopt the same or very similar orientations in the TCR-Ag-MHC complex as proposed for TCR recognizing classical peptide Ags (52). However, our data are in contrast to other studies identifying the J region to be responsible for a heterogeneous pattern of recognition (53, 54).

The different results obtained for the shuffling of the TCR {alpha}- and ß-chains of clones 4.13, ANi1.3, and ANi2.3 might be explained by a difference in CDR3 length, leading to different TCR orientations above the antigenic determinant, as suggested for peptide Ags (13, 55). On the other hand, this puts into focus the V-proximal sequence of CDR3B, which is identical or very similar between the ß-chains of clones 4.13 and ANi2.3. Those amino acids are located at or near the tip of the CDR3B loops in a variety of peptide- or hapten-specific TCR (10, 35, 56, 57, 58), indicating TCR contact sites with Ni determinants to be represented by the HV regions comparable with classical peptide Ags (5, 59). Crystallographic analysis of TCR even showed intimate contact of these amino acids in the CDR3B region to MHC-bound antigenic peptides (12, 37).

In this CDR3B region, we previously noticed a particular conservation of an Arg95-Asp96 motif in Ni-reactive TCRBV17 chains of donor IF (24). Here we show that mutation of either of these two amino acids to Ala resulted in complete loss of Ni specificity (Fig. 3Go, D and F). This underlines the importance of these amino acids in HLA-DR-restricted Ni recognition and, again, stresses the similarity between the reactivity of Ni- and peptide-specific TCR. Indeed, for peptide-specific T cells, positions 95 and 96 in the ß-chain CDR3 have repeatedly been shown to be involved in major contacts with MHC-associated antigenic peptides (6, 10, 56, 57, 60, 61). As Arg and Asp have been demonstrated to be involved in binding of Ni in peptides or in proteins such as arginase (42, 62), direct interactions with Ni2+ ions are conceivable. Therefore, one could imagine the nucleophilic nitrogen groups of Arg and/or the negatively charged oxygen group of Asp as contributing one or two coordination bonds to a Ni complex. This would make Ni-mediated activation similar to hapten recognition by T cells of hapten-peptide-MHC complexes (15). Moreover, the fact that the same results were obtained for Cu2+ ions clearly demonstrates that cross-reactive TCR adopt the same molecular interactions with Cu- as with Ni-induced antigenic determinants.

We have also compared the TCRBV17 sequence with other human TCRBV segments, particularly with regard to their CDR1 and CDR2 regions. Although His in position 27 is highly conserved in human CDR1B sequences (31, 38, 39), the amino acid motif His27-Asp28-Ala29 is unique for TCRBV17. This is interesting, as these same amino acids have been reported to participate in the complexing of Ni in several Ni-binding proteins such as human serum albumin or urease (40, 41, 63). The conservation of His27 in CDR1B led several authors to the conclusion that this amino acid might participate in conserved MHC-contacts or might be important for the overall structure of the TCR (38, 39, 64). Therefore, we assumed that the CDR1 of TCRBV17 might supply a second important site for Ni recognition and, thus, might explain the correlation of the TCRBV17 element with the severity of Ni hyperreactivity. However, mutation of neither His27 nor Asp28 interfered in any way with the reactivity of the 4.13 TCR with Ni or with SEB (Fig. 3Go, C and E). It thus appears that the CDR1 loop of TCRBV17 in the receptor studied does not contribute significantly to the TCR-Ag, TCR-HLA, or TCR-SEB contacts. This is in contrast to several studies describing the involvement of especially the amino acids in positions 27 and 28 of CDR1B in hapten (35, 58), peptide (10, 35, 44, 65, 66), or MHC (38, 44) contact.

In conclusion, we were able to define the amino acids Arg95 and Asp96 in the non-template-encoded region of the CDR3B loop as playing a crucial role in Ni recognition. We cannot exclude the possibility that amino acids other than the herein described Arg and Asp are involved in the recognition of Ni-induced antigenic determinants. Further mutational analysis of putative contact points in the TCR {alpha} as well as ß-chains of Ni-specific T cell clones might clarify this point. In addition, we cannot yet explain which structural features of the human TCRBV17 element favor its preferred usage in Ni-reactive TCR of highly allergic individuals. However, a superantigen-like activation of VB17+ TCR mediated by Ni2+ ions could be excluded. The finding that TCR specificity and the sensitivity of its activation was untouched by removal of CD4 implies a particularly high affinity of such receptor types for the Ni-MHC complex. This, in turn, may point to a dominant role of T cells bearing such receptors in the pathogenesis of contact dermatitis. In this respect, it should be recalled that overrepresentation of TCRBV17 among Ni-reactive TCR is restricted to CD4+ T cells and was not observed for CD8+ T cells of the same individual (24).


    Acknowledgments
 
We thank Dr. O. Acuto, who supplied the cell lines 54{zeta}17 and T{alpha}8.1, and H. Ruh for expert technical assistance. We also thank Dr. E. Padovan for helpful discussion and Dr. I. Haidl for critically revising the manuscript.


    Footnotes
 
1 This work was supported by the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie (Grant FKZ 07ALL10), and by the Klinische Forschergruppe "Pathomechanismen der allergischen Entzündung" (Grant FKZ 01GC9701/7). Back

2 Current address: CpG ImmunoPharmaceuticals GmbH, c/o Qiagen GmbH, Hilden, Germany. Back

3 Address correspondence and reprint requests to Dr. H. U. Weltzien, Max-Planck-Institut für Immunbiologie, Stübeweg 51, 79108 Freiburg, Germany. E-mail address: Back

4 Current address: Department of Immunology, IR Jouveinal/Parke Davis, Fresnes, France. Back

5 Abbreviations used in this paper: CDR, complementarity-determining region; HV, hypervariable; SEB, staphylococcal enterotoxin B; CTLL, CTL line; IHW, International Histocompatibility Workshop. Back

Received for publication December 22, 1998. Accepted for publication June 25, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Davis, M. M., P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature 334:395.[Medline]
  2. P. J. Bjorkman ed. The Human T-Cell Receptor Repertoire and Transplantation 1995 Springer-Verlag, Berlin.
  3. Petrie, H. T., F. Livak, D. Burtrum, S. Mazel. 1995. T cell receptor gene recombination patterns and mechanisms: cell death, rescue and T cell production. J. Exp. Med. 182:121.[Abstract/Free Full Text]
  4. Chothia, C., D. Ross Boswell, A. M. Lesk. 1988. The outline structure of the T-cell {alpha}ß receptor. EMBO J. 7:3745.[Medline]
  5. Chien, Y., M. M. Davis. 1993. How {alpha}ß T-cell receptors see peptide/MHC complexes. Immunol. Today 14:597.[Medline]
  6. Jorgensen, J. L., U. Esser, B. Fazekas de St. Groth, P. A. Reay, M. M. Davis. 1992. Mapping T cell receptor-peptide contacts by variant peptide immunization of single-chain transgenics. Nature 355:224.[Medline]
  7. Hong, S.-C., G. Waterbury, C. A. Janeway. 1996. Different superantigens interact with distinct sites in the Vß domain of a single T cell receptor. J. Exp. Med. 183:1437.[Abstract/Free Full Text]
  8. Kelly, J. M., S. J. Sterry, S. Cose, S. J. Turner, J. Fecondo, S. Rodda, P. J. Fink, F. R. Carbone. 1993. Identification of conserved T cell receptor CDR3 residues contacting known exposed peptide side chains from a major histocompatibility complex class I-bound determinant. Eur. J. Immunol. 23:3318.[Medline]
  9. Ehrich, E. W., B. Devaux, E. P. Rock, J. L. Jorgensen, M. M. Davis, Y. Chien. 1993. T cell receptor interaction with peptide/major histocompatibility complex (MHC) and superantigen/MHC ligands is dominated by antigen. J. Exp. Med. 178:713.[Abstract/Free Full Text]
  10. Manning, T. C., C. J. Schlueter, T. C. Brodnicki, E. A. Parke, J. A. Speir, K. C. Garcia, L. Teyton, I. A. Wilson, D. M. Kranz. 1998. Alanine scanning mutagenesis of an {alpha}ß T cell receptor: mapping the energy of antigen recognition. Immunity 8:413.[Medline]
  11. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
  12. Garcia, K. C., M. Degano, R. L. Stanfield, A. Brunmark, M. R. Jackson, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. An {alpha}ß T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.[Abstract/Free Full Text]
  13. Housset, D., G. Mazza, C. Grégoire, C. Piras, B. Malissen, J. C. Fontecilla-Camps. 1997. The three-dimensional structure of a T-cell antigen receptor V{alpha}Vß heterodimer reveals a novel arrangement of the Vß domain. EMBO J. 16:4205.[Medline]
  14. Fields, B. A., E. L. Malchiodi, H. Li, X. Ysern, C. V. Stauffacher, P. M. Schlievert, K. Karjalainen, R. A. Mariuzza. 1996. Crystal structure of a T-cell receptor ß-chain complexed with superantigen. Nature 384:188.[Medline]
  15. Weltzien, H. U., C. Moulon, S. Martin, E. Padovan, U. Hartmann, J. Kohler.. 1996. T cell immune responses to haptens: structural models for allergic and autoimmune responses. Toxicology 107:141.[Medline]
  16. Porcelli, S. A., C. T. Morita, R. L. Modlin. 1996. T-cell recognition of non-peptide antigens. Curr. Opin. Immunol. 8:510.[Medline]
  17. Sinigaglia, F., D. Scheidegger, G. Garotta, R. Scheper, M. Pletscher, A. Lanzavecchia. 1985. Isolation and characterization of Ni-specific T cell clones from patients with Ni-contact dermatitis. J. Immunol. 135:3929.[Abstract]
  18. Sinigaglia, F.. 1994. The molecular basis of metal recognition by T cells. J. Invest. Dermatol. 102:398.[Medline]
  19. Pettit, L. D., J. E. Gregor, and H. Kozlowski. 1991. Complex formation between metal ions and peptides. In Perspectives on Bioinorganic Chemistry, Vol. 1. JAI Press Ltd, Stamford, CT p. 1.
  20. Basketter, D., A. Dooms-Goossens, A.-T. Karlberg, J.-P. Lepoittevin. 1995. The chemistry of contact allergy: why is a molecule allergenic?. Contact Dermatitis 32:65.[Medline]
  21. Romagnoli, P., A. M. Labhardt, F. Sinigaglia. 1991. Selective interaction of Ni with a MHC-bound peptide. EMBO J. 10:1303.[Medline]
  22. Griem, P., M. Wulferink, B. Sachs, J. González, E. Gleichmann. 1998. Allergic and autoimmune reactions to xenobiotics: how do they arise?. Immunol. Today 19:133.[Medline]
  23. Kapsenberg, M. L., J. D. Bos, E. A. Wierenga. 1992. T cells in allergic responses to haptens and proteins. Springer Semin. Immunopathol. 13:303.[Medline]
  24. Vollmer, J., M. Fritz, A. Dormoy, H. U. Weltzien, C. Moulon. 1997. Dominance of the BV17 element in nickel-specific human T cell receptors relates to severity of contact sensitivity. Eur. J. Immunol. 27:1865.[Medline]
  25. Moulon, C., J. Vollmer, H.-U. Weltzien. 1995. Characterization of processing requirements and metal cross-reactivities in T cell clones from patients with allergic contact dermatitis to nickel. Eur. J. Immunol. 25:3308.[Medline]
  26. Blank, U., B. Boitel, D. Mège, M. Ermonval, O. Acuto. 1993. Analysis of tetanus toxin peptide/DR recognition by human T cell receptors reconstituted into a murine T cell hybridoma. Eur. J. Immunol. 23:3057.[Medline]
  27. Grabstein, K., J. Eisenmann, D. Modizuki, P. Schanebeck, P. Cordon, T. Hopp, C. March, S. J. Gilles. 1986. Purification to homogeneity of B cell stimulating factor: a molecule that stimulates proliferation of multiple lymphokine-dependent cell lines. J. Exp. Med. 163:1405.[Abstract/Free Full Text]
  28. Vollmer, J., H. U. Weltzien, A. Dormoy, F. Pistoor, C. Moulon. 1999. Functional expression of a human HLA-DQ restricted, nickel-reactive T cell receptor in mouse hybridoma cells. J. Invest. Dermatol. 113:101.
  29. Shimonkevitz, R., J. Kappler, P. Marrack, H. Grey. 1983. Antigen recognition by H-2-restricted T cells. I. Cell-free antigen processing. J. Exp. Med. 158:303.[Abstract/Free Full Text]
  30. Leo, O., M. Foo, D. H. Sachs, L. E. Samelson, J. A. Bluestone. 1987. Identification of a monoclonal antibody specific for a murine T3 polypeptide. Proc. Natl. Acad. Sci. USA 85:1374.
  31. Arden, B., S. P. Clark, D. Kabelitz, T. W. Mak. 1995. Human T-cell receptor variable gene segment families. Immunogenetics 42:455.[Medline]
  32. Moss, P. A. H., J. I. Bell. 1996. Sequence analysis of the human {alpha}ß T-cell receptor CDR3 region. Immunogenetics 42:10.
  33. Casorati, G., A. Traunecker, K. Karjalainen. 1993. The T cell receptor {alpha}ß V-J shuffling shows lack of autonomy between the combining site and the constant domain of the receptor chains. Eur. J. Immunol. 23:586.[Medline]
  34. Wells, J. A.. 1991. Systematic mutational analysis of protein-protein interfaces. P. J. BjorkmanJ. A. Wells ed. In Molecular Design and Modeling Vol. 202:390. Academic Press, New York.
  35. Kasibhatla, S., E. A. Nalefski, A. Rao. 1993. Simultaneous involvement of all six predicted antigen binding loops of the T cell receptor in recognition of the MHC/antigen peptide complex. J. Immunol. 151:3140.[Abstract]
  36. Boitel, B., M. Ermonval, P. Panina-Bordignon, R. A. Mariuzza, A. Lanzavecchia, O. Acuto. 1992. Preferential Vß gene usage and lack of junctional sequence conservation among human T cell receptors specific for a tetanus toxin-derived peptide: evidence for a dominant role of a germline-encoded V region in antigen/major histocompatibility complex recognition. J. Exp. Med. 175:765.[Abstract/Free Full Text]
  37. Ding, Y.-H., K. J. Smith, D. N. Garboczi, U. Utz, W. E. Biddison, D. C. Wiley. 1998. Two human T cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity 8:403.[Medline]
  38. Vasmatzis, G., J. Cornette, U. Sezerman, C. DeLisi. 1996. TCR recognition of the MHC-peptide dimer: structural properties of a ternary complex. J. Mol. Biol. 261:72.[Medline]
  39. Arden, B.. 1998. Conserved motifs in T-cell receptor CDR1 and CDR2: implications for ligand and CD8 co-receptor binding. Curr. Opin. Immunol. 10:74.[Medline]
  40. Glennon, J. D., B. Sarkar. 1982. Nickel(II) transport in human blood serum. Biochem. J. 203:15.[Medline]
  41. Lippard, S. J.. 1995. At last: the crystal structure of urease. Science 268:997.
  42. Kanyo, Z. F., L. R. Scolnick, D. E. Ash, D. W. Christianson. 1996. Structure of a unique binuclear manganese cluster in arginase. Nature 383:554.[Medline]
  43. Patten, P. A., E. P. Rock, T. Sonoda, B. Fazekas de St. Groth, J. L. Jorgensen, M. M. Davis. 1993. Transfer of putative complementary-determining region loops of T cell receptor V domains confers toxin reactivity but not peptide/MHC specificity. J. Immunol. 150:2281.[Abstract]
  44. Bellio, M., Y.-C. Lone, O. de la Calle-Martin, B. Malissen, J.-P. Abastado, P. Kourilsky. 1994. The Vß complementary determining region 1 of a major histocompatibility complex (MHC) class I-restricted T cell receptor is involved in the recognition of peptide/MHC I and superantigen/MHC II complex. J. Exp. Med. 179:1087.[Abstract/Free Full Text]
  45. Basketter, D. A., G. Briatico-Vangosa, W. Kaestner, C. Lally, W. J. Bontinck. 1993. Nickel, cobalt and chromium in consumer products: a role in allergic contact dermatitis?. Contact Dermatitis 28:15.[Medline]
  46. Zollner, T. M., C. Neubert, A. Wettstein, W.-H. Boehnke, W.-H. Manfras, B. O. Böhm, W. Sterry. 1998. The T-cell receptor Vß repertoire of nickel-specific T cells. Arch. Dermatol. Res. 290:397.[Medline]
  47. Shi, Y., A. Kaliyaperumal, L. Lu, S. Southwood, A. Sette, M. A. Michaels, S. K. Datta. 1998. Promiscuous presentation and recognition of nucleosomal autoepitopes in lupus: role of autoimmune T cell receptor {alpha} chain. J. Exp. Med. 187:367.[Abstract/Free Full Text]
  48. Tan, K.-N., B. M. Datlof, J. A. Gilmore, A. C. Kronman, J. H. Lee, A. M. Maxam, A. Rao. 1988. The T cell receptor V{alpha}3 gene segment is associated with reactivity to p-azobenzenearsonate. Cell 54:247.[Medline]
  49. Hong, S.-C., A. Chelouche, R.-H. Lin, D. Shaywitz, N. S. Braunstein, L. Glimcher, C. A. Janeway. 1992. An MHC interaction site maps to the amino-terminal half of the T cell receptor {alpha} chain variable domain. Cell 69:999.[Medline]
  50. Katayama, C. D., F. J. Eidelman, A. Duncan, F. Hooshmand, S. M. Hedrick. 1995. Predicted complementary determining regions of the T cell antigen receptor determine antigen specificity. EMBO J. 14:927.[Medline]
  51. Bukowski, J. F., C. T. Morita, H. Band, M. B. Brenner. 1998. Crucial role of TCR {gamma}-chain junctional region in prenyl pyrophosphate antigen recognition by {gamma}{delta} T cells. J. Immunol. 161:286.[Abstract/Free Full Text]
  52. Wucherpfennig, K. W., D. A. Hafler, J. L. Strominger. 1995. Structure of human T-cell receptors specific for an immunodominant myelin basic protein peptide: positioning of T-cell receptors on HLA-DR2/peptide complexes. Proc. Natl. Acad. Sci. USA 92:8896.[Abstract/Free Full Text]
  53. Ostrov, D., J. Krieger, J. Sidney, A. Sette, P. Concannon. 1993. T cell receptor antagonism mediated by interaction between T cell receptor junctional residues and peptide antigen analogues. J. Immunol. 150:4277.[Abstract]
  54. Quaratino, S., M. Feldman, C. M. Dayan, O. Acuto, M. Londei. 1996. Human self-reactive T cell clones expressing identical T cell receptor ß chains differ in their ability to recognize a cryptic self-epitope. J. Exp. Med. 183:349.[Abstract/Free Full Text]
  55. Li, H., M. I. Lebedeva, E. S. Ward, R. A. Mariuzza. 1997. Dual conformation of a T cell receptor V{alpha} homodimer: implications for variability in V{alpha}Vß domain association. J. Mol. Biol. 269:385.[Medline]
  56. Engel, I., S. M. Hedrick. 1988. Site-directed mutations in the VDJ junctional region of a T cell receptor ß chain cause changes in antigenic peptide recognition. Cell 54:473.[Medline]
  57. Chang, H.-C., A. Smolyar, R. Spoerl, T. Witte, Y. Yao, E. C. Goyarts, S. G. Nathenson, E. L. Reinherz. 1997. Topology of T cell receptor-peptide/class I MHC interaction defined by charge reversal complementation and functional analysis. J. Mol. Biol. 271:278.[Medline]
  58. Ganju, R. K., S. T. Smiley, J. Bajorath, J. Novotny, E. L. Reinherz. 1992. Similarity between fluorescein-specific T-cell receptor and antibody in chemical details of antigen recognition. Proc. Natl. Acad. Sci. USA 89:11552.[Abstract/Free Full Text]
  59. Wang, F., T. Ono, A. M. Kalergis, W. Zhang, T. P. DiLorenzo, K. Lim, S. G. Nathenson. 1998. On defining the rules for interactions between the T cell receptor and its ligand: a critical role for a specific amino acid residue of the T cell receptor ß chain. Proc. Natl. Acad. Sci. USA 95:5217.[Abstract/Free Full Text]
  60. Bowness, P., P. A. H. Moss, S. Rowland-Jones, J. I. Bell, A. J. McMichael. 1993. Conservation of T cell receptor usage by HLA B27-restricted influenza-specific cytotoxic T lymphocytes suggests a general pattern for antigen-specific major histocompatibility complex class I-restricted responses. Eur. J. Immunol. 23:1417.[Medline]
  61. Turner, S. J., S. C. Jameson, F. R. Carbone. 1997. Functional mapping of the orientation for TCR recognition of an H2-Kb-restricted ovalbumin peptide suggests that the ß-chain can dominate the determination of peptide side chain specificity. J. Immunol. 159:2312.[Abstract/Free Full Text]
  62. Kramer, A., A. Schuster, U. Reineke, R. Malin, R. Volkmer-Engert, C. Landgraf, J. Schneider-Mergener. 1994. Combinatorial cellulose-bound peptide libraries: screening tools for the identification of peptides that bind with predefined specificity. Methods Enzymol. 6:388.
  63. Gajda, T., B. Henry, A. Aubry, J.-J. Delpuech. 1996. Proton and metal ion interactions with glycylglycylhistamine, a serum albumin mimicking pseudopeptide. Inorg. Chem. 35:586.
  64. Bentley, G. A., R. A. Mariuzza. 1996. The structure of the T cell antigen receptor. Annu. Rev. Immunol. 14:563.[Medline]
  65. White, J., A. Pullen, K. Choi, P. Marrack, J. W. Kappler. 1993. Antigen recognition properties of mutant Vß3+ T cell receptors are consistent with an immunoglobulin-like structure for the receptor. J. Exp. Med. 177:119.[Abstract/Free Full Text]
  66. Lone, Y.-C., M. Bellio, A. Prochnicka-Chalufour, D. M. Ojcius, N. Boissel, T. H. M. Ottenhoff, R. D. Klausner, J.-P. Abastado, P. Kourilsky. 1994. Role of the CDR1 region of the TCRB chain in the binding to purified MHC-peptide complex. Int. Immunol. 6:1561.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Immunol.Home page
H.-J. Thierse, C. Moulon, Y. Allespach, B. Zimmermann, A. Doetze, S. Kuppig, D. Wild, F. Herberg, and H. U. Weltzien
Metal-Protein Complex-Mediated Transport and Delivery of Ni2+ to TCR/MHC Contact Sites in Nickel-Specific Human T Cell Activation
J. Immunol., February 1, 2004; 172(3): 1926 - 1934.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
K. Dornmair, N. Goebels, H.-U. Weltzien, H. Wekerle, and R. Hohlfeld
T-Cell-Mediated Autoimmunity: Novel Techniques to Characterize Autoreactive T-Cell Receptors
Am. J. Pathol., October 1, 2003; 163(4): 1215 - 1226.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Gamerdinger, C. Moulon, D. R. Karp, J. van Bergen, F. Koning, D. Wild, U. Pflugfelder, and H. U. Weltzien
A New Type of Metal Recognition by Human T Cells: Contact Residues for Peptide-independent Bridging of T Cell Receptor and Major Histocompatibility Complex by Nickel
J. Exp. Med., May 19, 2003; 197(10): 1345 - 1353.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J. Loh and J. Fraser
Metal-derivatized Major Histocompatibility Complex: Zeroing in on Contact Hypersensitivity
J. Exp. Med., March 3, 2003; 197(5): 549 - 552.
[Full Text] [PDF]


Home page
JEMHome page
L. Lu, J. Vollmer, C. Moulon, H. U. Weltzien, P. Marrack, and J. Kappler
Components of the Ligand for a Ni++ Reactive Human T Cell Clone
J. Exp. Med., March 3, 2003; 197(5): 567 - 574.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
L. Budinger, N. Neuser, U. Totzke, H. F. Merk, and M. Hertl
Preferential Usage of TCR-V{beta}17 by Peripheral and Cutaneous T Cells in Nickel-Induced Contact Dermatitis
J. Immunol., November 15, 2001; 167(10): 6038 - 6044.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Honda, W. Zhang, A. M. Kalergis, T. P. DiLorenzo, F. Wang, and S. G. Nathenson
Hapten Addition to an MHC Class I-Binding Peptide Causes Substantial Adjustments of the TCR Structure of the Responding CD8+ T Cells
J. Immunol., October 15, 2001; 167(8): 4276 - 4285.
[Abstract] [Full Text] [PDF]


Home page
JBJSHome page
N. Hallab, K. Merritt, and J. J. Jacobs
Metal Sensitivity in Patients with Orthopaedic Implants
J. Bone Joint Surg. Am., March 1, 2001; 83(3): 428 - 428.
[Full Text]


Home page
Int ImmunolHome page
J. Vollmer, H. U. Weltzien, K. Gamerdinger, S. Lang, Y. Choleva, and C. Moulon
Antigen contacts by Ni-reactive TCR: typical {alpha}{beta} chain cooperation versus {alpha} chain-dominated specificity
Int. Immunol., December 1, 2000; 12(12): 1723 - 1731.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. L. Kotzin, M. T. Falta, F. Crawford, E. F. Rosloniec, J. Bill, P. Marrack, and J. Kappler
Use of soluble peptide-DR4 tetramers to detect synovial T cells specific for cartilage antigens in patients with rheumatoid arthritis
PNAS, January 4, 2000; 97(1): 291 - 296.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vollmer, J.
Right arrow Articles by Moulon, C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vollmer, J.
Right arrow Articles by Moulon, C.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*NICKEL, ELEMENTAL


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS