|
|
||||||||
CUTTING EDGE |



*
Department of Pathology, University of Utah School of Medicine, Salt Lake City, UT 84132;
Institute for Medical Microbiology and Immunology, Technical University of Munich, Muenchen, Germany; and
Tularik, Inc., South San Francisco, CA 94080
| Abstract |
|---|
|
|
|---|
B
and cytokine production. The physiological importance of this
interaction was demonstrated by the 10-fold greater sensitivity of
TLR2-transfected cells to lipoproteins than LPS. Futhermore,
TLR2-dependant signaling by lipoproteins was facilitated by CD14. These
data indicate that TLR2 facilitates the inflammatory events associated
with Lyme arthritis. In addition, the widespread expression of
lipoproteins by other bacterial species suggests that this interaction
may have broad implications in microbial inflammation and
pathogenesis. | Introduction |
|---|
|
|
|---|
The inflammatory activities attributed to B. burgdorferi
lipoproteins include the ability to directly induce NF-
B nuclear
translocation, resulting in cytokine production, adhesion molecule
expression, and generation of nitric oxide and superoxide
(6, 7, 8, 9). Lipoproteins or their derivatives have been shown
to activate endothelial cells, neutrophils, macrophages, and B
lymphocytes in vitro, and to induce localized inflammatory infiltrate
into knee joints and dermal sites in vivo (6, 7, 8, 9, 14, 15, 16).
B. burgdorferi does not produce LPS (17), nor
does its genome encode the enzymes required for LPS synthesis
(10). Thus, lipoproteins provide the major inflammatory
stimulus associated with chronic infection. The existence of a specific
receptor for the highly inflammatory lipoproteins has been
hypothesized, and would provide a mechanism by which the localized
bacteria could directly activate inflammation.
Bacterial lipoproteins and LPS share many characteristics, including a biologically active lipid modification, the cell types that are responsive, and the types of responses that are induced (18). These observations argue that a similar molecule may be involved in signaling, and is supported by the finding that the LPS coreceptor CD14 also facilitates lipoprotein signaling in several cell types (19, 20, 21). Toll-like receptor (TLR)2 and TLR4 are two candidate proteins that have recently been implicated in LPS signaling (22, 23, 24, 25, 26, 27). TLR4 has been identified by positional cloning as the gene responsible for LPS hyporesponsiveness in C3H/HeJ mice (24, 25, 26). These mice respond normally to lipoproteins (7, 14), arguing that TLR4 is not required for lipoprotein signaling. Transfection of either TLR2 or TLR4 confers responsiveness to LPS in cell lines (22, 23, 27). In this study, the possibility that members of the toll-receptor-like family are involved in signaling by bacterial lipoproteins was investigated.
| Materials and Methods |
|---|
|
|
|---|
U373 cells were obtained from the American Type Culture Collection (ATCC; Manassas, VA). 293 cells were a subclone from Tularik (South San Francisco, CA). The TLR, endothelial cell-leukocyte adhesion molecule (ELAM-1) luciferase, and Rous sarcoma virus (RSV)-ß-galactosidase DNA constructs are described by Kirschning et al. (22). Polymyxin B, LPS from Salmonella typhimurium, and human serum were obtained from Sigma (St. Louis, MO). Pam3Cys-Ser-Lys4-OH was obtained from Boehringer Mannheim (Indianapolis, IN). Sonicated B. burgdorferi and OspA purified from B. burgdorferi were isolated as described (14). Recombinant OspA, OspB, and unlipidated OspA were provided by John Dunn (Brookhaven National Laboratories, Upton, NY) (28). The recombinant and native OspA and sonicated B. burgdorferi contained <0.3 endotoxin units (EU) per 500 ng, as determined by Limulus amebocyte assay (Associates of Cape Cod, Woods Hole, MA). The 60bca cell line was obtained from ATCC, and mopc 21 Ab was from Sigma.
Quantification of TLR cDNA
mRNA and cDNA were prepared (29) from U373 cells cultured in DMEM with serum replacement Nutridoma-HU (Boehringer Mannheim). Transcript levels were quantified using the Light Cycler (Idaho Technology, Idaho Falls, ID) and normalized to hypoxanthine phosphoribosyl transferase (HPRT). This technique continuously monitors the accumulation of fluorescently labeled product to calculate starting transcript numbers and is described in detail by Morrison et al. (29). The oligonucleotide primers used to quantify HPRT were CTGGCGTCGTGATTAGTG and CCAACACTTCGTGGGGTC; TLR1, CTATACACCAAGTTGTCAGC and GTCTCCAACTCAGTAAGGTG; TLR2, TCACCTACATTAGCAACAG and GATCTGAAGCATCAATCTC; TLR3, GATCTGTCTCATAATGGCTTG and GACAGATTCCGAATGCTTGTG; TLR4, GCTTACTTTCACTTCCAAC and GCCATTGAAGATGCCATTG; and TLR5, CTAGCTCCTAATCCTGATG and CCATGTGAAGTCTTTGCTGC.
Transfections
U373 cells were transfected using pFx-2 (Invitrogen, Carlsbad, CA) with 4 µg of either pFLAG alone or pFLAG containing a TLR construct. Cells were grown for 24 h in DMEM with Nutridoma-HU, followed by stimulation for an additional 24 h with agonist. 293 cells were cotransfected using a calcium phosphate kit (Life Technologies, Gaithersburg, MD) at a ratio of 3:1:2 µg for the pFLAG plasmid alone or pFLAG containing a TLR construct: the ELAM-1 luciferase reporter construct: and an RSV ß-galactosidase construct to normalize for transfection efficiency. Cells were grown for 36 h and stimulated with the indicated agonist for an additional 6 h.
Luciferase and cytokine assays
IL-6 (U373) and IL-8 (293) production was measured by ELISA using matched-pair Abs (Endogen, Woburn, MA). 293 cells were then lysed using reporter lysis buffer (Promega, Madison, WI), and 20 µl of lysate was assayed for luciferase and ß-galactosidase activity using a Dynatec MLX luminometer after incubation in luciferase assay reagent (Promega) or Galacto-Light with light emission accelerator (Tropix, Bedford, MA), respectively.
| Results |
|---|
|
|
|---|
|
To test this effect in a second TLR2-negative cell line
(22), expression constructs encoding the four TLR proteins
were transiently transfected into the human embryonic kidney line 293.
The TLR expression plasmids were cotransfected with a NF-
B-dependent
luciferase reporter plasmid that contained the E-selectin (ELAM-1)
promoter. To normalize for transfection efficiency, an
RSV-ß-galactocidase control plasmid was also cotransfected. Only
transfection of the TLR2 expression construct conferred responsiveness
to OspA in 293 cells (Fig. 2
,
A and B) and was reflected in both luciferase and
endogenous IL-8 production. As reported previously, TLR2 also conferred
responsiveness to LPS (22, 23). Because TLR2 conferred
responsiveness to both lipoproteins and LPS, polymyxin B was added to
all lipoprotein samples to eliminate stimulation due to possible LPS
contamination during experimental manipulation. Transfection of TLR4
resulted in constitutive activation, as reported by others in this cell
type (22), and was not up-regulated by either LPS or OspA.
None of the other constructs, pFLAG vector alone, TLR1, or TLR3,
conferred responsiveness to either agonist (Fig. 2
, A and
B).
|
B in 293 cells transfected with TLR2. Sonicated
B. burgdorferi, an abundant source of lipoproteins, was also
a strong stimulant in TLR2-expressing cells. A second recombinant
lipoprotein, OspB, which possesses the same lipid modification on a
distinct polypeptide, also strongly activated TLR2-expressing cells.
The fact that the synthetic lipopeptide
Pam3Cys-Ser-Lys4-OH also
possesses this activity further supports the requirement for the lipid
modification. These findings indicate that several distinct
Pam3Cys-containing molecules induce inflammatory
signaling through TLR2, and suggest that the interaction is dependent
on the common lipid modification. This specificity was confirmed with
unlipidated OspA, a recombinant protein that possesses the same amino
acid sequence as lipidated OspA, but lacks the amino-terminal cysteine
required for the Pam3Cys modification
(31). The unlipidated OspA did not activate either NF-
B
translocation (Fig. 2
Further evidence that lipoproteins are a biologically important ligand
for TLR2 was sought by comparing the dose required for NF-
B
translocation and IL-8 production by LPS and OspA. Human neutrophils
have been found to respond to 10-fold lower molar concentrations of LPS
than OspA when adequate amounts of LPS binding protein and CD14 are
present (9). In contrast, TLR2-transfected 293 cells
responded to at least 10-fold lower concentrations of OspA than LPS
(Fig. 3
, A and B).
The greater sensitivity of TLR2-expressing cells to OspA than LPS
strongly argues that TLR2 is important in mediating inflammatory
signaling by lipoproteins in humans.
|
|
|
| Discussion |
|---|
|
|
|---|
Other properties have been described for the Pam3Cys modification of bacterial lipoproteins, including that of immunological adjuvant (31). Animal studies of the OspA-based Lyme vaccine have demonstrated that its immungenicity is dependent on this lipid modification (31). The identification of TLR2 as a critical component of Pam3Cys signaling may provide a mechanism by which lipoproteins stimulate humoral immune responses without additional adjuvant.
Lyme arthritis, the most common manifestation of late Lyme disease, is associated with the presence of B. burgdorferi in the joint (3, 4). The abundantly expressed lipoproteins are intricately involved in the pathology of Lyme disease. These lipoproteins possess potent stimulatory properties for inflammatory cells that are associated with affected joints: namely neutrophils, mononuclear cells, and endothelial cells (6, 7, 8, 9, 15, 16). Thus, understanding the molecular basis of the signaling events caused by lipoproteins will lead to a greater understanding of the inflammatory events associated with Lyme arthritis in general. In addition, lipoproteins are broadly expressed by numerous pathogen species, many of which have been associated with inflammatory pathology (33, 34, 35). Thus, an understanding of lipoprotein-induced signaling events will have widespread implications in the understanding of the diverse pathologies caused by these microbial species.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Janis J. Weis, Department of Pathology, University of Utah School of Medicine, 50 North Medical Drive, Salt Lake City, UT 84132. E-mail address: ![]()
3 Abbreviations used in this paper: Pam3Cys, tripalmitoyl-S-glyceryl-cysteine; TLR, toll-like receptor; RSV, Rous sarcoma virus; Osp, outer surface protein; ELAM-1, endothelial cell-leukocyte adhesion molecule (E-selectin); HPRT, hypoxanthine phosphoribosyl transferase. ![]()
Received for publication June 9, 1999. Accepted for publication July 8, 1999.
| References |
|---|
|
|
|---|
B and inflammatory activation in human endothelial cells. J. Immunol. 157:4584.[Abstract]
B. Infect. Immun. 64:3845.
B, AP-1, and c-fos by Mycoplasma fermentans membrane lipoproteins in macrophages. J. Immunol. 162:2193.This article has been cited by other articles:
![]() |
M. M. Petzke, A. Brooks, M. A. Krupna, D. Mordue, and I. Schwartz Recognition of Borrelia burgdorferi, the Lyme Disease Spirochete, by TLR7 and TLR9 Induces a Type I IFN Response by Human Immune Cells J. Immunol., October 15, 2009; 183(8): 5279 - 5292. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Verstak, K. Nagpal, S. P. Bottomley, D. T. Golenbock, P. J. Hertzog, and A. Mansell MyD88 Adapter-like (Mal)/TIRAP Interaction with TRAF6 Is Critical for TLR2- and TLR4-mediated NF-{kappa}B Proinflammatory Responses J. Biol. Chem., September 4, 2009; 284(36): 24192 - 24203. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu, A. A. Belperron, C. J. Booth, and L. K. Bockenstedt The Caspase 1 Inflammasome Is Not Required for Control of Murine Lyme Borreliosis Infect. Immun., August 1, 2009; 77(8): 3320 - 3327. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. S. Shin, L. S. Miller, R. L. Modlin, S. Akira, S. Uematsu, and L. T. Hu Downstream Signals for MyD88-Mediated Phagocytosis of Borrelia burgdorferi Can Be Initiated by TRIF and Are Dependent on PI3K J. Immunol., July 1, 2009; 183(1): 491 - 498. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schmaler, N. J. Jann, F. Ferracin, L. Z. Landolt, L. Biswas, F. Gotz, and R. Landmann Lipoproteins in Staphylococcus aureus Mediate Inflammation by TLR2 and Iron-Dependent Growth In Vivo J. Immunol., June 1, 2009; 182(11): 7110 - 7118. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Tawaratsumida, M. Furuyashiki, M. Katsumoto, Y. Fujimoto, K. Fukase, Y. Suda, and M. Hashimoto Characterization of N-terminal Structure of TLR2-activating Lipoprotein in Staphylococcus aureus J. Biol. Chem., April 3, 2009; 284(14): 9147 - 9152. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. A. Dennis, S. Dixit, S. M. O'Brien, X. Alvarez, B. Pahar, and M. T. Philipp Live Borrelia burgdorferi Spirochetes Elicit Inflammatory Mediators from Human Monocytes via the Toll-Like Receptor Signaling Pathway Infect. Immun., March 1, 2009; 77(3): 1238 - 1245. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Sweet, W. Zhang, H. Torres-Fewell, A. Serianni, W. Boggess, and J. Schorey Mycobacterium avium Glycopeptidolipids Require Specific Acetylation and Methylation Patterns for Signaling through Toll-like Receptor 2 J. Biol. Chem., November 28, 2008; 283(48): 33221 - 33231. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. L. F. Bernardino, T. A. Myers, X. Alvarez, A. Hasegawa, and M. T. Philipp Toll-Like Receptors: Insights into Their Possible Role in the Pathogenesis of Lyme Neuroborreliosis Infect. Immun., October 1, 2008; 76(10): 4385 - 4395. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Collins, C. Shi, J. Q. Russell, K. A. Fortner, and R. C. Budd Activation of {gamma}{delta} T Cells by Borrelia burgdorferi Is Indirect via a TLR- and Caspase-Dependent Pathway J. Immunol., August 15, 2008; 181(4): 2392 - 2398. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Wang, M. M. Petzke, R. Iyer, H. Wu, and I. Schwartz Pattern of Proinflammatory Cytokine Induction in RAW264.7 Mouse Macrophages Is Identical for Virulent and Attenuated Borrelia burgdorferi J. Immunol., June 15, 2008; 180(12): 8306 - 8315. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. S. Shin, R. R. Isberg, S. Akira, S. Uematsu, A. K. Behera, and L. T. Hu Distinct Roles for MyD88 and Toll-Like Receptors 2, 5, and 9 in Phagocytosis of Borrelia burgdorferi and Cytokine Induction Infect. Immun., June 1, 2008; 76(6): 2341 - 2351. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. M. Abrahams, P. B. Aldo, S. P. Murphy, I. Visintin, K. Koga, G. Wilson, R. Romero, S. Sharma, and G. Mor TLR6 Modulates First Trimester Trophoblast Responses to Peptidoglycan J. Immunol., May 1, 2008; 180(9): 6035 - 6043. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Leendertse, R. J. L. Willems, I. A. J. Giebelen, P. S. van den Pangaart, W. J. Wiersinga, A. F. de Vos, S. Florquin, M. J. M. Bonten, and T. van der Poll TLR2-Dependent MyD88 Signaling Contributes to Early Host Defense in Murine Enterococcus faecium Peritonitis J. Immunol., April 1, 2008; 180(7): 4865 - 4874. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lazarus, M. A. Kay, A. L. McCarter, and R. M. Wooten Viable Borrelia burgdorferi Enhances Interleukin-10 Production and Suppresses Activation of Murine Macrophages Infect. Immun., March 1, 2008; 76(3): 1153 - 1162. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Petersen, K. D. Bloch, F. Ichinose, H.-S. Shin, M. Shigematsu, A. Bagchi, W. M. Zapol, and J. Hellman Activation of Toll-like receptor 2 impairs hypoxic pulmonary vasoconstriction in mice Am J Physiol Lung Cell Mol Physiol, February 1, 2008; 294(2): L300 - L308. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Bas, L. Neff, M. Vuillet, U. Spenato, T. Seya, M. Matsumoto, and C. Gabay The Proinflammatory Cytokine Response to Chlamydia trachomatis Elementary Bodies in Human Macrophages Is Partly Mediated by a Lipoprotein, the Macrophage Infectivity Potentiator, through TLR2/TLR1/TLR6 and CD14 J. Immunol., January 15, 2008; 180(2): 1158 - 1168. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. R. Cruz, M. W. Moore, C. J. La Vake, C. H. Eggers, J. C. Salazar, and J. D. Radolf Phagocytosis of Borrelia burgdorferi, the Lyme Disease Spirochete, Potentiates Innate Immune Activation and Induces Apoptosis in Human Monocytes Infect. Immun., January 1, 2008; 76(1): 56 - 70. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Barrionuevo, J. Cassataro, M. V. Delpino, A. Zwerdling, K. A. Pasquevich, C. G. Samartino, J. C. Wallach, C. A. Fossati, and G. H. Giambartolomei Brucella abortus Inhibits Major Histocompatibility Complex Class II Expression and Antigen Processing through Interleukin-6 Secretion via Toll-Like Receptor 2 Infect. Immun., January 1, 2008; 76(1): 250 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Nardelli, S. M. Callister, and R. F. Schell Lyme Arthritis: Current Concepts and a Change in Paradigm Clin. Vaccine Immunol., January 1, 2008; 15(1): 21 - 34. [Full Text] [PDF] |
||||
![]() |
C. Popa, S. Abdollahi-Roodsaz, L. A. B. Joosten, N. Takahashi, T. Sprong, G. Matera, M. C. Liberto, A. Foca, M. van Deuren, B. J. Kullberg, et al. Bartonella quintana Lipopolysaccharide Is a Natural Antagonist of Toll-Like Receptor 4 Infect. Immun., October 1, 2007; 75(10): 4831 - 4837. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Izadi, A. T. Motameni, T. C. Bates, E. R. Olivera, V. Villar-Suarez, I. Joshi, R. Garg, B. A. Osborne, R. J. Davis, M. Rincon, et al. c-Jun N-Terminal Kinase 1 Is Required for Toll-Like Receptor 1 Gene Expression in Macrophages Infect. Immun., October 1, 2007; 75(10): 5027 - 5034. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Young Goo, Y. S. Han, W. H. Kim, K.-H. Lee, and S.-J. Park Vibrio vulnificus IlpA-induced Cytokine Production Is Mediated by Toll-like Receptor 2 J. Biol. Chem., September 21, 2007; 282(38): 27647 - 27658. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. MacLeod and L. M. Wetzler T Cell Activation by TLRs: A Role for TLRs in the Adaptive Immune Response Sci. Signal., September 4, 2007; 2007(402): pe48 - pe48. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Rupprecht, C. J. Kirschning, B. Popp, S. Kastenbauer, V. Fingerle, H.-W. Pfister, and U. Koedel Borrelia garinii Induces CXCL13 Production in Human Monocytes through Toll-Like Receptor 2 Infect. Immun., September 1, 2007; 75(9): 4351 - 4356. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Hermann Review: Variability of host pathogen interaction Innate Immunity, August 1, 2007; 13(4): 199 - 218. [Abstract] [PDF] |
||||
![]() |
P. Hartiala, J. Hytonen, J. Pelkonen, K. Kimppa, A. West, M. A. Penttinen, J. Suhonen, R. Lahesmaa, and M. K. Viljanen Transcriptional response of human dendritic cells to Borrelia garinii--defective CD38 and CCR7 expression detected J. Leukoc. Biol., July 1, 2007; 82(1): 33 - 43. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zhao, R. Fleming, B. McCloud, and M. S. Klempner CD14 Mediates Cross Talk between Mononuclear Cells and Fibroblasts for Upregulation of Matrix Metalloproteinase 9 by Borrelia burgdorferi Infect. Immun., June 1, 2007; 75(6): 3062 - 3069. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Obonyo, M. Sabet, S. P. Cole, J. Ebmeyer, S. Uematsu, S. Akira, and D. G. Guiney Deficiencies of Myeloid Differentiation Factor 88, Toll-Like Receptor 2 (TLR2), or TLR4 Produce Specific Defects in Macrophage Cytokine Secretion Induced by Helicobacter pylori Infect. Immun., May 1, 2007; 75(5): 2408 - 2414. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. W. Moore, A. R. Cruz, C. J. LaVake, A. L. Marzo, C. H. Eggers, J. C. Salazar, and J. D. Radolf Phagocytosis of Borrelia burgdorferi and Treponema pallidum Potentiates Innate Immune Activation and Induces Gamma Interferon Production Infect. Immun., April 1, 2007; 75(4): 2046 - 2062. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Kielian, N. K. Phulwani, N. Esen, M. Md. Syed, A. C. Haney, K. McCastlain, and J. Johnson MyD88-Dependent Signals Are Essential for the Host Immune Response in Experimental Brain Abscess J. Immunol., April 1, 2007; 178(7): 4528 - 4537. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Winkler, D. Ghadimi, J. Schrezenmeir, and J.-P. Kraehenbuhl Molecular and Cellular Basis of Microflora-Host Interactions J. Nutr., March 1, 2007; 137(3): 756S - 772S. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. R. Montgomery, C. J. Booth, X. Wang, V. A. Blaho, S. E. Malawista, and C. R. Brown Recruitment of Macrophages and Polymorphonuclear Leukocytes in Lyme Carditis Infect. Immun., February 1, 2007; 75(2): 613 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Bolz, R. S. Sundsbak, Y. Ma, S. Akira, J. H. Weis, T. G. Schwan, and J. J. Weis Dual Role of MyD88 in Rapid Clearance of Relapsing Fever Borrelia spp. Infect. Immun., December 1, 2006; 74(12): 6750 - 6760. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Shirey, J.-Y. Jung, and J. M. Carlin Up-Regulation of Gamma Interferon Receptor Expression Due to Chlamydia-Toll-Like Receptor Interaction Does Not Enhance Signal Transducer and Activator of Transcription 1 Signaling Infect. Immun., December 1, 2006; 74(12): 6877 - 6884. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Crandall, D. M. Dunn, Y. Ma, R. M. Wooten, J. F. Zachary, J. H. Weis, R. B. Weiss, and J. J. Weis Gene Expression Profiling Reveals Unique Pathways Associated with Differential Severity of Lyme Arthritis J. Immunol., December 1, 2006; 177(11): 7930 - 7942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lazarus, M. J. Meadows, R. E. Lintner, and R. M. Wooten IL-10 Deficiency Promotes Increased Borrelia burgdorferi Clearance Predominantly through Enhanced Innate Immune Responses J. Immunol., November 15, 2006; 177(10): 7076 - 7085. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Sethi, M. Sondey, Y. Bai, K. S. Kim, and D. Cadavid Interaction of a Neurotropic Strain of Borrelia turicatae with the Cerebral Microcirculation System Infect. Immun., November 1, 2006; 74(11): 6408 - 6418. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Buckley, J. H. Wang, and H. P. Redmond Cellular reprogramming by gram-positive bacterial components: a review J. Leukoc. Biol., October 1, 2006; 80(4): 731 - 741. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Bubeck Wardenburg, W. A. Williams, and D. Missiakas Host defenses against Staphylococcus aureus infection require recognition of bacterial lipoproteins PNAS, September 12, 2006; 103(37): 13831 - 13836. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Mogensen, S. R. Paludan, M. Kilian, and L. Ostergaard Live Streptococcus pneumoniae, Haemophilus influenzae, and Neisseria meningitidis activate the inflammatory response through Toll-like receptors 2, 4, and 9 in species-specific patterns J. Leukoc. Biol., August 1, 2006; 80(2): 267 - 277. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Paul-Satyaseela, M. Karched, Z. Bian, R. Ihalin, T. Boren, A. Arnqvist, C. Chen, and S. Asikainen Immunoproteomics of Actinobacillus actinomycetemcomitans outer-membrane proteins reveal a highly immunoreactive peptidoglycan-associated lipoprotein. J. Med. Microbiol., July 1, 2006; 55(Pt 7): 931 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Behera, E. Hildebrand, S. Uematsu, S. Akira, J. Coburn, and L. T. Hu Identification of a TLR-Independent Pathway for Borrelia burgdorferi-Induced Expression of Matrix Metalloproteinases and Inflammatory Mediators through Binding to Integrin {alpha}3beta1 J. Immunol., July 1, 2006; 177(1): 657 - 664. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Stewart, X. Wang, D. M. Bueschel, D. R. Clifton, D. Grimm, K. Tilly, J. A. Carroll, J. J. Weis, and P. A. Rosa Delineating the Requirement for the Borrelia burgdorferi Virulence Factor OspC in the Mammalian Host Infect. Immun., June 1, 2006; 74(6): 3547 - 3553. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Malik, C. S. Bakshi, B. Sahay, A. Shah, S. A. Lotz, and T. J. Sellati Toll-Like Receptor 2 Is Required for Control of Pulmonary Infection with Francisella tularensis Infect. Immun., June 1, 2006; 74(6): 3657 - 3662. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. E. Cole, K. L. Elkins, S. M. Michalek, N. Qureshi, L. J. Eaton, P. Rallabhandi, N. Cuesta, and S. N. Vogel Immunologic Consequences of Francisella tularensis Live Vaccine Strain Infection: Role of the Innate Immune Response in Infection and Immunity. J. Immunol., June 1, 2006; 176(11): 6888 - 6899. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Andersen, D. Al-Khairy, and R. R. Ingalls Innate Immunity at the Mucosal Surface: Role of Toll-Like Receptor 3 and Toll-Like Receptor 9 in Cervical Epithelial Cell Responses to Microbial Pathogens Biol Reprod, May 1, 2006; 74(5): 824 - 831. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Buwitt-Beckmann, H. Heine, K.-H. Wiesmuller, G. Jung, R. Brock, S. Akira, and A. J. Ulmer TLR1- and TLR6-independent Recognition of Bacterial Lipopeptides J. Biol. Chem., April 7, 2006; 281(14): 9049 - 9057. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Behera, E. Hildebrand, R. T. Bronson, G. Perides, S. Uematsu, S. Akira, and L. T. Hu MyD88 Deficiency Results in Tissue-Specific Changes in Cytokine Induction and Inflammation in Interleukin-18-Independent Mice Infected with Borrelia burgdorferi Infect. Immun., March 1, 2006; 74(3): 1462 - 1470. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hashimoto, K. Tawaratsumida, H. Kariya, K. Aoyama, T. Tamura, and Y. Suda Lipoprotein is a predominant Toll-like receptor 2 ligand in Staphylococcus aureus cell wall components Int. Immunol., February 1, 2006; 18(2): 355 - 362. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. M. O'Connell, I. A. Ionova, A. J. Quayle, A. Visintin, and R. R. Ingalls Localization of TLR2 and MyD88 to Chlamydia trachomatis Inclusions: EVIDENCE FOR SIGNALING BY INTRACELLULAR TLR2 DURING INFECTION WITH AN OBLIGATE INTRACELLULAR PATHOGEN J. Biol. Chem., January 20, 2006; 281(3): 1652 - 1659. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Knapp, C. W. Wieland, S. Florquin, R. Pantophlet, L. Dijkshoorn, N. Tshimbalanga, S. Akira, and T. van der Poll Differential Roles of CD14 and Toll-like Receptors 4and 2 in Murine Acinetobacter Pneumonia Am. J. Respir. Crit. Care Med., January 1, 2006; 173(1): 122 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Xu, S. V. Seemanapalli, L. Lomax, K. McShan, X. Li, E. Fikrig, and F. T. Liang Association of Linear Plasmid 28-1 with an Arthritic Phenotype of Borrelia burgdorferi Infect. Immun., November 1, 2005; 73(11): 7208 - 7215. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Guerau-de-Arellano, J. Alroy, D. Bullard, and B. T. Huber Aggravated Lyme Carditis in CD11a-/- and CD11c-/- Mice Infect. Immun., November 1, 2005; 73(11): 7637 - 7643. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Londono, Y. Bai, W. R. Zuckert, H. Gelderblom, and D. Cadavid Cardiac Apoptosis in Severe Relapsing Fever Borreliosis Infect. Immun., November 1, 2005; 73(11): 7669 - 7676. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Collins, J. Wolfe, K. Roessner, C. Shi, L. H. Sigal, and R. C. Budd Lyme Arthritis Synovial {gamma}{delta} T Cells Instruct Dendritic Cells via Fas Ligand J. Immunol., November 1, 2005; 175(9): 5656 - 5665. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Verjan, I. Hirono, and T. Aoki Genetic Loci of Major Antigenic Protein Genes of Edwardsiella tarda Appl. Envir. Microbiol., September 1, 2005; 71(9): 5654 - 5658. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Al-Robaiy, J. Knauer, and R. K. Straubinger Borrelia burgdorferi Organisms Lacking Plasmids 25 and 28-1 Are Internalized by Human Blood Phagocytes at a Rate Identical to That of the Wild-Type Strain Infect. Immun., September 1, 2005; 73(9): 5547 - 5553. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. J. Schroder, I. Diterich, A. Zinke, J. Eckert, C. Draing, V. v. Baehr, D. Hassler, S. Priem, K. Hahn, K. S. Michelsen, et al. Heterozygous Arg753Gln Polymorphism of Human TLR-2 Impairs Immune Activation by Borrelia burgdorferi and Protects from Late Stage Lyme Disease J. Immunol., August 15, 2005; 175(4): 2534 - 2540. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Salazar, C. D. Pope, M. W. Moore, J. Pope, T. G. Kiely, and J. D. Radolf Lipoprotein-Dependent and -Independent Immune Responses to Spirochetal Infection Clin. Vaccine Immunol., August 1, 2005; 12(8): 949 - 958. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. S. Berenson, T. F. Murphy, C. T. Wrona, and S. Sethi Outer Membrane Protein P6 of Nontypeable Haemophilus influenzae Is a Potent and Selective Inducer of Human Macrophage Proinflammatory Cytokines Infect. Immun., May 1, 2005; 73(5): 2728 - 2735. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Craig-Mylius, G. F. Weber, J. Coburn, and L. Glickstein Borrelia burgdorferi, an extracellular pathogen, circumvents osteopontin in inducing an inflammatory cytokine response J. Leukoc. Biol., May 1, 2005; 77(5): 710 - 718. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Stoll, J. Dengjel, C. Nerz, and F. Gotz Staphylococcus aureus Deficient in Lipidation of Prelipoproteins Is Attenuated in Growth and Immune Activation Infect. Immun., April 1, 2005; 73(4): 2411 - 2423. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghosh, A. C. Steere, B. D. Stollar, and B. T. Huber In Situ Diversification of the Antibody Repertoire in Chronic Lyme Arthritis Synovium J. Immunol., March 1, 2005; 174(5): 2860 - 2869. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. R.-E.-I. Benhnia, D. Wroblewski, M. N. Akhtar, R. A. Patel, W. Lavezzi, S. C. Gangloff, S. M. Goyert, M. J. Caimano, J. D. Radolf, and T. J. Sellati Signaling through CD14 Attenuates the Inflammatory Response to Borrelia burgdorferi, the Agent of Lyme Disease J. Immunol., February 1, 2005; 174(3): 1539 - 1548. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. O'Brien, J. H. Wang, and H. P. Redmond Bacterial Lipoprotein Induces Resistance to Gram-Negative Sepsis in TLR4-Deficient Mice via Enhanced Bacterial Clearance J. Immunol., January 15, 2005; 174(2): 1020 - 1026. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Akamine, F. Higa, N. Arakaki, K. Kawakami, K. Takeda, S. Akira, and A. Saito Differential Roles of Toll-Like Receptors 2 and 4 in In Vitro Responses of Macrophages to Legionella pneumophila Infect. Immun., January 1, 2005; 73(1): 352 - 361. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Wang, Y. Ma, J. H. Weis, J. F. Zachary, C. J. Kirschning, and J. J. Weis Relative Contributions of Innate and Acquired Host Responses to Bacterial Control and Arthritis Development in Lyme Disease Infect. Immun., January 1, 2005; 73(1): 657 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Vasselon, P. A. Detmers, D. Charron, and A. Haziot TLR2 Recognizes a Bacterial Lipopeptide through Direct Binding J. Immunol., December 15, 2004; 173(12): 7401 - 7405. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Hyakushima, H. Mitsuzawa, C. Nishitani, H. Sano, K. Kuronuma, M. Konishi, T. Himi, K. Miyake, and Y. Kuroki Interaction of Soluble Form of Recombinant Extracellular TLR4 Domain with MD-2 Enables Lipopolysaccharide Binding and Attenuates TLR4-Mediated Signaling J. Immunol., December 1, 2004; 173(11): 6949 - 6954. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. H. Giambartolomei, A. Zwerdling, J. Cassataro, L. Bruno, C. A. Fossati, and M. T. Philipp Lipoproteins, Not Lipopolysaccharide, Are the Key Mediators of the Proinflammatory Response Elicited by Heat-Killed Brucella abortus J. Immunol., October 1, 2004; 173(7): 4635 - 4642. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Gehring, K. M. Dobos, J. T. Belisle, C. V. Harding, and W. H. Boom Mycobacterium tuberculosis LprG (Rv1411c): A Novel TLR-2 Ligand That Inhibits Human Macrophage Class II MHC Antigen Processing J. Immunol., August 15, 2004; 173(4): 2660 - 2668. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. J. Schroder, H. Heine, C. Alexander, M. Manukyan, J. Eckert, L. Hamann, U. B. Gobel, and R. R. Schumann Lipopolysaccharide Binding Protein Binds to Triacylated and Diacylated Lipopeptides and Mediates Innate Immune Responses J. Immunol., August 15, 2004; 173(4): 2683 - 2691. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Siedlar, M. Frankenberger, E. Benkhart, T. Espevik, M. Quirling, K. Brand, M. Zembala, and L. Ziegler-Heitbrock Tolerance Induced by the Lipopeptide Pam3Cys Is Due to Ablation of IL-1R-Associated Kinase-1 J. Immunol., August 15, 2004; 173(4): 2736 - 2745. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. D. Bolz, R. S. Sundsbak, Y. Ma, S. Akira, C. J. Kirschning, J. F. Zachary, J. H. Weis, and J. J. Weis MyD88 Plays a Unique Role in Host Defense but Not Arthritis Development in Lyme Disease J. Immunol., August 1, 2004; 173(3): 2003 - 2010. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Liu, R. R. Montgomery, S. W. Barthold, and L. K. Bockenstedt Myeloid Differentiation Antigen 88 Deficiency Impairs Pathogen Clearance but Does Not Alter Inflammation in Borrelia burgdorferi-Infected Mice Infect. Immun., June 1, 2004; 72(6): 3195 - 3203. [Abstract] [Full Text] [PDF] |
||||
![]() |
A.-H. Hovav, L. Davidovitch, G. Nussbaum, J. Mullerad, Y. Fishman, and H. Bercovier Mitogenicity of the Recombinant Mycobacterial 27-Kilodalton Lipoprotein Is Not Connected to Its Antiprotective Effect Infect. Immun., June 1, 2004; 72(6): 3383 - 3390. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Shin, A. V. Bryksin, H. P. Godfrey, and F. C. Cabello Localization of BmpA on the Exposed Outer Membrane of Borrelia burgdorferi by Monospecific Anti-Recombinant BmpA Rabbit Antibodies Infect. Immun., April 1, 2004; 72(4): 2280 - 2287. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Okusawa, M. Fujita, J.-i. Nakamura, T. Into, M. Yasuda, A. Yoshimura, Y. Hara, A. Hasebe, D. T. Golenbock, M. Morita, et al. Relationship between Structures and Biological Activities of Mycoplasmal Diacylated Lipopeptides and Their Recognition by Toll-Like Receptors 2 and 6 Infect. Immun., March 1, 2004; 72(3): 1657 - 1665. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Knapp, C. W. Wieland, C. van 't Veer, O. Takeuchi, S. Akira, S. Florquin, and T. van der Poll Toll-Like Receptor 2 Plays a Role in the Early Inflammatory Response to Murine Pneumococcal Pneumonia but Does Not Contribute to Antibacterial Defense J. Immunol., March 1, 2004; 172(5): 3132 - 3138. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Campos, G. M. S. Rosinha, I. C. Almeida, X. S. Salgueiro, B. W. Jarvis, G. A. Splitter, N. Qureshi, O. Bruna-Romero, R. T. Gazzinelli, and S. C. Oliveira Role of Toll-Like Receptor 4 in Induction of Cell-Mediated Immunity and Resistance to Brucella abortus Infection in Mice Infect. Immun., January 1, 2004; 72(1): 176 - 186. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. L. Fisette, S. Ram, J. M. Andersen, W. Guo, and R. R. Ingalls The Lip Lipoprotein from Neisseria gonorrhoeae Stimulates Cytokine Release and NF-{kappa}B Activation in Epithelial Cells in a Toll-like Receptor 2-dependent Manner J. Biol. Chem., November 21, 2003; 278(47): 46252 - 46260. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Saito, T. Yajima, H. Nishimura, K. Aiba, R. Ishimitsu, T. Matsuguchi, T. Fushimi, Y. Ohshima, Y. Tsukamoto, and Y. Yoshikai Soluble Branched {beta}-(1,4)Glucans from Acetobacter Species Show Strong Activities to Induce Interleukin-12 in Vitro and Inhibit T-helper 2 Cellular Response with Immunoglobulin E Production in Vivo J. Biol. Chem., October 3, 2003; 278(40): 38571 - 38578. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Coleman and J. L. Benach The Urokinase Receptor Can Be Induced by Borrelia burgdorferi through Receptors of the Innate Immune System Infect. Immun., October 1, 2003; 71(10): 5556 - 5564. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Fujita, T. Into, M. Yasuda, T. Okusawa, S. Hamahira, Y. Kuroki, A. Eto, T. Nisizawa, M. Morita, and K.-i. Shibata Involvement of Leucine Residues at Positions 107, 112, and 115 in a Leucine-Rich Repeat Motif of Human Toll-Like Receptor 2 in the Recognition of Diacylated Lipoproteins and Lipopeptides and Staphylococcus aureus Peptidoglycans J. Immunol., October 1, 2003; 171(7): 3675 - 3683. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Hayashi, T. K. Means, and A. D. Luster Toll-like receptors stimulate human neutrophil function Blood, October 1, 2003; 102(7): 2660 - 2669. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Sau, S. S. Mambula, E. Latz, P. Henneke, D. T. Golenbock, and S. M. Levitz The Antifungal Drug Amphotericin B Promotes Inflammatory Cytokine Release by a Toll-like Receptor- and CD14-dependent Mechanism J. Biol. Chem., September 26, 2003; 278(39): 37561 - 37568. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. W. J. Schroder, U. Schombel, H. Heine, U. B. Gobel, U. Zahringer, and R. R. Schumann Acylated Cholesteryl Galactoside as a Novel Immunogenic Motif in Borrelia burgdorferi Sensu Stricto J. Biol. Chem., September 5, 2003; 278(36): 33645 - 33653. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Leemans, M. Heikens, K. P. M. van Kessel, S. Florquin, and T. van der Poll Lipoteichoic Acid and Peptidoglycan from Staphylococcus aureus Synergistically Induce Neutrophil Influx into the Lungs of Mice Clin. Vaccine Immunol., September 1, 2003; 10(5): 950 - 953. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Forestal, J. L. Benach, C. Carbonara, J. K. Italo, T. J. Lisinski, and M. B. Furie Francisella tularensis Selectively Induces Proinflammatory Changes in Endothelial Cells J. Immunol., September 1, 2003; 171(5): 2563 - 2570. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Salazar, C. D. Pope, T. J. Sellati, H. M. Feder Jr, T. G. Kiely, K. R. Dardick, R. L. Buckman, M. W. Moore, M. J. Caimano, J. G. Pope, et al. Coevolution of Markers of Innate and Adaptive Immunity in Skin and Peripheral Blood of Patients with Erythema Migrans J. Immunol., September 1, 2003; 171(5): 2660 - 2670. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. F. Smith Jr., A. Mitchell, G. Li, S. Ding, A. M. Fitzmaurice, K. Ryan, S. Crowe, and J. B. Goldberg Toll-like Receptor (TLR) 2 and TLR5, but Not TLR4, Are Required for Helicobacter pylori-induced NF-{kappa}B Activation and Chemokine Expression by Epithelial Cells J. Biol. Chem., August 29, 2003; 278(35): 32552 - 32560. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. I. Tapping and P. S. Tobias Mycobacterial lipoarabinomannan mediates physical interactions between TLR1 and TLR2 to induce signaling Innate Immunity, August 1, 2003; 9(4): 264 - 268. [Abstract] [PDF] |
||||
![]() |
H. M. Paterson, T. J. Murphy, E. J. Purcell, O. Shelley, S. J. Kriynovich, E. Lien, J. A. Mannick, and J. A. Lederer Injury Primes the Innate Immune System for Enhanced Toll-Like Receptor Reactivity J. Immunol., August 1, 2003; 171(3): 1473 - 1483. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Van Amersfoort, T. J. C. Van Berkel, and J. Kuiper Receptors, Mediators, and Mechanisms Involved in Bacterial Sepsis and Septic Shock Clin. Microbiol. Rev., July 1, 2003; 16(3): 379 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Yoder, X. Wang, Y. Ma, M. T. Philipp, M. Heilbrun, J. H. Weis, C. J. Kirschning, R. M. Wooten, and J. J. Weis Tripalmitoyl-S-Glyceryl-Cysteine-Dependent OspA Vaccination of Toll-Like Receptor 2-Deficient Mice Results in Effective Protection from Borrelia burgdorferi Challenge Infect. Immun., July 1, 2003; 71(7): 3894 - 3900. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Diterich, C. Rauter, C. J. Kirschning, and T. Hartung Borrelia burgdorferi-Induced Tolerance as a Model of Persistence via Immunosuppression Infect. Immun., July 1, 2003; 71(7): 3979 - 3987. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Crowley and B. T. Huber Host-Adapted Borrelia burgdorferi in Mice Expresses OspA during Inflammation Infect. Immun., July 1, 2003; 71(7): 4003 - 4010. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Sato, H. Sano, D. Iwaki, K. Kudo, M. Konishi, H. Takahashi, T. Takahashi, H. Imaizumi, Y. Asai, and Y. Kuroki Direct Binding of Toll-Like Receptor 2 to Zymosan, and Zymosan-Induced NF-{kappa}B Activation and TNF-{alpha} Secretion Are Down-Regulated by Lung Collectin Surfactant Protein A J. Immunol., July 1, 2003; 171(1): 417 - 425. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |