The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, S. K.
Right arrow Articles by Pillarisetti, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, S. K.
Right arrow Articles by Pillarisetti, K.
The Journal of Immunology, 1999, 163: 2368-2372.
Copyright © 1999 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: CXCR4-Lo: Molecular Cloning and Functional Expression of a Novel Human CXCR4 Splice Variant

Shalley K. Gupta1 and Kodandaram Pillarisetti

Department of Cardiovascular Pharmacology, SmithKline Beecham Pharmaceuticals, King of Prussia, PA 19406


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
Human CXCR4 is a specific receptor for the CXC chemokine stromal cell-derived factor-1 (SDF-1) and a coreceptor for T cell line tropic strains of HIV-1. Genetic knockouts of CXCR4 and SDF-1 have delineated their critical role during embryonic cardiogenesis, leukopoiesis, and vasculogenesis. Herein, we used bioinformatics and differential strategies like isoform-specific RT-PCR and Northern blots to identify and clone a novel unspliced isoform of human CXCR4, termed CXCR4-Lo. CXCR4-Lo corresponds to a larger ~4.0-kb mRNA transcript and differs from the known human CXCR4 by the first 9 aa in the functionally important NH2-terminal extracellular domain of the receptor. CXCR4-Lo-transfected rat basophil leukemia-2H3 cells responded to SDF-1 with a transient rise of intracellular Ca2+ concentration and by undergoing chemotaxis. Expression of CXCR4-Lo is noteworthy, as it may have differential affinity as a coreceptor for HIV strains in comparison with CXCR4. Furthermore, CXCR4-Lo may also provide a functional backup to CXCR4 during embryogenesis.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
Stromal cell-derived factor-1 (SDF-1)2 is a CXC chemokine (1) that uses CXCR4 as its specific receptor (2). SDF-1 (1, 3), along with CXCR4 (4, 5), has widespread tissue expression and is a potent chemoattractant of PBLs (6) and endothelial cells (7). Recent studies with genetic knockouts of both SDF-1 (8) and CXCR4 (9, 10) have underscored their vital role during embryogenesis. Another noteworthy feature of CXCR4 (11) and CC chemokine receptors like CCR5 (12) is their role as coreceptors for infection by HIV. The NH2-terminal extracellular (EC) domain is a major determinant of receptor subtype specificity and binding to chemokine ligands (13, 14, 15, 16). Among HIV coreceptors like CXCR4 and CCR5, the EC domain mediates a crucial role during their tripartite interaction with HIV-encoded gp120 and its cellular receptor CD4 (11, 17). In this context, it is noteworthy that the first 20 NH2-terminal residues of CCR5 confer coreceptor function when placed into the CCR2b background (17). Abs against the NH2 terminus of human CXCR4 inhibit cell fusion and infection with HIV-1 (11).

The intron splice junction of murine CXCR4 gene has an in-frame alternative GT splice donor site within exon 1, causing expression of an isoform that is shorter by 2 aa in the NH2-terminal domain (18, 19). Both murine CXCR4 isoforms are coexpressed in all tissues examined and use SDF-1 as their functional ligand. The human CXCR4 gene also contains 2 exons of 103- and 1563-bp size (20, 21), interrupted by a 2132-bp intron precisely between codons 5 (AGT/Ser) and 6 (ATA/Ile) of the NH2-terminal domain (20). Although an alternative splice donor site (GT) similar to the murine CXCR4 gene exists 9 bp downstream from the last codon of the first exon in human CXCR4 (20), there is no molecular evidence it causes expression of multiple transcripts (21, 22).

In contrast, our initial observation of two distinct mRNA transcripts in HUVECs (7) strongly revealed the possible existence and expression of a unique human CXCR4 splice variant. In this report, we demonstrate that the human CXCR4 gene indeed has a larger unspliced form of the receptor, CXCR4-Lo, that differs with CXCR4 in the NH2-terminal region by 9 aa. We also show that CXCR4-Lo is functional and differentially expressed in human tissues.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Isolation of human CXCR4-Lo cDNA, RT-PCR, and Northern blot analysis

The CXCR4-Lo cDNA clone was identified from the SmithKline Beecham cDNA database by searching for expressed sequence tags (ESTs) with identity to human CXCR4 and analyzing their open reading frames (ORFs) for NH2-terminal sequence variants using the FASTA and BLAST algorithms of the GCG software package (Genetics Computer Group, Madison, WI). Total RNA was isolated from HL-60 cells by the Tri-reagent procedure (Molecular Research Center, Cincinnati, OH), and CXCR4-Lo specific cDNA was amplified with two sets of specific primers, Lo-346 and Lo-1071 (Lo-346, forward: 5'AGAGAGAGAACTAGTCTCGC, reverse: 5'AGAGGCAAAGGAATGGACAT; and Lo-1071, forward: 5'ATGTCCATTCCTTTGCCTCT, reverse: 5'AGCTGGAGTGAAAACTTGAAG) using the RNA-PCR kit from Perkin-Elmer (Foster City, CA), according to the manufacturer’s protocol. The 346-bp PCR product amplified with Lo-346 primers was used as a CXCR4-Lo-specific cDNA probe, while the 515-bp cDNA fragment of CXCR4 (7) was used as a common probe for both isoforms. Human tissue Northern blots were purchased from Clontech (Palo Alto, CA). The GAPDH probe (Clontech) was used to normalize the amount of total RNA loaded in all lanes. [{alpha}-32P]dCTP-labeled DNA probes were used for high-stringency hybridizations as described earlier (7). Northern blots were analyzed using phosphorimager densitometric scans (Molecular Devices, Menlo Park, CA).

Transfection of rat basophil leukemia (RBL)-2H3 cells

Full-length CXCR4 and CXCR4-Lo cDNAs were subcloned into pCRR3.1 (Invitrogen, San Diego, CA) eukaryotic expression vectors, and their orientation was confirmed by sequencing. The resultant expression constructs were transfected into RBL cells (American Type Culture Collection, Manassas, VA) by electroporation, and transfected cells were selected by using RPMI 1640 media containing 800 µg/ml G-418 (Life Technologies, Rockville, MD). CXCR4 and CXCR4-Lo specific mRNA expression was confirmed by Northern blot analysis. FACS analysis to compare surface expression of CXCR4 and CXCR4-Lo in transfected RBL cell lines was done with the CXCR4-specific 12G5 mAb as described before for endothelial cells (7).

Functional characterization of CXCR4-Lo in stably transfected RBL cells

Mobilization of [Ca2+]i in transfected RBL cells was measured by fluorometric imaging plate reader (FLIPR; Molecular Devices) analysis (23). Briefly, 6 x 104 cells were added per well of a 96-well plate and grown for 24 h. Cells were loaded with Fluo-3 AM dissolved in dye-loading buffer (Eagle’s minimum essential medium with 0.1% BSA and 15 mM sulpinpyrozone) for 60 min at 37°C. Following this, the dye-loading buffer was removed, and 100 µl hydrolysis buffer (15 mM sulfinpyrozone in Eagle’s minimum essential medium) was added to each well and incubated for 10 min at 37°C. Relative changes in fluorescence counts as a response to [Ca2+]i flux after addition of SDF-1{alpha} (R&D Systems, Minneapolis, MN) are expressed as FLIPR units.

SDF-1-induced migration of transfected RBL cells was done as described for HUVECs (7). Briefly, 5 x 105 cells in serum-free RPMI 1640 medium (with 0.25% BSA) were added in the top chamber of a 6.5-mm diameter, 5-µm pore poly carbonate transwell culture insert (Costar, Cambridge, MA). Incubation was conducted at 37°C in a 5% CO2 incubator for 18 h. Migrated cells in the lower chamber were counted with a ZM Coulter counter (Coulter Diagnostics, Hialeah, FL). Percent migration was calculated based on the total initial input of cells per well.


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
Molecular cloning and analysis of the novel un-spliced CXCR4-Lo variant cDNA

We previously demonstrated the expression of two distinct mRNAs, ~1.7-kb and ~4.0-kb transcripts for CXCR4 in HUVECs, and had speculated on the putative existence of an alternatively spliced isoform (7). Subsequently, we used bioinformatics to identify homologous ESTs with sequence variation in the NH2-terminal region of the EC domain of CXCR4. Two variant cDNA clones, designated as CXCR4-Lo, were isolated from a human neutrophil cDNA library and sequenced. Unlike CXCR4, the 1071-bp ORF of CXCR4-Lo cDNA clone is encoded by a single exon. The coding region is initiated from an alternate in-frame ATG start codon found within the intron sequence characterized in the recently published genomic structure for CXCR4 (20, 21) and 25-bp upstream of the known AG acceptor site used for intron splicing (Fig. 1Go, A and B). Significantly, the predicted full-length 357-aa CXCR4-Lo receptor (not shown, GenBank accession no. AF147204) contains a longer neo-NH2-terminal EC domain that is different from the corresponding CXCR4 sequence by the first 9 aa residues M-S-I-P-L-P-L-L-Q (Fig. 1Go, A and B), while the remaining sequence is identical. The 3' untranslated region of CXCR4-Lo (not shown) has an AATAAA polyadenylation consensus signal and is identical with the published genomic sequence of human CXCR4 (20).



View larger version (39K):
[in this window]
[in a new window]
  		FIGURE 1. Sequence of a novel CXCR4-Lo isoform and the proposed splicing mechanism of the human CXCR4 gene. A, Partial nucleotide sequence of the 5'-untranslated region and deduced amino acid sequence of the neo-NH2-terminal end of the full-length CXCR4-Lo cDNA clone. The unique 9-aa extension of the EC domain is shown in circles. The AG splice acceptor site used for splicing out the intron for CXCR4 (20 ) is boxed. The cDNA sequence distal to ATA codon (Ile) at position 370 is identical with CXCR4 cDNA. Nucleotide sequences of the Lo-346 primers used to amplify the 346-bp CXCR4-Lo-specific fragment are highlighted with directional arrows. B, Schematic representation of the origin of human CXCR4-Lo cDNA from CXCR4 gene. The splice donor (GT) and splice acceptor (AG) sites that flank the 2.13-kb intron of CXCR4 are encircled. In the proposed origin of CXCR4-Lo, the normal splicing does not occur and the intron is retained and expressed as part of the unspliced ~4.0 kb mRNA. The in-frame alternative ATG start codon within the "coding intron" used by the CXCR4-Lo variant is boxed and initiates the unique 9-aa extension to the NH2-terminal EC domain. C, RT-PCR of CXCR4-Lo ORF with isoform-specific primers (Lo-1071) from HL-60 cells and its hybridization with the specific 346-bp DNA probe. The reverse transcriptase reaction was initiated with either the oligo(dT) or the 3'-Lo-1071 primers. D, Multiple-tissue Northern blot hybridization with the CXCR4-Lo-specific 346-bp cDNA probe.

 
Although alternative splicing was recently demonstrated for murine CXCR4 (18, 19, 22), the human CXCR4-Lo we have discovered is structurally distinct and generated by a unique mechanism. In the case of murine CXCR4b (18, 19, 22), a different GT splice donor site is used to yield an isoform that is shorter by 2 aa, while the overall functional activity, genomic structure, and intron splicing mechanism are conserved (18, 22). In contrast, in human CXCR4-Lo, the known intron remains unspliced and the entire gene is expressed as a single exon to yield the longer 4.0-kb transcript (Fig. 1GoB). Other cases of retention and read through of "coding introns" have also been observed, most recently with the generation of a new CTL Ag from a tyrosinase-related protein mRNA (24).

To further test this hypothesis, and also address the question whether the two human CXCR4 isoforms are products of a single gene, RT-PCR primers (Lo-346 and Lo-1071) were designed to selectively amplify from the unique 5'-end of CXCR4-Lo transcripts from HL-60 cells. Hybridization of amplified cDNA with the CXCR4-Lo cDNA-specific 346-bp DNA probe revealed the expected specificity of the 1071-bp PCR product (Fig. 1GoC). In addition, Northern analysis with the 346-bp probe also confirmed expression of the ~4.0-kb CXCR4-Lo mRNA in PBLs and other tissues (Fig. 1GoD).

The qualitative comparison of CXCR4 and CXCR4-Lo mRNA expression in tissues was done using the common 515-bp cDNA probe (7). As noted previously (4, 5), CXCR4 is highly expressed in most human tissues upon Northern blot analysis (Fig. 2Go). While overall CXCR4-Lo expression is either proportionally lower or absent in all tissues (Fig. 2GoA), there is relatively more expression of its mRNA in spleen, lung, PBLs, and cancer cell lines like HL-60 and MOLT-4. Such selective differences in tissue-specific expression of the unspliced CXCR4-Lo isoform implies that its expression is regulated, rather than being caused by a random or passive absence of normal splicing. However, additional studies including the role of the "coding intron" in modulating transcription are desirable to assess the functional significance of CXCR4-Lo expression. Furthermore, although CXCR4 expression is low in whole brain (Fig. 2Go, A and B), especially high mRNA expression was observed in spinal cord, medulla, and frontal lobe, with moderate to low expression in putamen, temporal lobe, cerebellum, and cerebellar cortex. Significant, though lower, concomitant expression of the ~4.0-kb CXCR4-Lo mRNA was also observed in the spinal cord, medulla, substantia nigra, and subthalamic nucleus (Fig. 2GoB). The functional consequence of such an expression pattern of both CXCR4 and CXCR4-Lo in brain is not known, although it was recently shown that fetal cerebellar development is impaired in the CXCR4-knockout mice (10).



View larger version (64K):
[in this window]
[in a new window]
  		FIGURE 2. Tissue distribution of human CXCR4 and CXCR4-Lo by Northern blots using the common 515-bp cDNA probe. The ~1.7-kb and ~4.0-kb bands specific for CXCR4 and CXCR4-Lo mRNAs are indicated by arrows. A, Take note of the relatively high expression of both CXCR4 and CXCR4-Lo isoforms in PBL and various leukemia cell lines with the striking exception of K-562, which is devoid of CXCR4 expression. B, Northern blot analysis of CXCR4-Lo and CXCR4 expression in regions of the human brain.

 
Heterologous functional expression of CXCR4-Lo and comparison with CXCR4

Stably transfected RBL cell lines were generated from full-length ORFs of both CXCR4 and CXCR4-Lo, and their functional response to SDF-1{alpha}-mediated [Ca2+]i flux and chemotaxis was compared. Expression of CXCR4-Lo-specific mRNA in transfected RBL cell lines was confirmed by isoform-specific RT-PCR (with Lo-346 primers) and Northern blot analysis of total RNA (data not shown). Furthermore, as shown in Fig. 3GoA, FACS analysis revealed comparable levels of chemokine receptor surface expression on both CXCR4- and CXCR4-Lo-transfected RBL cell lines. Upon treatment with SDF-1{alpha}, there was a rapid [Ca2+]i flux in CXCR4-Lo-transfected RBL cells in a concentration-dependent manner (Fig. 3GoB). Similar results were obtained with SDF-1ß also (data not shown). Altogether, CXCR4-Lo was found to be less potent and efficacious (EC50 of ~20 nM) in its response to SDF-1, in comparison with CXCR4-transfected RBL cells (EC50 of ~6 nM) in the FLIPR [Ca+2]i assay (Fig. 3GoB). Similarly, the chemotactic response of CXCR4-Lo-transfected RBL cells, although significant, was also comparatively attenuated in the transwell migration assay (Fig. 3GoC).



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 3. Functional expression of CXCR4-Lo in stably transfected RBL cells. A, FACS analysis with the CXCR4-specific 12G5 mAb reveals similar levels of surface expression in CXCR4- and CXCR4-Lo-transfected RBL cell lines. B, SDF-1{alpha}-mediated [Ca2+]i flux was measured by FLIPR (n = 6). C, SDF-1{alpha} (n = 4) induced chemotaxis of RBL cells. RBL cells transfected with a control plasmid (E1A-neo, not shown) were used as negative control, while CXCR4-transfected RBL cells (inset) were used for comparison and as positive control in these functional assays.

 
Our results clearly demonstrate that the human CXCR4 gene is expressed in two alternate functional forms: the highly expressed known CXCR4, which is the primary receptor for SDF-1; and a longer, low abundance but functional CXCR4-Lo unspliced variant. In contrast to other chemokines (25), both CXCR4 and SDF-1 genes are remarkably conserved with >90% identity across diverse species (19). Such identity suggests a fundamental role for them during development, and it is noteworthy that the exceptional lethal phenotype caused by their genetic knockouts (8, 9, 10) is not similarly observed for other chemokines and chemokine receptors (26, 27, 28). Therefore, it is not surprising that in the unlikely event of failure in the splicing mechanism during embryogenesis, the critical requirement to conserve SDF-1 functions may be fulfilled by a backup functional receptor in the form of an unspliced CXCR4-Lo. Our data with CXCR4-Lo also shows that the NH2-terminal EC domain of CXCR4 is critical to elicit an efficacious biological response to SDF-1. This is in accordance with a multisite model for chemokine-chemokine receptor interaction (15) in which one or more subsites determine chemokine activation. Furthermore, CXCR4-Lo may also have significant independent role as an additional coreceptor for strains of HIV-1. If this is indeed true, further exploration on involvement of the CXCR4-Lo receptor in HIV pathogenesis becomes imperative.


   Acknowledgments
 
We thank Mary Brawner and James Fornwald for help with transfection in RBL cells and James Foley for FLIPR analysis. We also thank John White and Paul Lysko for critical discussion throughout this work.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. Shalley K. Gupta, Mail Code UW2511, Department of Cardiovascular Pharmacology, SmithKline Beecham Pharmaceuticals, King of Prussia, PA 19406. E-mail address: Back

2 Abbreviations used in this paper: SDF-1, stromal cell-derived factor-1; EC, extracellular; EST, expressed sequence tag; FLIPR, fluorometric imaging plate reader; ORF, open reading frame; RBL, rat basophil leukemia cells; [Ca2+]i, intracellular Ca2+ concentration. Back

Received for publication March 17, 1999. Accepted for publication July 6, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. Tashiro, K., H. Tada, R. Heilker, M. Shirozu, T. Nakano, T. Honjo. 1993. Signal sequence trap: a cloning strategy for secreted proteins and type I membrane proteins. Science 261:600.[Abstract/Free Full Text]
  2. Oberlin, E., A. Amara, F. Bachelerie, C. Bessia, J.-L. Virelizier, F. Arenzana-Seisdedos, O. Schwartz, J.-L. Heard, I. Clark-Lewis, D. F. Legler, M. Loetscher, M. Baggiolini, B. Moser. 1996. The CXC chemokine SDF-1 is the ligand for LESTR/fusin and prevents infection by T-cell-line-adapted HIV-1. Nature 382:833.[Medline]
  3. Shirozu, M., T. Nakano, J. Inazawa, K. Tashiro, H. Tada, T. Shinohara, T. Honjo. 1995. Structure and chromosomal localization of the human stromal cell-derived factor 1 (SDF1) gene. Genomics 28:495.[Medline]
  4. Rimland, J., W. Xin, P. Sweetnam, K. Saijoh, E. J. Nestler, R. S. Duman. 1991. Sequence and expression of a neuropeptide Y receptor cDNA. Mol. Pharmacol. 40:869.[Abstract]
  5. Federsppiel, B., I. G. Melhado, A. M. V. Duncan, A. Delaney, K. Schappert, I. Clark-Lewis, F. R. Jirik. 1993. Molecular cloning of the cDNA and chromosomal localization of the gene for a putative seven-transmembrane segment (7-TMS) receptor isolated from human spleen. Genomics 16:707.[Medline]
  6. Bleul, C. C., R. C. Fuhlbrigge, J. M. Casanovas, A. Aiuti, T. A. Springer. 1996. A highly efficacious lymphocyte chemoattractant, stromal cell-derived factor 1 (SDF-1). J. Exp. Med. 184:1101.[Abstract/Free Full Text]
  7. Gupta, S. K., P. G. Lysko, K. Pillarisetti, E. Ohlstein, J. M. Stadel. 1998. Chemokine receptors in human endothelial cells: functional expression of CXCR4 and its transcriptional regulation by inflammatory cytokines. J. Biol. Chem. 273:4282.[Abstract/Free Full Text]
  8. Nagasawa, T., S. Hirota, K. Tachibana, N. Takakura, S. Nishikawa, Y. Kitamura, N. Yoshida, H. Kikutani, T. Kishimoto. 1996. Defects of B-cell lymphopoiesis and bone-marrow myelopoiesis in mice lacking the CXC chemokine PBSF/SDF-1. Nature 382:635.[Medline]
  9. Tachibana, K., S. Hirota, H. Iizasa, H. Yoshida, K. Kawabata, Y. Kataoka, Y. Kitamura, K. Matsushima, N. Yoshida, S. Nishikawa, T. Kishimoto, T. Nagasawa. 1998. The chemokine receptor CXCR4 is essential for vascularization of the gastrointestinal tract. Nature 393:591.[Medline]
  10. Zou, Y.-R., A. H. Kottman, M. Kuroda, I. Taniuchi, D. R. Littman. 1998. Function of the chemokine receptor CXCR4 in haematopoiesis and in cerebellar development. Nature 393:595.[Medline]
  11. Feng, Y., C. C. Broder, P. E. Kennedy, E. A. Berger. 1996. HIV-1 entry cofactor: functional cDNA cloning of a seven-transmembrane, G protein-coupled receptor. Science 272:872.[Abstract]
  12. Alkhatib, G., C. Comadiere, C. C. Broder, Y. Feng, P. E. Kennedy, P. M. Murphy, E.A. Berger. 1996. CC CKR5: a RANTES, MIP-1{alpha}, MIP-1ß receptor as a fusion cofactor for macrophage-tropic HIV-1. Science 272:1955.[Abstract]
  13. LaRosa, G. J., K. M. Thomas, M. E. Kaufmann, R. Mark, M. White, L. Taylor, G. Gray, D. Witt, J. Navarro. 1992. Amino terminus of the interleukin-8 receptor is a major determinant of receptor subtype specificity. J. Biol. Chem. 267:25402.[Abstract/Free Full Text]
  14. Hebert, C., A. Chuntharapai, M. Smith, T. Colby, J. Kim, R. Horuk. 1993. Partial functional mapping of the human interleukin-8 type A receptor: identification of a major ligand binding domain. J. Biol. Chem. 268:18549.[Abstract/Free Full Text]
  15. Monteclaro, F. S., I. F. Charo. 1996. The amino-terminal extracellular domain of the MCP-1 receptor, but not the RANTES/MIP-1 alpha receptor, confers chemokine selectivity: evidence for a two-step mechanism for MCP-1 receptor activation. J. Biol. Chem. 271:19084.[Abstract/Free Full Text]
  16. Pease, J. E., J. Wang, P. D. Ponath, P. M. Murphy. 1998. The N-terminal extracellular segments of the chemokine receptors CCR1 and CCR3 are determinants for MIP-1{alpha} and eotaxin binding, respectively, but a second domain is essential for efficient receptor activation. J. Biol. Chem. 273:19972.[Abstract/Free Full Text]
  17. Ruckers, J., M. Samson, B. J. Doranz, F. Libert, J. F. Berson, C. C. Broder, G. Vassart, R. W. Doms, M. Parmentier. 1996. Regions in ß-chemokine receptors CCR5 and CCR2b that determine HIV-1 cofactor specificity. Cell 87:437.[Medline]
  18. Heesen, M., M. A. Berman, U. E. Hopken, N. P. Gerard, M. E. Dorf. 1997. Alternate splicing of mouse fusin/CXC chemokine receptor-4: stromal cell-derived factor-1{alpha} is a ligand for both CXC chemokine receptor-4 isoforms. J. Immunol. 158:3561.[Abstract]
  19. Moepps, B., R. Frodl, H. Rodewald, M. Baggiolini, P. Gierschik. 1997. Two murine homologues of the human chemokine receptor CXCR4 mediating stromal cell-derived factor 1{alpha} activation of Gi2 are differentially expressed in vivo. Eur. J. Immunol. 27:2102.[Medline]
  20. Wegner, S.A., P. K. Ehrenberg, G. Chang, D. E. Dayhoff, A. L. Sleeker, N. L. Michael. 1998. Genomic organization and functional characterization of the chemokine receptor CXCR4, a major entry co-receptor for human immunodeficiency virus type 1. J. Biol. Chem. 273:4754.[Abstract/Free Full Text]
  21. Caruz, A., M. Samsom, J. M. Alonso, J. Alcami, F. Baleux, J. L. Virelizier, M. Parmentier, F. Arenzana-Seisdedos. 1998. Genomic organization and promoter characterization of human CXCR4 gene. FEBS Lett. 426:271.[Medline]
  22. Frodl. R., P., P. Gierschik, B. Moepps. 1998. Genomic organization and expression of the CXCR4 gene in mouse and man: absence of a splice variant corresponding to mouse CXCR4-b in human tissues. J. Recept. Signal Transduct. Res. 18:321.[Medline]
  23. Dooley, D. J., J. J. Geer, S. J. Haleen, A.W. Probert, K. M. Welch. 1998. Assessment of endothelin receptor subtype-mediated increases of [Ca2+]i in distinct rat cell types using fluorimetric imaging. J. Cardiovasc. Pharmacol. 31:(Suppl. 1):S192.
  24. Lupetti, R., P. Pisarra, A. Verrecchia, C. Farina, G. Nicolini, A. Anichini, C. Bordignon, M. Sensi, G. Parmiani, C. Travesari. 1998. Translation of a retained intron in tyrosinase-related protein (TRP) 2 mRNA generates a new cytotoxic T lymphocyte (CTL)-defined and shared human melanoma antigen not expressed in normal cells of the melanocytic lineage. J. Exp. Med. 188:1005.[Abstract/Free Full Text]
  25. Crump, P. M., J.-H. Gong, P. Loetscher, K. Rajarathanam, A. Amara, F. Arenzana-Seisdedos, J.-L. Virelizier, M. Baggiolini, B. D. Sykes, I. Clark- Lewis. 1997. Solution structure and basis for functional activity of stromal cell-derived factor-1: dissociation of CXCR4 activation from binding and inhibition of HIV-1. EMBO J. 16:6996.[Medline]
  26. Cacalano, G., J. Lee, K. Kikly, A. M. Ryan, S. Pitts-Meek, B. Hultgren, W. I. Wood, M. W. Moore. 1994. Neutrophil and B cell expansion in mice that lack the murine IL-8 receptor homolog. Science 265:682.[Abstract/Free Full Text]
  27. Rothenberg, M. E., J. A. MacLean, E. Pearlman, A. D. Luster, L. Philip. 1997. Targeted disruption of the chemokine eotaxin partially reduces antigen-induced tissue eosinophilia. J. Exp. Med. 185:785.[Abstract/Free Full Text]
  28. Boring, L., J. Gosling, M. Cleary, I. F. Charo. 1998. Decreased lesion formation in CCR2-/- mice reveals a role for chemokines in the initiation of atherosclerosis. Nature 394:894.[Medline]



This article has been cited by other articles:


Home page
 J. Biol. Chem.Home page
J. Wang, Y. Shiozawa, J. Wang, Y. Wang, Y. Jung, K. J. Pienta, R. Mehra, R. Loberg, and R. S. Taichman
The Role of CXCR7/RDC1 as a Chemokine Receptor for CXCL12/SDF-1 in Prostate Cancer
J. Biol. Chem., February 15, 2008; 283(7): 4283 - 4294.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. Kortesidis, A. Zannettino, S. Isenmann, S. Shi, T. Lapidot, and S. Gronthos
Stromal-derived factor-1 promotes the growth, survival, and development of human bone marrow stromal stem cells
Blood, May 15, 2005; 105(10): 3793 - 3801.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. E. Ehlert, C. A. Addison, M. D. Burdick, S. L. Kunkel, and R. M. Strieter
Identification and Partial Characterization of a Variant of Human CXCR3 Generated by Posttranscriptional Exon Skipping
J. Immunol., November 15, 2004; 173(10): 6234 - 6240.
[Abstract] [Full Text] [PDF]

Home page
 Molecular Cancer TherapeuticsHome page
Y. S. Haviv, W. J. van Houdt, B. Lu, D. T. Curiel, and Z. B. Zhu
Transcriptional targeting in renal cancer cell lines via the human CXCR4 promoter
Mol. Cancer Ther., June 1, 2004; 3(6): 687 - 691.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. Garin, N. Tarantino, S. Faure, M. Daoudi, C. Lecureuil, A. Bourdais, P. Debre, P. Deterre, and C. Combadiere
Two Novel Fully Functional Isoforms of CX3CR1 Are Potent HIV Coreceptors
J. Immunol., November 15, 2003; 171(10): 5305 - 5312.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
A. D. Cristillo, M. J. Macri, and B. E. Bierer
Differential chemokine expression profiles in human peripheral blood T lymphocytes: dependence on T-cell coreceptor and calcineurin signaling
Blood, January 1, 2003; 101(1): 216 - 225.
[Abstract] [Full Text] [PDF]

Home page
 FASEB J.Home page
A. D. CRISTILLO, H. C. HIGHBARGER, R. L. DEWAR, D. S. DIMITROV, H. GOLDING, and B. E. BIERER
Up-regulation of HIV coreceptor CXCR4 expression in human T lymphocytes is mediated in part by a cAMP-responsive element
FASEB J, March 1, 2002; 16(3): 354 - 364.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
R. S. Taichman, C. Cooper, E. T. Keller, K. J. Pienta, N. S. Taichman, and L. K. McCauley
Use of the Stromal Cell-derived Factor-1/CXCR4 Pathway in Prostate Cancer Metastasis to Bone
Cancer Res., March 1, 2002; 62(6): 1832 - 1837.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
F. Vinante, A. Rigo, M. T. Scupoli, and G. Pizzolo
CD30 triggering by agonistic antibodies regulates CXCR4 expression and CXCL12 chemotactic activity in the cell line L540
Blood, January 1, 2002; 99(1): 52 - 60.
[Abstract] [Full Text] [PDF]

Home page
 Pharmacol. Rev.Home page
P. M. Murphy, M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller, J. J. Oppenheim, and C. A. Power
International Union of Pharmacology. XXII. Nomenclature for Chemokine Receptors
Pharmacol. Rev., March 1, 2000; 52(1): 145 - 176.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
C.-R. Yu, K. W. C. Peden, M. B. Zaitseva, H. Golding, and J. M. Farber
CCR9A and CCR9B: Two Receptors for the Chemokine CCL25/TECK/Ck{beta}-15 That Differ in Their Sensitivities to Ligand
J. Immunol., February 1, 2000; 164(3): 1293 - 1305.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Y. Sotsios, G. C. Whittaker, J. Westwick, and S. G. Ward
The CXC Chemokine Stromal Cell-Derived Factor Activates a Gi-Coupled Phosphoinositide 3-Kinase in T Lymphocytes
J. Immunol., December 1, 1999; 163(11): 5954 - 5963.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Brelot, N. Heveker, M. Montes, and M. Alizon
Identification of Residues of CXCR4 Critical for Human Immunodeficiency Virus Coreceptor and Chemokine Receptor Activities
J. Biol. Chem., July 28, 2000; 275(31): 23736 - 23744.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gupta, S. K.
Right arrow Articles by Pillarisetti, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gupta, S. K.
Right arrow Articles by Pillarisetti, K.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS