The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burger, M.
Right arrow Articles by Schraufstatter, I. U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burger, M.
Right arrow Articles by Schraufstatter, I. U.
The Journal of Immunology, 1999, 163: 2017-2022.
Copyright © 1999 by The American Association of Immunologists

Point Mutation Causing Constitutive Signaling of CXCR2 Leads to Transforming Activity Similar to Kaposi’s Sarcoma Herpesvirus-G Protein-Coupled Receptor1

Meike Burger2,*, Jan A. Burger{dagger}, Robert C. Hoch*, Zenaida Oades*, Hiroshi Takamori* and Ingrid U. Schraufstatter{ddagger}

* Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037; {dagger} Department of Medicine, University of California, San Diego, CA 92093; and {ddagger} La Jolla Institute of Experimental Medicine, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The chemokine receptor CXCR2 is the closest homologue to Kaposi’s sarcoma herpesvirus-G protein-coupled receptor (KSHV-GPCR), which is known to be constitutively activated and able to cause oncogenic transformation. Among G protein-coupled receptors, a DRY sequence in the second intracellular loop is highly conserved. However, the KSHV-GPCR shows a VRY sequence instead. In this study, we exchanged Asp138 of the DRY sequence in the CXCR2 with a Val (D138V), the corresponding amino acid in KSHV-GPCR, or with a Gln (D138Q), and investigated the functional consequences of these mutations. In focus formation and soft agar growth assays in NIH 3T3 cells, the D138V mutant exhibited transforming potential similar to the KSHV-GPCR. Surprisingly, the CXCR2 wild type itself showed transforming activity, although not as potently, due to continuous autocrine stimulation, whereas the D138Q mutant formed no foci. In agreement with these results were high levels of inositol phosphate accumulation in the D138V mutant and the KSHV-GPCR, indicating constitutive activity. These data emphasize the importance of the DRY sequence for G protein-coupled signaling of the CXCR2. Either constitutive activation or persistent autocrine stimulation of the CXCR2 causes transformation similar to KSHV-GPCR-transfected cells, probably activating the same signal transduction cascade that can abrogate normal growth control mechanisms.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The human CXCR2 and Kaposi’s sarcoma herpesvirus-G protein-coupled receptor (KSHV-GPCR)3 are both members of the same rhodopsin/ß-adrenergic subfamily of seven-transmembrane-spanning receptors. These receptors share characteristic structural features that presumably reflect their common mechanism of action (1).

The KSHV-GPCR is the product of open reading frame 74 of the human Herpesvirus 8. It has been speculated that the KSHV-GPCR has been pirated from CXCR2 or CXCR1 (2), its closest homologues.

The KSHV-GPCR exhibits constitutive signaling via activation of phosphoinositide-specific phospholipase (3) in the absence of ligand, although it can bind IL-8 and other chemokines. The CXCR2 activates the same signal transduction cascade, when it binds its ligands that include IL-8, GRO-{alpha}, and NAP-2, but does not exhibit constitutive signaling.

The KSHV-GPCR appears to be involved in the pathogenesis of Kaposi’s sarcoma (4) and primary effusion lymphomas (5). Expression of this receptor stimulates proliferation in rat fibroblasts (3) and causes transformation in NIH 3T3 cells and tumors, when transfected cells are injected into nude mice (6). This transforming activity of the receptor is thought to be a result of its constitutive activation.

The DRY sequence at the junction of the third transmembrane domain to the second intracellular loop of the CXCR2 is a highly conserved motif among G protein-coupled receptors. However, the KSHV-GPCR shows a VRY motif in this position.

It has been shown for other GPCRs, e.g., the {alpha}1b-adrenergic (7, 8), the ß2-adrenergic receptor (9), and the AT1A angiotensin II receptor (10), that mutations in the second and third intracellular loop result in increased agonist-independent receptor activity and confer sometimes oncogenic properties to the receptor (11). In addition, mutations inducing constitutive activation of GPCRs have been described and found to be associated with human diseases (12, 13).

This prompted us to compare the activity and function of the KSHV-GPCR and the CXCR2, and to introduce mutations into the highly conserved DRY sequence of CXCR2.

In this study, we report that the replacement of Asp138 by Val in the second intracellular loop of the CXCR2 constitutively activates the receptor and causes transformation in transfected NIH 3T3 cells comparable with results seen with the KSHV-GPCR. Furthermore, we show for the first time that the CXCR2 wild type itself is able to transform transfected NIH 3T3 cells due to autocrine stimulation by mouse KC, the mouse equivalent of GRO-{alpha}, which binds to the CXCR2 and is produced by mouse fibroblast NIH 3T3 cells. These data provide support for a role of the CXCR2 in cell proliferation and tumorigenesis.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
DNA constructs, transfection, and cell culture

DNA constructs. The CXCR1 and CXCR2 receptor constructs have been described (14). The KSHV-GPCR was amplified by RT-PCR from BCBL-1 lymphoma cell RNA (obtained from Dr. Jaques Corbeil, University of California, San Diego) using the 5' oligo GAGAATTCAGGCCATGGCGGCCGAGG and the 3' oligo GAGAATTCACGTGGTGGCGCCGGACA and cloned into the EcoRI site of pSFFV.neo (15). D138V and D138Q are point mutations of the CXCR2 in which Asp138 (GTA) is replaced by Val (GCA) or Gln (GAA). Point mutations were introduced by two rounds of PCR amplification. The correctness of the constructs was verified by automated DNA sequencing. The sequences are shown in a schematic form in Fig. 1Go.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. Two-dimensional scheme of the CXCR2. The highly conserved DRY motif is highlighted; the specific sequences and mutations are indicated below.

 
NIH 3T3 mouse fibroblasts were grown in DMEM containing 10% FCS and transfected with CXCR1, CXCR2, KSHV-GPCR, or mutant receptor constructs by the calcium phosphate precipitation technique (16), followed by a 3-min glycerol shock after 5 h. Stable cell lines were selected with 600 µg/ml of G418.

RBL2H3 rat basophilic leukemia cells were grown in RPMI 1640 containing 10% FCS and transfected with the same DNA constructs using lipofectamine, as described (14). Stable cell lines were selected with 300 µg/ml G418.

Mouse KC in the culture supernatants was quantified using an ELISA kit from R&D Systems (Minneapolis, MN).

Analysis of receptor expression

Receptor expression was verified by FACS analysis using polyclonal rabbit Abs raised against a fusion protein of the first 44 amino acids of the receptors with GST, as described (17). Binding of 125I-labeled IL-8 was determined as previously described (14).

Focus formation

NIH 3T3 cells were transfected with the receptor constructs (1 µg plasmid DNA per 60-mm dish) in quadruplicates, and cell foci were counted after 18–21 days. In addition, 200 stably transfected cells were seeded on a layer of 2 x 105 untransfected NIH 3T3 cells, as described (18), and cell foci were counted after 2 wk.

Anchorage-independent growth

A total of 4 x 104 stably transfected NIH 3T3 cells was mixed in an equal amount of DMEM containing 10% FCS and 0.3% melted soft agar in medium and poured onto a bottom layer of 0.6% soft agar. Cells were fed every 3 days with three drops of media, and cell colonies formed were photographed after 2–3 wk.

Accumulation of inositol phosphates

Subconfluent NIH 3T3 cells were labeled for 48 h in 12-well plates in inositol-free DMEM (Life Technologies, Grand Island, NY) containing 1 µCi/ml [3H]myoinositol (Amersham, Arlington Heights, IL). Cells were washed in DMEM containing 10 mM LiCl and 1 mM CaCl2 and incubated for 10 min at room temperature, followed by 20 min at 37°C. Inositol phosphates were extracted with 10% perchloric acid, followed by neutralization with KOH/Tris. [3H]inositol phosphates were separated by anion-exchange chromatography on AG 1-X8 formate resin (Bio-Rad, Vista, CA), as described by Berridge (19). Inositol phosphate accumulation was expressed as the percentage of 3H label in inositol phosphates per µg of protein in the cell precipitates.

Pertussis toxin (100 ng/ml) was added for 16 h before inositol phosphate extraction. Anti-CXCR2 and anti-mouse KC Abs (R&D Systems) were added together with the [3H]myoinositol for 48 h.

Ca2+ mobilization and actin polymerization

RBL2H3 cells stably transfected with the different receptor constructs were labeled with Indo-1AM (Molecular Probes, Eugene, OR), and Ca2+ flux was measured on an SLM 8000 fluorometer (Spectronic Instruments, Rochester, NY), as previously described (14).

Actin polymerization in RBL2H3 cells was measured as described earlier (20). All results are plotted relative to the mean fluorescence of the sample before addition of the chemokine.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Focus formation and growth in soft agar

The consequences of expression of CXCR2, CXCR1, mutant receptors, and KSHV-GPCR on cell growth were investigated in NIH 3T3 cells. Focus formation in these cells represents a morphologic manifestation of transformation associated with the loss of contact inhibition that limits the cell density of these cells.

The focus formation assay was performed in two different ways by plating 200 stably transfected NIH 3T3 cells on a layer of untransfected cells or by transient transfection (Figs. 2Go and 3).



View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 2. Focus formation assay. Two hundred NIH 3T3 cells, stably transfected with the different receptors or mutants as indicated in the figure, were seeded on a layer of 2 x 105 untransfected NIH 3T3. Foci were counted and photographed after 2 wk. Untransfected cells (NIH 3T3) and cells transfected with the vector only (pSFFV.neo) served as negative controls.

 
Focus formation by cells expressing the KSHV-GPCR served as the positive control. As expected, the KSHV-GPCR caused high numbers of focus formation, which confirms the results described earlier (6).

Surprisingly, cells transfected with the wild-type CXCR2 also formed foci, although to a lesser extent, which were observed with both methods and not seen with untransfected NIH 3T3 fibroblasts, those transfected with the pSFFV.neo vector only, or with the CXCR1 (Figs. 2Go and 3Go). Cells within foci caused by the CXCR2 manifested the malignant phenotype with a loss of density-dependent growth inhibition, resulting in increased cellular packing and piling up of cells. This oncogene-like ability of the CXCR2 to induce transformation is presumably due to continuous autocrine stimulation of the receptor by mouse KC, the mouse equivalent of GRO-{alpha}, produced by NIH 3T3 cells. Overnight cultures of NIH 3T3 cells contained between 12–20 ng/ml of mouse KC, which is a sufficient concentration to activate the human CXCR2 (21).



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 3. Total numbers of focus formation assessed by two different methods: A, 200 cells derived from a clone of G418-selected NIH 3T3 cells expressing the different receptor constructs were plated together with 2 x 105 untransfected NIH 3T3 cells, or B, NIH 3T3 cells were directly transfected with 1 µg of each plasmid DNA. The number of foci formed by cells transfected with CXCR2, KSHV-GPCR, and the D138V mutant are significantly higher than untransfected cells or those transfected with CXCR1 or the D138Q mutant.

 
The mutant receptor D138V, in which the Asp of the DRY sequence in the second intracellular loop of the CXCR2 was exchanged for the corresponding hydrophobic Val in the KSHV-GPCR, caused almost as many foci as the KSHV-GPCR. In contrast, the CXCR2 mutant D138Q, in which the same Asp was replaced by the hydrophilic Gln, induced a complete loss of the transforming potential of the CXCR2. These results emphasize the importance of the highly conserved DRY sequence for G protein coupling in CXCR2. In contrast, the same point mutation, corresponding to the D138V in CXCR2, that exchanges the Asp for a Val in the CXCR1 (D134V-CXCR1) or continuous stimulation of the CXCR1 with IL-8, did not result in focus formation (Fig. 2Go).

FACS analysis indicated that surface expression of the CXCR1, CXCR2, and the D138V and D138Q mutants was similar, even a little higher for the D138Q mutant (data not shown), so that differences in the level of expression could not explain the varying behavior of these receptors.

The transforming potential of the CXCR2, mutant receptors, and the KSHV-GPCR was paralleled by their ability to form colonies in soft agar. Cells transfected with the CXCR2, the D138V mutant, or the KSHV-GPCR all formed colonies after 2–3 wk in culture (Fig. 4Go). Colonies of CXCR2-transfected cells tended to stay smaller than those of cells transfected with the KSHV-GPCR or the D138V mutant, but clearly grew in an anchorage-independent fashion, usually associated with the potential to metastasize (22). Untransfected cells or those transfected with the D138Q mutant or the CXCR1 failed to grow in soft agar (Fig. 4Go).



View larger version (80K):
[in this window]
[in a new window]
 
FIGURE 4. Cell proliferation in soft agar. Transfected NIH 3T3 cells were seeded and grown in 0.3% agar containing medium on a bottom layer of 0.6% agar. After 2–3 wk, cell colonies were photographed. A, Untransfected NIH 3T3 cells; B, CXCR2; C, KSHV-GPCR; D, CXCR1; E, D138V; F, D138Q.

 
Inositol phosphate accumulation

Activation of phospholipase C is a major pathway that links G protein-coupled receptor activation to cell proliferation (3, 23). To evaluate G protein-coupled signaling through this pathway, we measured inositol phosphate accumulation in NIH 3T3 cells stably transfected with the various receptors and the mutants.

In agreement with previous reports (3), NIH 3T3 cells transfected with the KSHV-GPCR accumulated 3.5 times the amount of inositol phosphates observed in untransfected control cells. This increase could not be blocked by pertussis toxin treatment of these cells, which only caused small, nonspecific inhibition of inositol phosphate accumulation that was seen in all cells treated with pertussis toxin (Fig. 5Go). It also could not be blocked by Abs against the CXCR2 or against mouse KC (Fig. 5Go).



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 5. Inositol phoshate accumulation in NIH 3T3 cells and inhibition by pertussis toxin, anti-CXCR2, and anti-mouse KC Abs. Results are normalized to untransfected cells (= 100%). Data of baseline inositol phosphate accumulation of the different receptors and mutants are means of six to nine experiments. SDs of triplicate experiments on the same day were less than 5%. The inositol phosphate accumulation in cells transfected with CXCR2, KSHV-GPCR, and the D138V mutant is significantly higher than in untransfected cells or those transfected with CXCR1 or the D138Q mutant. Addition of anti-CXCR2, anti-mouse-KC Abs, or pertussis toxin treatment led to significantly lower inositol phosphate accumulation in CXCR2-transfected cells compared with KSHV-GPCR- or D138V-transfected cells.

 
Cells transfected with the CXCR2 showed a 2.9-fold higher accumulation of inositol phosphates than untransfected NIH 3T3 cells (Fig. 5Go). No further increase in inositol phosphate formation was seen, when 10-7 M IL-8 was added. Stimulation of this pathway in CXCR2-transfected cells seemed to be mediated by mouse KC, since either Abs to mouse KC or to the CXCR2 inhibited inositol phosphate accumulation (Fig. 5Go). Pertussis toxin, which inactivates Gi largely, but not completely, blocked inositolphosphate formation (Fig. 5Go).

In contrast, accumulation of inositol phosphates in cells transfected with the CXCR2 mutant D138V (3.1-fold higher than found in untransfected NIH 3T3 cells) could not be blocked by either of the Abs, and pertussis toxin blocked inositol phosphate accumulation in these cells only to a small degree (Fig. 5Go). Together these results suggest that this mutant receptor signals in an agonist-independent fashion similar to the KSHV-GPCR.

The CXCR2 mutant D138Q, in which the same Asp was replaced with Gln, showed only a small increase of inositol phosphate turnover over untransfected NIH 3T3 cells (Fig. 5Go), which is consistent with the low potential of this mutant to form foci. A similar behavior was seen in cells transfected with the CXCR1.

Ca2+ mobilization and actin polymerization in RBL2H3 cells

The same receptor constructs were transfected into RBL2H3 cells, and calcium mobilization and actin polymerization were determined.

As shown in Figs. 6Go and 7, CXCR2- and CXCR1-transfected cells showed a high level of actin polymerization and calcium mobilization upon stimulation with IL-8. At high concentrations, the CXCR2 mutant D138Q responded almost as well as the CXCR2, but the mutant showed a much lower affinity. Approximately 20-fold higher concentrations of ligand were necessary for a response equal to that seen with the wild-type receptor. These functional results were confirmed by 125I-labeled IL-8 binding studies that showed a Kd of 1.2 x 10-9 M for the CXCR2 and a Kd greater than 2 x 10-8 M for the D138Q mutant. The affinity of GPCRs not coupled to G proteins generally drops by 1–2 orders of magnitude. All of these results are consistent with poor G protein coupling of the D138Q mutant.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. Actin polymerization in transfected RBL2H3 cells. Cells were stained and fixed with phalloidin-Formalin at the indicated time points after stimulation with 200 nM human IL-8. Results are means of three experiments ± SEM. Actin polymerization is significantly higher in CXCR2-, CXCR1-, and D138Q-transfected cells compared with untransfected, KSHV-GPCR-, or D138V-transfected cells.

 
In CXCR2-transfected cells, the Ca2+ mobilization was transient and Ca2+ concentrations quickly fell back to almost background levels, whereas Ca2+ remained elevated over a prolonged time in D138Q-transfected cells. Ca2+ mobilization and actin polymerization could be completely blocked by pertussis toxin in CXCR1, CXCR2, and D138Q (data not shown).

In both assays, the KSHV-GPCR and the mutant D138V showed only a small response to IL-8 stimulation, consistent with the idea that these receptors exhibit constitutive activity independent of ligand. In accordance with the report of Gershengorn et al. (2), the KSHV-GPCR as well as D138V can be activated by IL-8 over constitutive levels, which could mean that additional stimulation might even enhance the functional activities of these receptors.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Our studies demonstrate the potential of the CXCR2 and its ligands to activate signal transduction pathways that can abrogate normal growth control mechanisms.

It has been demonstrated for several receptors that discrete mutation can cause dramatic increases in agonist-independent receptor activity (24). It was therefore proposed that important conformational constraints maintain the receptor preferentially in an inactive conformation and that these constraints are released upon activation, causing key sequences to be exposed to the G protein (25). Single point mutations seem to be able to change the receptor conformation leading to constitutive activation, thereby mimicking the active state of the wild-type receptor.

Constitutive signaling, as shown by some native GPCRs (26), occurs more commonly with mutated GPCRs (24, 27) in several human diseases and in tumors (28, 29). The KSHV-GPCR has been recently described as a naturally occurring receptor exhibiting constitutive signaling, which is thought to play a role in the pathogenesis of Kaposi’s sarcoma. It has been speculated that the KSHV pirated the gene encoding for the KSHV-GPCR from CXCR2 or CXCR1, its closest homologues, and retaining similarities to these receptors.

Our study points out the importance of the DRY sequence in CXCR2 for regulated signaling function and the significance of the mutation to a VRY motif, the respective sequence in the KSHV-GPCR, which makes the CXCR2 functionally similar to the KSHV-GPCR. The DRY sequence at the junction between the third transmembrane domain and the second intracellular loop is shared by almost all GPCRs, including the chemokine receptors. The importance of this sequence for G protein coupling has been shown for the CCR5 (30). The surrounding amino acids are also highly conserved among chemokine receptors and necessary for proper signal transduction (31). Sequence homology between the CXCRs and the KSHV-GPCR is higher in this region than in any other area outside of the transmembrane domains.

The second intracellular loops of both the CXCR2 and the KSHV-GPCR contain the basic amino acids at both the NH2- and COOH-terminal ends that are necessary for interaction with Gi proteins (32, 33).

Replacement of the Asp in the DRY sequence by the bulky hydrophobic Val in this location, as seen in the KSHV-GPCR and in our D138V mutant, presumably pulls this region into the plasma membrane. The more conservative D138Q mutant would not be expected to have this effect. It has been proposed that the {alpha}-helical structure of the third transmembrane domain of GPCRs continues on into the second intracellular loop. Hydrophobic residues of the second intracellular loop are thought to interact with {alpha}-helical structures of the third intracellular loop, while amino acids in the second intracellular loop that face away from the third intracellular loop are considered important to keep the receptor in an active state in the absence of ligand (34). Our results are consistent with this hypothesis.

In contrast, continuous stimulation of the CXCR1 with human IL-8 or introducing the point mutation that exchanges the Asp for a Val into the CXCR1 receptor (D134V-CXCR1) did not result in transforming capacity (Fig. 2Go), although both the CXCR1 and the mutant receptor were expressed as assessed by FACS (data not shown). Hence, the similarity in the signaling of the CXCR2 mutant D138V and the KSHV-GPCR supports the hypothesis that the gene of the KSHV-GPCR has been pirated from the CXCR2. In addition, it emphasizes the transforming potential of the CXCR2, which seems to be exhibited only by the CXCR2 and not by the CXCR1. Being continuously stimulated or constitutively activated due to a single amino acid change in the receptor, the CXCR2 seems to activate normal cellular genes with latent transforming potential and subvert regulatory key pathways controlling cell proliferation. There have not been any reports about the transforming potential of the CXCR2 to date, although Norgauer et al. (35) showed that the CXCR2 exhibits a growth-promoting function in melanoma cells that could be blocked by Abs against the CXCR2.

It also has been shown for other G protein-coupled receptors that persistent activation can transform cells (18) and act as oncogenes in human cancers (29). These pathways are complex (23) and not understood in detail. Increased inositol phosphate turnover seems to play a role, and indeed occurred in all focus-forming mutants we analyzed.

Leukocytes and leukocytic cell lines such as RBL2H3 cells express such a high level of Gi{alpha}2 that the signal transduction cascade in these cells following stimulation with IL-8 is dominated by the activation of Gi{alpha} (36). The CXCR2 can, however, also couple to G{alpha}14 and G{alpha}16 (37), and possibly additional G proteins. Pertussis toxin largely, but not completely, blocked inositol phosphate accumulation in NIH 3T3 cells expressing the CXCR2, while it abrogated functions induced by IL-8 in RBL2H3 cells expressing the same receptor. Indeed, actin polymerization, which was blocked completely by incubation with pertussis toxin in RBL2H3 cells, was not affected by this Gi and Go protein-specific inhibitor in NIH 3T3 cells (Schraufstatter et al., unpublished observation). Another G protein, possibly G{alpha}12 or G{alpha}13, must mediate this response in NIH 3T3 cells. G{alpha}12 has recently been described to be involved in cellular transformation caused by m1 muscarinic acethylcholine receptors in NIH 3T3 cells (38). The relative contribution of various G proteins in CXCR2-transfected NIH 3T3 cells warrants further evaluation.

Expression of the CXCR2 has been shown to be present on many different cell types, including leukocytes and related cell lines, melanoma cells, and breast cancer cells (39). IL-8 and Gro-{alpha} are produced by various cell types and are known to be angiogenic and mitogenic for endothelial cells (40). But the IL-8 mitogenic signaling pathway has not been defined, and cellular chemokine receptors have not been tested carefully for mitogenic activity. In addition, it has been proposed repeatedly that IL-8 acts as an autocrine promoter of cell proliferation (41) and even human tumor growth, e.g., in non-small cell lung cancer (42) or gastric carcinoma (43).

These reports together with our findings suggest that IL-8 produced by tumor cells may regulate cell proliferation and tumor growth in an autocrine fashion via CXCR2. The KSHV-GPCR in Kaposi’s sarcoma might thus be used to connect constitutively to the pathway that is used for IL-8-induced angiogenesis, one of the main features in Kaposi’s sarcoma histology besides inflammation and proliferation.

In conclusion, we propose that IL-8 and other ligands of CXCR2 may act as autocrine growth factors in tumors or at sites of inflammation through the activation of CXCR2, and that the KSHV-GPCR may use the same signal transduction cascade as the CXCR2.



View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 7. Comparison of Ca2+ mobilization in indo-1-labeled RBL2H3 cells transfected with different receptor constructs, as indicated in the figure. Cells were stimulated with 100 nM human IL-8.

 

    Footnotes
 
1 This work was supported by a grant of the Deutsche Forschungsgemeinschaft, SA-623/2-1, and by National Institutes of Health Grant HL55657 (to I.U.S.). Back

2 Address correspondence and reprint requests to Dr. Meike Burger, Department of Immunology, The Scripps Research Institute, IMM 12, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: Back

3 Abbreviations used in this paper: KSHV-GPCR, Kaposi’s sarcoma herpesvirus-G protein-coupled receptor; GRO, growth-related oncogene. Back

Received for publication March 22, 1999. Accepted for publication June 7, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Strader, C. D., T. M. Fong, M. P. Graziano, M. R. Tota. 1995. The family of G-protein-coupled receptors. FASEB J. 9:745.[Abstract]
  2. Gershengorn, M. C., E. Geras-Raaka, A. Varma, I. Clark-Lewis. 1998. Chemokines activate Kaposi’s sarcoma-associated herpesvirus G protein- coupled receptor in mammalian cells in culture. J. Clin. Invest. 102:1469.[Medline]
  3. Arvanitakis, L., E. Geras-Raaka, A. Varma, M. C. Gershengorn, E. Cesarman. 1997. Human herpesvirus KSHV encodes a constitutively active G-protein coupled receptor linked to cell proliferation. Nature 385:347.[Medline]
  4. Offermann, M. K.. 1996. HHV-8: a new herpesvirus associated with Kaposi’s sarcoma. Trends Microbiol. 4:383.[Medline]
  5. Nador, R. G., E. Cesarman, A. Chadburn, D. B. Dawson, M. Q. Ansari, J. Sald, D. M. Knowles. 1996. Primary effusion lymphoma: a distinct clinicopathologic entity associated with the Kaposi’s sarcoma-associated herpes virus. Blood 88:645.[Abstract/Free Full Text]
  6. Bais, C., B. Santomasso, O. Coso, L. Arvanitakis, E. Geras-Raaka, J. S. Gutkind, A. Asch, E. Cesarman, M. C. Gershengorn, E. A. Mesri. 1998. G-protein-coupled receptor of Kaposi’s sarcoma-associated herpesvirus is a viral oncogene and angiogenesis activator. Nature 391:86.[Medline]
  7. Scheer, A., F. Fanelli, T. Costa, P. G. De Benedetti, S. Cotecchia. 1996. Constitutively active mutants of the {alpha}1B-adrenergic receptor: role of highly conserved polar amino acids in receptor activation. EMBO J. 15:3566.[Medline]
  8. Scheer, A., S. Cotecchia. 1997. Constitutively active G protein-coupled receptors: potential mechanisms of receptor activation. J. Recept. Signal Transduct. Res. 17:57.[Medline]
  9. Samama, P., S. Cotecchia, T. Costa, R. J. Lefkowitz. 1993. A mutation-induced activated state of the ß2-adrenergic receptor: extending the ternary complex model. J. Biol. Chem. 268:4625.[Abstract/Free Full Text]
  10. Groblewski, T., B. Maigret, R. Larguier, C. Lombard, J. C. Bonnafous, J. Marie. 1997. Mutation of Asn111 in the third transmembrane domain of the AT1A angiotensin II receptor induces its constitutive activation. J. Biol. Chem. 272:1822.[Abstract/Free Full Text]
  11. Allen, L. F., R. J. Lefkowitz, M. G. Caron, S. Cotecchia. 1991. G-protein-coupled receptor genes as protooncogenes: constitutively activating mutation of the {alpha}1B-adrenergic receptor enhances mitogenesis and tumerogenicity. Proc. Natl. Acad. Sci. USA 88:11354.[Abstract/Free Full Text]
  12. Parma, J., L. Duprez, J. Van Sande, P. Cochaux, C. Gervy, J. Mockel, J. Dumont, G. Vassart. 1993. Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature 365:649.[Medline]
  13. Schipani, E., K. Kruse, H. Juppner. 1995. A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science 268:98.[Abstract/Free Full Text]
  14. Schraufstatter, I. U., D. S. Barrett, M. Ma, Z. G. Oades, C. G. Cochrane. 1993. Multiple sites on IL-8 responsible for binding to {alpha} and ß IL-8 receptors. J. Immunol. 151:6418.[Abstract]
  15. Fuhlbrigge, R. R., S. M. Fine, E. R. Unanue, D. D. Chaplin. 1988. Expression of membrane interleukin 1 by fibroblasts transfected with murine pro-interleukin 1{alpha} cDNA. Proc. Natl. Acad. Sci. USA 85:5649.[Abstract/Free Full Text]
  16. Wigler, M., D. DeFeo, I. B. Weinstein. 1978. Induction of plasminogen activator in cultured cells by macrocyclic plant diterpene esters and other agents related to tumor promotion. Cancer Res. 38:1434.[Abstract/Free Full Text]
  17. Schraufstatter, I. U., M. Ma, Z. G. Oades, D. S. Barritt, C. G. Cochrane. 1995. The role of Tyr13 and Lys15 of interleukin-8 in the high affinity interaction with the interleukin-8 receptor type A. J. Biol. Chem. 270:10428.[Abstract/Free Full Text]
  18. Gutkind, J. S., E. A. Novotny, M. R. Brann, K. C. Robbins. 1991. Muscarinic acetylcholine receptor subtypes as agonist-dependent oncogenes. Proc. Natl. Acad. Sci. USA 88:4703.[Abstract/Free Full Text]
  19. Berridge, M., R. Dawson, C. P. Downes, J. P. Heslopand, R. F. Irvine. 1983. Changes in the levels of inositol phosphates after agonist-dependent hydrolysis of membrane phosphoinositides. Biochem. J. 212:473.[Medline]
  20. Norgauer, J., J. Krutmann, G. J. Dobos, A. E. Traynor-Kaplan, Z. G. Oades, I. U. Schraufstatter. 1994. Actin polymerization, calcium-transients, and phospholipid metabolism in human neutrophils after stimulation with interleukin-8 and N-formyl peptide. J. Invest. Dermatol. 102:310.[Medline]
  21. Bozic, C. R., L. F. Kolakowski, N. P. Gerard, C. Garcia-Rodriguez, C. von Uexkull-Guldenbrand, M. J. Conklyn, R. Breslow, H. J. Showell, C. Gerard. 1995. Expression and biologic characterization of the murine chemokine KC. J. Immunol. 154:6048.[Abstract]
  22. Garcia, M., D. Derocq, P. Pujol, H. Rochefort. 1990. Overexpression of transfected cathepsin D in transformed cells increases their malignant phenotype and metastatic potency. Oncogene 5:1809.[Medline]
  23. Gutkind, J. S.. 1998. The pathways connecting G protein-coupled receptors to the nucleus through divergent mitogen-activated protein kinase assays. J. Biol. Chem. 273:1839.[Free Full Text]
  24. Lefkowitz, R. J., S. Cotecchia, P. Samama, T. Costa. 1993. Constitutive activity of receptors coupled to guanine nucleotide regulatory proteins. Trends Pharmacol. Sci. 14:303.[Medline]
  25. Kjelsberg, M., J. Ostrowski, M. C. Caron, R. J. Lefkowitz. 1992. Constitutive activation of the {alpha}1B-adrenergic receptor by all amino acid substitutions at a single site. J. Biol. Chem. 267:1430.[Abstract/Free Full Text]
  26. Milano, C. A., L. F. Allen, H. A. Rockman, P. C. Dolber, T. R. McMinn, K. R. Chien, T. D. Johnson, R. A. Bond, R. J. Lefkowitz. 1994. Enhanced myocardial function in transgenic mice overexpressing the ß2-adrenergic receptor. Science 264:582.[Abstract/Free Full Text]
  27. Alblas, J., I. van Etten, W. H. Moolenaar. 1996. Truncated, desensitization-defective neurokinin receptors mediate sustained MAP kinase activation, cell growth and transformation by a Ras-independent mechanism. EMBO J. 15:3351.[Medline]
  28. Coughlin, S. R.. 1994. Expanding horizons for receptors coupled to G proteins: diversity and disease. Curr. Opin. Cell Biol. 6:191.[Medline]
  29. Van Sande, J., J. Parma, M. Tonacchera, S. Swillens, J. Dumont, G. Vassart. 1995. Somatic and germline mutations of the TSH receptor gene in thyroid diseases. J. Clin. Endocrinol. Metab. 80:2577.[Medline]
  30. Gosling, J., F. S. Monteclaro, R. E. Atchison, H. Arai, C. L. Tsou, M. A. Goldsmith, I. F. Charo. 1997. Molecular uncoupling of C-C chemokine receptor 5-induced chemotaxis and signal transduction from HIV-1 coreceptor activity. Proc. Natl. Acad. Sci. USA 94:5061.[Abstract/Free Full Text]
  31. Damaj, B. B., S. R. McColl, K. Neote, N. Songqing, K. T. Ogborn, C. A. Hebert, P. H. Naccache. 1996. Identification of G-protein binding sites of the human interleukin-8 receptors by functional mapping of the intracellular loops. FASEB J. 10:1426.[Abstract]
  32. Okamoto, T., I. Nishimoto. 1992. Detection of G protein-activated regions in M4 subtype muscarinic, cholinergic, and {alpha}2-adrenergic receptors based upon characteristics in primary structure. J. Biol. Chem. 267:8342.[Abstract/Free Full Text]
  33. Verrall, S., M. Ishii, M. Chen, L. Wang, T. Tram, S. R. Coughlin. 1997. The thrombin receptor second cytoplasmic loop confers coupling to Gq-like G proteins in chimeric receptors. J. Biol. Chem. 272:6898.[Abstract/Free Full Text]
  34. Burstein, E. S., T. A. Spalding, M. R. Brann. 1998. The second intracellular loop of the m5 muscarinic receptor is the switch which enables G-protein coupling. J. Biol. Chem. 273:24322.[Abstract/Free Full Text]
  35. Norgauer, J., B. Metzner, I. U. Schraufstatter. 1996. Expression and growth-promoting function of the IL-8 receptor ß in human melanoma cells. J. Immunol. 156:1132.[Abstract]
  36. Arai, H., I. F. Charo. 1996. Differential regulation of G-protein-mediated signaling by chemokine receptors. J. Biol. Chem. 271:21814.[Abstract/Free Full Text]
  37. Wu, D., G. J. LaRosa, M. I. Simon. 1993. G-protein-coupled signal transduction pathways for interleukin-8. Science 261:101.[Abstract/Free Full Text]
  38. Fromm, C., O. A. Coso, S. Montaner, N. Xy, S. Gutkind. 1997. The small GTP-binding protein Rho links G-protein-coupled receptors and G{alpha}12 to the serum response element and to cellular transformation. Proc. Natl. Acad. Sci. USA 94:10098.[Abstract/Free Full Text]
  39. Youngs, S. J., S. A. Ali, D. D. Taub, R. C. Rees. 1997. Chemokines induce migrational responses in human breast carcinoma cell lines. Int. J. Cancer 71:257.[Medline]
  40. Koch, A. E., P. Polverini, S. L. Kunkel, L. A. Harlow, L. A. DiPietro, V. M. Elner, S. G. Elner, R. M. Strieter. 1992. Interleukin-8 as a macrophage-derived mediator of angiogenesis. Science 258:1798.[Abstract/Free Full Text]
  41. Arici, A., E. Seli, H. B. Zeyneloglu, L. M. Senturk, E. Oral, D. L. Olive. 1998. Interleukin-8 induces proliferation of endometrial stromal cells: a potential autocrine growth factor. J. Clin. Endocrinol. Metab. 83:1201.[Abstract/Free Full Text]
  42. Arenberg, D. A., S. L. Kunkel, P. J. Polverini, M. Glass, M. D. Burdick, R. M. Strieter. 1996. Inhibition of interleukin-8 reduces tumorigenesis of non-small cell lung cancer in SCID mice. J. Clin. Invest. 97:2792.[Medline]
  43. Kitadai, Y., K. Haruma, K. Sumii, S. Yamamoto, T. Ue, H. Yokozaki, W. Yasui, Y. Ohmoto, G. Kajiyama, I. J. Fidler, E. Tahara. 1998. Expression of interleukin-8 correlates with vascularity in human gastric carcinomas. Am. J. Pathol. 152:93.[Abstract]



This article has been cited by other articles:


Home page
J Biomol ScreenHome page
S. Kredel, M. Wolff, J. Wiedenmann, B. Moepps, G. U. Nienhaus, P. Gierschik, B. Kistler, and R. Heilker
CXCR2 Inverse Agonism Detected by Arrestin Redistribution
J Biomol Screen, October 1, 2009; 14(9): 1076 - 1091.
[Abstract] [PDF]


Home page
J. Virol.Home page
J. D. Sherrill, M. P. Stropes, O. D. Schneider, D. E. Koch, F. M. Bittencourt, J. L. C. Miller, and W. E. Miller
Activation of Intracellular Signaling Pathways by the Murine Cytomegalovirus G Protein-Coupled Receptor M33 Occurs via PLC-{beta}/PKC-Dependent and -Independent Mechanisms
J. Virol., August 15, 2009; 83(16): 8141 - 8152.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
Z. Saidak, R. Mentaverri, and E. M. Brown
The Role of the Calcium-Sensing Receptor in the Development and Progression of Cancer
Endocr. Rev., April 1, 2009; 30(2): 178 - 195.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y. Yu, Y. Su, S. R. Opalenik, T. Sobolik-Delmaire, N. F. Neel, S. Zaja-Milatovic, S. T. Short, J. Sai, and A. Richmond
Short tail with skin lesion phenotype occurs in transgenic mice with keratin-14 promoter-directed expression of mutant CXCR2
J. Leukoc. Biol., August 1, 2008; 84(2): 406 - 419.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
D. Verzijl, S. Storelli, D. J. Scholten, L. Bosch, T. A. Reinhart, D. N. Streblow, C. P. Tensen, C. P. Fitzsimons, G. J. R. Zaman, J. E. Pease, et al.
Noncompetitive Antagonism and Inverse Agonism as Mechanism of Action of Nonpeptidergic Antagonists at Primate and Rodent CXCR3 Chemokine Receptors
J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 544 - 555.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Case, E. Sharp, T. Benned-Jensen, M. M. Rosenkilde, N. Davis-Poynter, and H. E. Farrell
Functional Analysis of the Murine Cytomegalovirus Chemokine Receptor Homologue M33: Ablation of Constitutive Signaling Is Associated with an Attenuated Phenotype In Vivo
J. Virol., February 15, 2008; 82(4): 1884 - 1898.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
D. Maussang, D. Verzijl, M. van Walsum, R. Leurs, J. Holl, O. Pleskoff, D. Michel, G. A. M. S. van Dongen, and M. J. Smit
Human cytomegalovirus-encoded chemokine receptor US28 promotes tumorigenesis
PNAS, August 29, 2006; 103(35): 13068 - 13073.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Ueda, N. F. Neel, E. Schutyser, D. Raman, and A. Richmond
Deletion of the COOH-Terminal Domain of CXC Chemokine Receptor 4 Leads to the Down-regulation of Cell-to-Cell Contact, Enhanced Motility and Proliferation in Breast Carcinoma Cells
Cancer Res., June 1, 2006; 66(11): 5665 - 5675.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
P. Najarro, C. Gubser, M. Hollinshead, J. Fox, J. Pease, and G. L. Smith
Yaba-like disease virus chemokine receptor 7L, a CCR8 orthologue.
J. Gen. Virol., April 1, 2006; 87(Pt 4): 809 - 816.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. M. Rosenkilde, T. N. Kledal, and T. W. Schwartz
High Constitutive Activity of a Virus-Encoded Seven Transmembrane Receptor in the Absence of the Conserved DRY Motif (Asp-Arg-Tyr) in Transmembrane Helix 3
Mol. Pharmacol., July 1, 2005; 68(1): 11 - 19.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
B. Lagane, S. Ballet, T. Planchenault, K. Balabanian, E. Le Poul, C. Blanpain, Y. Percherancier, I. Staropoli, G. Vassart, M. Oppermann, et al.
Mutation of the DRY Motif Reveals Different Structural Requirements for the CC Chemokine Receptor 5-Mediated Signaling and Receptor Endocytosis
Mol. Pharmacol., June 1, 2005; 67(6): 1966 - 1976.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
Y. K. Gruijthuijsen, E. V. H. Beuken, M. J. Smit, R. Leurs, C. A. Bruggeman, and C. Vink
Mutational analysis of the R33-encoded G protein-coupled receptor of rat cytomegalovirus: identification of amino acid residues critical for cellular localization and ligand-independent signalling
J. Gen. Virol., April 1, 2004; 85(4): 897 - 909.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Liu, G. Sandford, G. Fei, and J. Nicholas
G{alpha} Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor
J. Virol., March 1, 2004; 78(5): 2460 - 2471.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
D. Dadke, B. H. Fryer, E. A. Golemis, and J. Field
Activation of p21-Activated Kinase 1-Nuclear Factor {kappa}B Signaling by Kaposi's Sarcoma-Associated Herpes Virus G Protein-Coupled Receptor during Cellular Transformation
Cancer Res., December 15, 2003; 63(24): 8837 - 8847.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. U. Schraufstatter, K. Trieu, M. Zhao, D. M. Rose, R. A. Terkeltaub, and M. Burger
IL-8-Mediated Cell Migration in Endothelial Cells Depends on Cathepsin B Activity and Transactivation of the Epidermal Growth Factor Receptor
J. Immunol., December 15, 2003; 171(12): 6714 - 6722.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
N. Mukaida
Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases
Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L566 - L577.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. D. Estep, M. K. Axthelm, and S. W. Wong
A G Protein-Coupled Receptor Encoded by Rhesus Rhadinovirus Is Similar to ORF74 of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol., February 1, 2003; 77(3): 1738 - 1746.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. Cannon, N. J. Philpott, and E. Cesarman
The Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Has Broad Signaling Effects in Primary Effusion Lymphoma Cells
J. Virol., January 1, 2003; 77(1): 57 - 67.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
P. Dhawan and A. Richmond
Role of CXCL1 in tumorigenesis of melanoma
J. Leukoc. Biol., July 1, 2002; 72(1): 9 - 18.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C.-J. Chiou, L. J. Poole, P. S. Kim, D. M. Ciufo, J. S. Cannon, C. M. ap Rhys, D. J. Alcendor, J.-C. Zong, R. F. Ambinder, and G. S. Hayward
Patterns of Gene Expression and a Transactivation Function Exhibited by the vGCR (ORF74) Chemokine Receptor Protein of Kaposi's Sarcoma-Associated Herpesvirus
J. Virol., April 1, 2002; 76(7): 3421 - 3439.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
M. J. Smit, D. Verzijl, P. Casarosa, M. Navis, H. Timmerman, and R. Leurs
Kaposi's Sarcoma-Associated Herpesvirus-Encoded G Protein-Coupled Receptor ORF74 Constitutively Activates p44/p42 MAPK and Akt via Gi and Phospholipase C-Dependent Signaling Pathways
J. Virol., February 15, 2002; 76(4): 1744 - 1752.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
R. D. Ye
Regulation of nuclear factor {kappa}B activation by G-protein-coupled receptors
J. Leukoc. Biol., December 1, 2001; 70(6): 839 - 848.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. W. Shepard, M. Yang, P. Xie, D. D. Browning, T. Voyno-Yasenetskaya, T. Kozasa, and R. D. Ye
Constitutive Activation of NF-kappa B and Secretion of Interleukin-8 Induced by the G Protein-coupled Receptor of Kaposi's Sarcoma-associated Herpesvirus Involve Galpha 13 and RhoA
J. Biol. Chem., November 30, 2001; 276(49): 45979 - 45987.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
S. Pati, M. Cavrois, H.-G. Guo, J. S. Foulke Jr., J. Kim, R. A. Feldman, and M. Reitz
Activation of NF-{kappa}B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis
J. Virol., September 15, 2001; 75(18): 8660 - 8673.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Schwarz and P. M. Murphy
Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Constitutively Activates NF-{{kappa}}B and Induces Proinflammatory Cytokine and Chemokine Production Via a C-Terminal Signaling Determinant
J. Immunol., July 1, 2001; 167(1): 505 - 513.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
I. U. Schraufstatter, J. Chung, and M. Burger
IL-8 activates endothelial cell CXCR1 and CXCR2 through Rho and Rac signaling pathways
Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1094 - L1103.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
M. N. Wakeling, D. J. Roy, A. A. Nash, and J. P. Stewart
Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor
J. Gen. Virol., May 1, 2001; 82(5): 1187 - 1197.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
S. Montaner, A. Sodhi, S. Pece, E. A. Mesri, and J. S. Gutkind
The Kaposi's Sarcoma-associated Herpesvirus G Protein-coupled Receptor Promotes Endothelial Cell Survival through the Activation of Akt/Protein Kinase B
Cancer Res., March 1, 2001; 61(6): 2641 - 2648.
[Abstract] [Full Text]


Home page
Cancer Res.Home page
A. Sodhi, S. Montaner, V. Patel, M. Zohar, C. Bais, E. A. Mesri, and J. S. Gutkind
The Kaposi's Sarcoma-associated Herpes Virus G Protein-coupled Receptor Up-Regulates Vascular Endothelial Growth Factor Expression and Secretion through Mitogen-activated Protein Kinase and p38 Pathways Acting on Hypoxia-inducible Factor 1{{alpha}}
Cancer Res., September 1, 2000; 60(17): 4873 - 4880.
[Abstract] [Full Text]


Home page
J. Leukoc. Biol.Home page
J. A. Belperio, M. P. Keane, D. A. Arenberg, C. L. Addison, J. E. Ehlert, M. D. Burdick, and R. M. Strieter
CXC chemokines in angiogenesis
J. Leukoc. Biol., July 1, 2000; 68(1): 1 - 8.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. M. Rosenkilde, T. N. Kledal, P. J. Holst, and T. W. Schwartz
Selective Elimination of High Constitutive Activity or Chemokine Binding in the Human Herpesvirus 8 Encoded Seven Transmembrane Oncogene ORF74
J. Biol. Chem., August 18, 2000; 275(34): 26309 - 26315.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. H. Ho, N. Ganeshalingam, A. Rosenhouse-Dantsker, R. Osman, and M. C. Gershengorn
Charged Residues at the Intracellular Boundary of Transmembrane Helices 2 and 3 Independently Affect Constitutive Activity of Kaposi's Sarcoma-associated Herpesvirus G Protein-coupled Receptor
J. Biol. Chem., January 5, 2001; 276(2): 1376 - 1382.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Burger, M.
Right arrow Articles by Schraufstatter, I. U.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Burger, M.
Right arrow Articles by Schraufstatter, I. U.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS