|
|
||||||||


*
Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037;
Department of Medicine, University of California, San Diego, CA 92093; and
La Jolla Institute of Experimental Medicine, La Jolla, CA 92037
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The KSHV-GPCR is the product of open reading frame 74 of the human Herpesvirus 8. It has been speculated that the KSHV-GPCR has been pirated from CXCR2 or CXCR1 (2), its closest homologues.
The KSHV-GPCR exhibits constitutive signaling via activation of
phosphoinositide-specific phospholipase (3) in the absence
of ligand, although it can bind IL-8 and other chemokines. The CXCR2
activates the same signal transduction cascade, when it binds its
ligands that include IL-8, GRO-
, and NAP-2, but does not exhibit
constitutive signaling.
The KSHV-GPCR appears to be involved in the pathogenesis of Kaposis sarcoma (4) and primary effusion lymphomas (5). Expression of this receptor stimulates proliferation in rat fibroblasts (3) and causes transformation in NIH 3T3 cells and tumors, when transfected cells are injected into nude mice (6). This transforming activity of the receptor is thought to be a result of its constitutive activation.
The DRY sequence at the junction of the third transmembrane domain to the second intracellular loop of the CXCR2 is a highly conserved motif among G protein-coupled receptors. However, the KSHV-GPCR shows a VRY motif in this position.
It has been shown for other GPCRs, e.g., the
1b-adrenergic (7, 8), the
ß2-adrenergic receptor (9), and
the AT1A angiotensin II receptor
(10), that mutations in the second and third intracellular
loop result in increased agonist-independent receptor activity and
confer sometimes oncogenic properties to the receptor
(11). In addition, mutations inducing constitutive
activation of GPCRs have been described and found to be associated with
human diseases (12, 13).
This prompted us to compare the activity and function of the KSHV-GPCR and the CXCR2, and to introduce mutations into the highly conserved DRY sequence of CXCR2.
In this study, we report that the replacement of
Asp138 by Val in the second intracellular loop of
the CXCR2 constitutively activates the receptor and causes
transformation in transfected NIH 3T3 cells comparable with results
seen with the KSHV-GPCR. Furthermore, we show for the first time that
the CXCR2 wild type itself is able to transform transfected NIH 3T3
cells due to autocrine stimulation by mouse KC, the mouse equivalent of
GRO-
, which binds to the CXCR2 and is produced by mouse fibroblast
NIH 3T3 cells. These data provide support for a role of the CXCR2 in
cell proliferation and tumorigenesis.
| Materials and Methods |
|---|
|
|
|---|
DNA constructs. The CXCR1 and CXCR2 receptor constructs have
been described (14). The KSHV-GPCR was amplified by RT-PCR
from BCBL-1 lymphoma cell RNA (obtained from Dr. Jaques Corbeil,
University of California, San Diego) using the 5' oligo
GAGAATTCAGGCCATGGCGGCCGAGG and the 3' oligo
GAGAATTCACGTGGTGGCGCCGGACA and cloned into the EcoRI
site of pSFFV.neo (15). D138V and D138Q are point
mutations of the CXCR2 in which Asp138 (GTA) is
replaced by Val (GCA) or Gln (GAA). Point mutations were introduced by
two rounds of PCR amplification. The correctness of the constructs was
verified by automated DNA sequencing. The sequences are shown in a
schematic form in Fig. 1
.
|
RBL2H3 rat basophilic leukemia cells were grown in RPMI 1640 containing 10% FCS and transfected with the same DNA constructs using lipofectamine, as described (14). Stable cell lines were selected with 300 µg/ml G418.
Mouse KC in the culture supernatants was quantified using an ELISA kit from R&D Systems (Minneapolis, MN).
Analysis of receptor expression
Receptor expression was verified by FACS analysis using polyclonal rabbit Abs raised against a fusion protein of the first 44 amino acids of the receptors with GST, as described (17). Binding of 125I-labeled IL-8 was determined as previously described (14).
Focus formation
NIH 3T3 cells were transfected with the receptor constructs (1 µg plasmid DNA per 60-mm dish) in quadruplicates, and cell foci were counted after 1821 days. In addition, 200 stably transfected cells were seeded on a layer of 2 x 105 untransfected NIH 3T3 cells, as described (18), and cell foci were counted after 2 wk.
Anchorage-independent growth
A total of 4 x 104 stably transfected NIH 3T3 cells was mixed in an equal amount of DMEM containing 10% FCS and 0.3% melted soft agar in medium and poured onto a bottom layer of 0.6% soft agar. Cells were fed every 3 days with three drops of media, and cell colonies formed were photographed after 23 wk.
Accumulation of inositol phosphates
Subconfluent NIH 3T3 cells were labeled for 48 h in 12-well plates in inositol-free DMEM (Life Technologies, Grand Island, NY) containing 1 µCi/ml [3H]myoinositol (Amersham, Arlington Heights, IL). Cells were washed in DMEM containing 10 mM LiCl and 1 mM CaCl2 and incubated for 10 min at room temperature, followed by 20 min at 37°C. Inositol phosphates were extracted with 10% perchloric acid, followed by neutralization with KOH/Tris. [3H]inositol phosphates were separated by anion-exchange chromatography on AG 1-X8 formate resin (Bio-Rad, Vista, CA), as described by Berridge (19). Inositol phosphate accumulation was expressed as the percentage of 3H label in inositol phosphates per µg of protein in the cell precipitates.
Pertussis toxin (100 ng/ml) was added for 16 h before inositol phosphate extraction. Anti-CXCR2 and anti-mouse KC Abs (R&D Systems) were added together with the [3H]myoinositol for 48 h.
Ca2+ mobilization and actin polymerization
RBL2H3 cells stably transfected with the different receptor constructs were labeled with Indo-1AM (Molecular Probes, Eugene, OR), and Ca2+ flux was measured on an SLM 8000 fluorometer (Spectronic Instruments, Rochester, NY), as previously described (14).
Actin polymerization in RBL2H3 cells was measured as described earlier (20). All results are plotted relative to the mean fluorescence of the sample before addition of the chemokine.
| Results |
|---|
|
|
|---|
The consequences of expression of CXCR2, CXCR1, mutant receptors, and KSHV-GPCR on cell growth were investigated in NIH 3T3 cells. Focus formation in these cells represents a morphologic manifestation of transformation associated with the loss of contact inhibition that limits the cell density of these cells.
The focus formation assay was performed in two different ways by
plating 200 stably transfected NIH 3T3 cells on a layer of
untransfected cells or by transient transfection (Figs. 2
and
3).
|
Surprisingly, cells transfected with the wild-type CXCR2 also formed
foci, although to a lesser extent, which were observed with both
methods and not seen with untransfected NIH 3T3 fibroblasts, those
transfected with the pSFFV.neo vector only, or with the CXCR1 (Figs. 2
and 3
). Cells within foci caused by the CXCR2 manifested the malignant
phenotype with a loss of density-dependent growth inhibition, resulting
in increased cellular packing and piling up of cells. This
oncogene-like ability of the CXCR2 to induce transformation is
presumably due to continuous autocrine stimulation of the receptor by
mouse KC, the mouse equivalent of GRO-
, produced by NIH 3T3 cells.
Overnight cultures of NIH 3T3 cells contained between 1220 ng/ml of
mouse KC, which is a sufficient concentration to activate the human
CXCR2 (21).
|
FACS analysis indicated that surface expression of the CXCR1, CXCR2, and the D138V and D138Q mutants was similar, even a little higher for the D138Q mutant (data not shown), so that differences in the level of expression could not explain the varying behavior of these receptors.
The transforming potential of the CXCR2, mutant receptors, and the
KSHV-GPCR was paralleled by their ability to form colonies in soft
agar. Cells transfected with the CXCR2, the D138V mutant, or the
KSHV-GPCR all formed colonies after 23 wk in culture (Fig. 4
). Colonies of CXCR2-transfected cells
tended to stay smaller than those of cells transfected with the
KSHV-GPCR or the D138V mutant, but clearly grew in an
anchorage-independent fashion, usually associated with the potential to
metastasize (22). Untransfected cells or those transfected
with the D138Q mutant or the CXCR1 failed to grow in soft agar
(Fig. 4
).
|
Activation of phospholipase C is a major pathway that links G protein-coupled receptor activation to cell proliferation (3, 23). To evaluate G protein-coupled signaling through this pathway, we measured inositol phosphate accumulation in NIH 3T3 cells stably transfected with the various receptors and the mutants.
In agreement with previous reports (3), NIH 3T3 cells
transfected with the KSHV-GPCR accumulated 3.5 times the amount of
inositol phosphates observed in untransfected control cells. This
increase could not be blocked by pertussis toxin treatment of these
cells, which only caused small, nonspecific inhibition of inositol
phosphate accumulation that was seen in all cells treated with
pertussis toxin (Fig. 5
). It also could
not be blocked by Abs against the CXCR2 or against mouse KC (Fig. 5
).
|
In contrast, accumulation of inositol phosphates in cells transfected
with the CXCR2 mutant D138V (3.1-fold higher than found in
untransfected NIH 3T3 cells) could not be blocked by either of the Abs,
and pertussis toxin blocked inositol phosphate accumulation in these
cells only to a small degree (Fig. 5
). Together these results suggest
that this mutant receptor signals in an agonist-independent fashion
similar to the KSHV-GPCR.
The CXCR2 mutant D138Q, in which the same Asp was replaced with Gln,
showed only a small increase of inositol phosphate turnover over
untransfected NIH 3T3 cells (Fig. 5
), which is consistent with the low
potential of this mutant to form foci. A similar behavior was seen in
cells transfected with the CXCR1.
Ca2+ mobilization and actin polymerization in RBL2H3 cells
The same receptor constructs were transfected into RBL2H3 cells, and calcium mobilization and actin polymerization were determined.
As shown in Figs. 6
and
7, CXCR2- and CXCR1-transfected cells
showed a high level of actin polymerization and calcium mobilization
upon stimulation with IL-8. At high concentrations, the CXCR2 mutant
D138Q responded almost as well as the CXCR2, but the mutant showed a
much lower affinity. Approximately 20-fold higher concentrations of
ligand were necessary for a response equal to that seen with the
wild-type receptor. These functional results were confirmed by
125I-labeled IL-8 binding studies that showed a
Kd of 1.2 x
10-9 M for the CXCR2 and a
Kd greater than 2 x
10-8 M for the D138Q mutant. The affinity of
GPCRs not coupled to G proteins generally drops by 12 orders of
magnitude. All of these results are consistent with poor G protein
coupling of the D138Q mutant.
|
In both assays, the KSHV-GPCR and the mutant D138V showed only a small response to IL-8 stimulation, consistent with the idea that these receptors exhibit constitutive activity independent of ligand. In accordance with the report of Gershengorn et al. (2), the KSHV-GPCR as well as D138V can be activated by IL-8 over constitutive levels, which could mean that additional stimulation might even enhance the functional activities of these receptors.
| Discussion |
|---|
|
|
|---|
It has been demonstrated for several receptors that discrete mutation can cause dramatic increases in agonist-independent receptor activity (24). It was therefore proposed that important conformational constraints maintain the receptor preferentially in an inactive conformation and that these constraints are released upon activation, causing key sequences to be exposed to the G protein (25). Single point mutations seem to be able to change the receptor conformation leading to constitutive activation, thereby mimicking the active state of the wild-type receptor.
Constitutive signaling, as shown by some native GPCRs (26), occurs more commonly with mutated GPCRs (24, 27) in several human diseases and in tumors (28, 29). The KSHV-GPCR has been recently described as a naturally occurring receptor exhibiting constitutive signaling, which is thought to play a role in the pathogenesis of Kaposis sarcoma. It has been speculated that the KSHV pirated the gene encoding for the KSHV-GPCR from CXCR2 or CXCR1, its closest homologues, and retaining similarities to these receptors.
Our study points out the importance of the DRY sequence in CXCR2 for regulated signaling function and the significance of the mutation to a VRY motif, the respective sequence in the KSHV-GPCR, which makes the CXCR2 functionally similar to the KSHV-GPCR. The DRY sequence at the junction between the third transmembrane domain and the second intracellular loop is shared by almost all GPCRs, including the chemokine receptors. The importance of this sequence for G protein coupling has been shown for the CCR5 (30). The surrounding amino acids are also highly conserved among chemokine receptors and necessary for proper signal transduction (31). Sequence homology between the CXCRs and the KSHV-GPCR is higher in this region than in any other area outside of the transmembrane domains.
The second intracellular loops of both the CXCR2 and the KSHV-GPCR contain the basic amino acids at both the NH2- and COOH-terminal ends that are necessary for interaction with Gi proteins (32, 33).
Replacement of the Asp in the DRY sequence by the bulky hydrophobic Val
in this location, as seen in the KSHV-GPCR and in our D138V mutant,
presumably pulls this region into the plasma membrane. The more
conservative D138Q mutant would not be expected to have this effect. It
has been proposed that the
-helical structure of the third
transmembrane domain of GPCRs continues on into the second
intracellular loop. Hydrophobic residues of the second intracellular
loop are thought to interact with
-helical structures of the third
intracellular loop, while amino acids in the second intracellular loop
that face away from the third intracellular loop are considered
important to keep the receptor in an active state in the absence of
ligand (34). Our results are consistent with this
hypothesis.
In contrast, continuous stimulation of the CXCR1 with human IL-8 or
introducing the point mutation that exchanges the Asp for a Val into
the CXCR1 receptor (D134V-CXCR1) did not result in transforming
capacity (Fig. 2
), although both the CXCR1 and the mutant receptor were
expressed as assessed by FACS (data not shown). Hence, the similarity
in the signaling of the CXCR2 mutant D138V and the KSHV-GPCR supports
the hypothesis that the gene of the KSHV-GPCR has been pirated from the
CXCR2. In addition, it emphasizes the transforming potential of the
CXCR2, which seems to be exhibited only by the CXCR2 and not by the
CXCR1. Being continuously stimulated or constitutively activated due to
a single amino acid change in the receptor, the CXCR2 seems to activate
normal cellular genes with latent transforming potential and subvert
regulatory key pathways controlling cell proliferation. There have not
been any reports about the transforming potential of the CXCR2 to date,
although Norgauer et al. (35) showed that the CXCR2
exhibits a growth-promoting function in melanoma cells that could be
blocked by Abs against the CXCR2.
It also has been shown for other G protein-coupled receptors that persistent activation can transform cells (18) and act as oncogenes in human cancers (29). These pathways are complex (23) and not understood in detail. Increased inositol phosphate turnover seems to play a role, and indeed occurred in all focus-forming mutants we analyzed.
Leukocytes and leukocytic cell lines such as RBL2H3 cells express such
a high level of Gi
2 that the signal
transduction cascade in these cells following stimulation with IL-8 is
dominated by the activation of Gi
(36). The CXCR2 can, however, also couple to
G
14 and G
16
(37), and possibly additional G proteins. Pertussis toxin
largely, but not completely, blocked inositol phosphate accumulation in
NIH 3T3 cells expressing the CXCR2, while it abrogated functions
induced by IL-8 in RBL2H3 cells expressing the same receptor. Indeed,
actin polymerization, which was blocked completely by incubation with
pertussis toxin in RBL2H3 cells, was not affected by this
Gi and Go protein-specific
inhibitor in NIH 3T3 cells (Schraufstatter et al., unpublished
observation). Another G protein, possibly G
12
or G
13, must mediate this response in NIH 3T3
cells. G
12 has recently been described to be
involved in cellular transformation caused by m1 muscarinic
acethylcholine receptors in NIH 3T3 cells (38). The
relative contribution of various G proteins in CXCR2-transfected NIH
3T3 cells warrants further evaluation.
Expression of the CXCR2 has been shown to be present on many different
cell types, including leukocytes and related cell lines, melanoma
cells, and breast cancer cells (39). IL-8 and Gro-
are
produced by various cell types and are known to be angiogenic and
mitogenic for endothelial cells (40). But the IL-8
mitogenic signaling pathway has not been defined, and cellular
chemokine receptors have not been tested carefully for mitogenic
activity. In addition, it has been proposed repeatedly that IL-8 acts
as an autocrine promoter of cell proliferation (41) and
even human tumor growth, e.g., in non-small cell lung cancer
(42) or gastric carcinoma (43).
These reports together with our findings suggest that IL-8 produced by tumor cells may regulate cell proliferation and tumor growth in an autocrine fashion via CXCR2. The KSHV-GPCR in Kaposis sarcoma might thus be used to connect constitutively to the pathway that is used for IL-8-induced angiogenesis, one of the main features in Kaposis sarcoma histology besides inflammation and proliferation.
In conclusion, we propose that IL-8 and other ligands of CXCR2 may act as autocrine growth factors in tumors or at sites of inflammation through the activation of CXCR2, and that the KSHV-GPCR may use the same signal transduction cascade as the CXCR2.
|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Meike Burger, Department of Immunology, The Scripps Research Institute, IMM 12, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: ![]()
3 Abbreviations used in this paper: KSHV-GPCR, Kaposis sarcoma herpesvirus-G protein-coupled receptor; GRO, growth-related oncogene. ![]()
Received for publication March 22, 1999. Accepted for publication June 7, 1999.
| References |
|---|
|
|
|---|
1B-adrenergic receptor: role of highly conserved polar amino acids in receptor activation. EMBO J. 15:3566.[Medline]
1B-adrenergic receptor enhances mitogenesis and tumerogenicity. Proc. Natl. Acad. Sci. USA 88:11354.
and ß IL-8 receptors. J. Immunol. 151:6418.[Abstract]
cDNA. Proc. Natl. Acad. Sci. USA 85:5649.
1B-adrenergic receptor by all amino acid substitutions at a single site. J. Biol. Chem. 267:1430.
2-adrenergic receptors based upon characteristics in primary structure. J. Biol. Chem. 267:8342.
12 to the serum response element and to cellular transformation. Proc. Natl. Acad. Sci. USA 94:10098.This article has been cited by other articles:
![]() |
S. Kredel, M. Wolff, J. Wiedenmann, B. Moepps, G. U. Nienhaus, P. Gierschik, B. Kistler, and R. Heilker CXCR2 Inverse Agonism Detected by Arrestin Redistribution J Biomol Screen, October 1, 2009; 14(9): 1076 - 1091. [Abstract] [PDF] |
||||
![]() |
J. D. Sherrill, M. P. Stropes, O. D. Schneider, D. E. Koch, F. M. Bittencourt, J. L. C. Miller, and W. E. Miller Activation of Intracellular Signaling Pathways by the Murine Cytomegalovirus G Protein-Coupled Receptor M33 Occurs via PLC-{beta}/PKC-Dependent and -Independent Mechanisms J. Virol., August 15, 2009; 83(16): 8141 - 8152. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Saidak, R. Mentaverri, and E. M. Brown The Role of the Calcium-Sensing Receptor in the Development and Progression of Cancer Endocr. Rev., April 1, 2009; 30(2): 178 - 195. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yu, Y. Su, S. R. Opalenik, T. Sobolik-Delmaire, N. F. Neel, S. Zaja-Milatovic, S. T. Short, J. Sai, and A. Richmond Short tail with skin lesion phenotype occurs in transgenic mice with keratin-14 promoter-directed expression of mutant CXCR2 J. Leukoc. Biol., August 1, 2008; 84(2): 406 - 419. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Verzijl, S. Storelli, D. J. Scholten, L. Bosch, T. A. Reinhart, D. N. Streblow, C. P. Tensen, C. P. Fitzsimons, G. J. R. Zaman, J. E. Pease, et al. Noncompetitive Antagonism and Inverse Agonism as Mechanism of Action of Nonpeptidergic Antagonists at Primate and Rodent CXCR3 Chemokine Receptors J. Pharmacol. Exp. Ther., May 1, 2008; 325(2): 544 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Case, E. Sharp, T. Benned-Jensen, M. M. Rosenkilde, N. Davis-Poynter, and H. E. Farrell Functional Analysis of the Murine Cytomegalovirus Chemokine Receptor Homologue M33: Ablation of Constitutive Signaling Is Associated with an Attenuated Phenotype In Vivo J. Virol., February 15, 2008; 82(4): 1884 - 1898. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Maussang, D. Verzijl, M. van Walsum, R. Leurs, J. Holl, O. Pleskoff, D. Michel, G. A. M. S. van Dongen, and M. J. Smit Human cytomegalovirus-encoded chemokine receptor US28 promotes tumorigenesis PNAS, August 29, 2006; 103(35): 13068 - 13073. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ueda, N. F. Neel, E. Schutyser, D. Raman, and A. Richmond Deletion of the COOH-Terminal Domain of CXC Chemokine Receptor 4 Leads to the Down-regulation of Cell-to-Cell Contact, Enhanced Motility and Proliferation in Breast Carcinoma Cells Cancer Res., June 1, 2006; 66(11): 5665 - 5675. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Najarro, C. Gubser, M. Hollinshead, J. Fox, J. Pease, and G. L. Smith Yaba-like disease virus chemokine receptor 7L, a CCR8 orthologue. J. Gen. Virol., April 1, 2006; 87(Pt 4): 809 - 816. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Rosenkilde, T. N. Kledal, and T. W. Schwartz High Constitutive Activity of a Virus-Encoded Seven Transmembrane Receptor in the Absence of the Conserved DRY Motif (Asp-Arg-Tyr) in Transmembrane Helix 3 Mol. Pharmacol., July 1, 2005; 68(1): 11 - 19. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Lagane, S. Ballet, T. Planchenault, K. Balabanian, E. Le Poul, C. Blanpain, Y. Percherancier, I. Staropoli, G. Vassart, M. Oppermann, et al. Mutation of the DRY Motif Reveals Different Structural Requirements for the CC Chemokine Receptor 5-Mediated Signaling and Receptor Endocytosis Mol. Pharmacol., June 1, 2005; 67(6): 1966 - 1976. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. K. Gruijthuijsen, E. V. H. Beuken, M. J. Smit, R. Leurs, C. A. Bruggeman, and C. Vink Mutational analysis of the R33-encoded G protein-coupled receptor of rat cytomegalovirus: identification of amino acid residues critical for cellular localization and ligand-independent signalling J. Gen. Virol., April 1, 2004; 85(4): 897 - 909. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Liu, G. Sandford, G. Fei, and J. Nicholas G{alpha} Protein Selectivity Determinant Specified by a Viral Chemokine Receptor-Conserved Region in the C Tail of the Human Herpesvirus 8 G Protein-Coupled Receptor J. Virol., March 1, 2004; 78(5): 2460 - 2471. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Dadke, B. H. Fryer, E. A. Golemis, and J. Field Activation of p21-Activated Kinase 1-Nuclear Factor {kappa}B Signaling by Kaposi's Sarcoma-Associated Herpes Virus G Protein-Coupled Receptor during Cellular Transformation Cancer Res., December 15, 2003; 63(24): 8837 - 8847. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. U. Schraufstatter, K. Trieu, M. Zhao, D. M. Rose, R. A. Terkeltaub, and M. Burger IL-8-Mediated Cell Migration in Endothelial Cells Depends on Cathepsin B Activity and Transactivation of the Epidermal Growth Factor Receptor J. Immunol., December 15, 2003; 171(12): 6714 - 6722. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Mukaida Pathophysiological roles of interleukin-8/CXCL8 in pulmonary diseases Am J Physiol Lung Cell Mol Physiol, April 1, 2003; 284(4): L566 - L577. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Estep, M. K. Axthelm, and S. W. Wong A G Protein-Coupled Receptor Encoded by Rhesus Rhadinovirus Is Similar to ORF74 of Kaposi's Sarcoma-Associated Herpesvirus J. Virol., February 1, 2003; 77(3): 1738 - 1746. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cannon, N. J. Philpott, and E. Cesarman The Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Has Broad Signaling Effects in Primary Effusion Lymphoma Cells J. Virol., January 1, 2003; 77(1): 57 - 67. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Dhawan and A. Richmond Role of CXCL1 in tumorigenesis of melanoma J. Leukoc. Biol., July 1, 2002; 72(1): 9 - 18. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-J. Chiou, L. J. Poole, P. S. Kim, D. M. Ciufo, J. S. Cannon, C. M. ap Rhys, D. J. Alcendor, J.-C. Zong, R. F. Ambinder, and G. S. Hayward Patterns of Gene Expression and a Transactivation Function Exhibited by the vGCR (ORF74) Chemokine Receptor Protein of Kaposi's Sarcoma-Associated Herpesvirus J. Virol., April 1, 2002; 76(7): 3421 - 3439. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Smit, D. Verzijl, P. Casarosa, M. Navis, H. Timmerman, and R. Leurs Kaposi's Sarcoma-Associated Herpesvirus-Encoded G Protein-Coupled Receptor ORF74 Constitutively Activates p44/p42 MAPK and Akt via Gi and Phospholipase C-Dependent Signaling Pathways J. Virol., February 15, 2002; 76(4): 1744 - 1752. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. D. Ye Regulation of nuclear factor {kappa}B activation by G-protein-coupled receptors J. Leukoc. Biol., December 1, 2001; 70(6): 839 - 848. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. W. Shepard, M. Yang, P. Xie, D. D. Browning, T. Voyno-Yasenetskaya, T. Kozasa, and R. D. Ye Constitutive Activation of NF-kappa B and Secretion of Interleukin-8 Induced by the G Protein-coupled Receptor of Kaposi's Sarcoma-associated Herpesvirus Involve Galpha 13 and RhoA J. Biol. Chem., November 30, 2001; 276(49): 45979 - 45987. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Pati, M. Cavrois, H.-G. Guo, J. S. Foulke Jr., J. Kim, R. A. Feldman, and M. Reitz Activation of NF-{kappa}B by the Human Herpesvirus 8 Chemokine Receptor ORF74: Evidence for a Paracrine Model of Kaposi's Sarcoma Pathogenesis J. Virol., September 15, 2001; 75(18): 8660 - 8673. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Schwarz and P. M. Murphy Kaposi's Sarcoma-Associated Herpesvirus G Protein-Coupled Receptor Constitutively Activates NF-{{kappa}}B and Induces Proinflammatory Cytokine and Chemokine Production Via a C-Terminal Signaling Determinant J. Immunol., July 1, 2001; 167(1): 505 - 513. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. U. Schraufstatter, J. Chung, and M. Burger IL-8 activates endothelial cell CXCR1 and CXCR2 through Rho and Rac signaling pathways Am J Physiol Lung Cell Mol Physiol, June 1, 2001; 280(6): L1094 - L1103. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. N. Wakeling, D. J. Roy, A. A. Nash, and J. P. Stewart Characterization of the murine gammaherpesvirus 68 ORF74 product: a novel oncogenic G protein-coupled receptor J. Gen. Virol., May 1, 2001; 82(5): 1187 - 1197. [Abstract] [Full Text] |
||||
![]() |
S. Montaner, A. Sodhi, S. Pece, E. A. Mesri, and J. S. Gutkind The Kaposi's Sarcoma-associated Herpesvirus G Protein-coupled Receptor Promotes Endothelial Cell Survival through the Activation of Akt/Protein Kinase B Cancer Res., March 1, 2001; 61(6): 2641 - 2648. [Abstract] [Full Text] |
||||
![]() |
A. Sodhi, S. Montaner, V. Patel, M. Zohar, C. Bais, E. A. Mesri, and J. S. Gutkind The Kaposi's Sarcoma-associated Herpes Virus G Protein-coupled Receptor Up-Regulates Vascular Endothelial Growth Factor Expression and Secretion through Mitogen-activated Protein Kinase and p38 Pathways Acting on Hypoxia-inducible Factor 1{{alpha}} Cancer Res., September 1, 2000; 60(17): 4873 - 4880. [Abstract] [Full Text] |
||||
![]() |
J. A. Belperio, M. P. Keane, D. A. Arenberg, C. L. Addison, J. E. Ehlert, M. D. Burdick, and R. M. Strieter CXC chemokines in angiogenesis J. Leukoc. Biol., July 1, 2000; 68(1): 1 - 8. [Abstract] [Full Text] |
||||
![]() |
M. M. Rosenkilde, T. N. Kledal, P. J. Holst, and T. W. Schwartz Selective Elimination of High Constitutive Activity or Chemokine Binding in the Human Herpesvirus 8 Encoded Seven Transmembrane Oncogene ORF74 J. Biol. Chem., August 18, 2000; 275(34): 26309 - 26315. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. H. Ho, N. Ganeshalingam, A. Rosenhouse-Dantsker, R. Osman, and M. C. Gershengorn Charged Residues at the Intracellular Boundary of Transmembrane Helices 2 and 3 Independently Affect Constitutive Activity of Kaposi's Sarcoma-associated Herpesvirus G Protein-coupled Receptor J. Biol. Chem., January 5, 2001; 276(2): 1376 - 1382. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |