The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kisich, K. O.
Right arrow Articles by Erickson, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kisich, K. O.
Right arrow Articles by Erickson, K. L.
The Journal of Immunology, 1999, 163: 2008-2016.
Copyright © 1999 by The American Association of Immunologists

Specific Inhibition of Macrophage TNF-{alpha} Expression by In Vivo Ribozyme Treatment1

Kevin O. Kisich2,*, Robert W. Malone3,{dagger}, Paul A. Feldstein4,{ddagger} and Kent L. Erickson5,*

Departments of * Cell Biology and Human Anatomy, and {dagger} Medical Pathology, School of Medicine, and {ddagger} Department of Plant Pathology, University of California, Davis, CA 95616


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The overproduction of the cytokine TNF-{alpha} is associated with inflammatory and autoimmune diseases. We have developed a means to block TNF-{alpha} production with ribozymes directed against TNF-{alpha} mRNA to selectively inhibit its production in vitro and in vivo. Following cationic lipid-mediated delivery to peritoneal murine macrophages in culture, anti-TNF-{alpha} ribozymes were more effective inhibitors of TNF-{alpha} secretion than catalytically inactive ribozyme controls. Inhibition of TNF-{alpha} secretion was proportional to the concentration of ribozyme administered, with an IC50 of ~10 nM. After i.p. injection of cationic lipid/ribozyme complexes, elicited macrophages accumulated ~6% of the administered ribozyme. The catalytically active ribozyme suppressed LPS-stimulated TNF-{alpha} secretion by ~50% relative to an inactive ribozyme control without inhibiting secretion of another proinflammatory cytokine produced by macrophages, IL-1{alpha}. Ribozyme-specific TNF-{alpha} mRNA degradation products were found among the mRNA extracted from macrophages following in vivo ribozyme treatment and ex vivo stimulation. Thus, catalytic ribozymes can accumulate in appropriate target cells in vivo; once in the target cell, ribozymes can be potent inhibitors of specific gene expression.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Tumor necrosis factor-{alpha} is a proinflammatory cytokine produced primarily by activated cells of the monocyte/macrophage lineage (1). Although TNF-{alpha} is necessary for normal immune responses to pathogens, when overproduced, TNF-{alpha} can cause acute shock-like symptoms (2), cachexia (3), or chronic autoimmune reactions such as rheumatoid arthritis or multiple sclerosis (4, 5). One method for blocking acute shock-like symptoms involves the use of Abs against TNF-{alpha}. For example, the development of sepsis in mice following LPS administration was blocked by pretreatment of the mice with anti-TNF-{alpha} neutralizing antiserum (6). Moreover, treatment of mice or humans with anti-TNF-{alpha} mAbs ameliorated many of the symptoms of rheumatoid arthritis (7).

Although TNF-{alpha} function can be blocked with soluble receptors for or mAb against TNF-{alpha}, we sought to develop a method to inhibit TNF-{alpha} production at the gene transcriptional level. Inhibition of TNF-{alpha} production may be a more efficient method in treating conditions associated with its overexpression than blocking protein binding, because no immune complexes would be formed. Thus, we have developed methods for synthesizing and delivering catalytic RNA specific for TNF-{alpha} and have used an in vivo murine peritoneal macrophage model to demonstrate and examine the biological response to the gene therapy.

One approach to block gene expression is through the use of ribozymes. Those RNA molecules have enzymatic properties to catalyze specific RNA cleavage. Thus, development of an effective ribozyme-based strategy to reduce gene expression requires the design and synthesis of oligonucleotides that efficiently cleave the target mRNA, as well as their delivery or expression within the appropriate cells. For that purpose, several ribozyme motifs including the group I intron of Tetrahymena thermophyla (8), self-splicing group II introns, hepatitis {delta} virus ribozymes (9), Neurospora VS RNA (10), Ribonuclease P, and hairpin and hammerhead ribozymes have been adapted to trans cleavage of substrate RNA (11, 12). Hammerhead motif ribozymes common to the (+)-strands of plant satellite RNA have been shown to suppress gene expression in several experimental models (13, 14, 15). The hammerhead was chosen for these studies due to its requirements for a minimal substrate recognition sequence in the mRNA target, as well as its small size relative to other ribozyme motifs (11). Moreover, a number of the factors that may influence hammerhead ribozyme activity against TNF-{alpha} in vitro have been previously defined (16). Specificity of the ribozymes for TNF-{alpha} mRNA was achieved by altering the sequences in the 5' and 3' regions of the ribozymes such that they were complementary to the targeted region of TNF-{alpha} mRNA.

Ribozymes are not normally present in mammalian cells. Thus, to inhibit gene expression, ribozymes must enter the cytoplasm or nucleus where they can cleave the targeted mRNA. Cationic transfection lipids, cytofectins, are one group of vehicles used for in vitro delivery of RNA (17), including preformed ribozymes (13), into mammalian cells. RNA transfection into a promonocytic cell line has been demonstrated (13, 17), but reports documenting transfection of primary macrophages in vivo have yet to be published. Different cultured cells appear to require different cytofectins for optimal delivery of polynucleotides.

Ribozymes must be catalytically active after delivery to the target to offer advantages over antisense oligonucleotides. Previous reports of ribozyme inhibition of TNF-{alpha} secretion did not demonstrate this key feature. In this paper, we have demonstrated that ribozymes consisting of only RNA can be delivered efficiently and intact to the appropriate target cells in vivo. We have evaluated four cationic lipid formulations for ribozyme delivery, both in vitro and in vivo, by assessing the amount of intact ribozyme within the cells as well as the degree of inhibition of TNF-{alpha}. Hammerhead ribozymes delivered to macrophages in vivo were biologically active by virtue of their ability to inhibit TNF-{alpha} secretion and catalyze the degradation of the TNF-{alpha} mRNA into smaller fragments, activities that were dependent on the catalytic capacity of the ribozymes.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Ribozyme design and synthesis

Ribozymes were designed according to the method previously described (11, 16), with modifications. Ribozyme sites were chosen based on proximity to the beginning of the coding region of the mRNA (rz254 and rz254sp) or production of fragments of similar electrophoretic mobility (rz442 and rz442sp) (16). Rz254 was targeted to cleave at position 254 and Rz442 was to cleave at position 442 of the TNF-{alpha} cDNA. Rz254sp and rz442sp were self-processing (sp), whereas rz254 and rz442 had the self-processing domains removed. Mini monomer (mm) constructs, rzmm442/24 and rzmm442/10, were based on site 442 for comparison with the linear ribozymes rz442 and rz442sp. For that, rz442 was inserted into the variable domain of an autocircularizing hairpin ribozyme, m101 (12) to create rzmm442/24. Reduction of the target recognition bases of rzmm442/24 from 12 nt to 5 nt for each arm created rzmm442/10. RNA sequences of the ribozymes with the hammerhead sequence underlined were as follows: Rz254, 5'-GGGCGAGAAGAGGCUGACUGAUGAGUCCGUGAGGACGAAACAUAGGCACCG; Rz254sp, 5'-GGGCGAAUUCGAGCUCGGUACCCGGGGAUCUCCUAUGUCUCAGCAAAAGAAGAGGCUGACUGAUGAGUCCGUGAGGACGAAACAUAGGCACCG; Rz442, 5'-GGGGUGGUUUGCUACCUGAUGAGUCCGUGAGGACGAAACGUGGGCUACA; Rz442sp, 5'-GGGCGAAUUCGAGCUCGGUACCCGGGGAUCACGUCGCAAAAGUGGUUUGCUACCUGAUGAGUCCGUGAGGACGAAACGUGGGCUACA; Rzmm442/24, 5'-GGGCGAAUUCUGACAGUCCUGUCCGUAUGACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAUAUUACCUGGUACCCGGGGAUCCUCUAGAGGGCGAGUGGUUUGCUACCUGAUGAGUCCGUGAGGACGAAACGUGGGCUACAGGGGCCCUGACCGUCCUGUUUAAGCUU; and Rzmm442/10, 5'-GGGCGAAUUCUGACAGUCCUGUCCGUAUGACAGAGAAGUCAACCAGAGAAACACACGUUGUGGUAUAUUACCUGGUACCCGGGGAUCCUCUAGAGGGCGGCUACCUGAUGAGUCCGUGAGGACGAAACGUGGGGGCCCUGACCGUCCUGUUUAAGCUU. Inactive ribozymes had the altered core sequence: CUGAUUAGUCCGUGAGGACGAUAC and are designated with a suffix -d, e.g., Rz254d is the inactive version of Rz254.

Ribozyme sequences were synthesized as complementary oligonucleotides (Gene Assembler Plus; Pharmacia, Uppsala, Sweden); ligated into pGEM3z (Promega, Madison, WI) between EcoRI and HindIII restriction sites (17). Ribozymes were prepared by in vitro transcription of HindIII linearized templates with T7 RNA polymerase (New England Biolabs, Beverly, MA) using a protocol for the synthesis of large amounts of RNA (18). Polynucleotides were purified by chromatography over Sephadex G-50 spin columns (Pharmacia) to remove unincorporated nucleotides. Concentrations were determined by electrophoresis of sample aliquots on 8% polyacrylamide gels containing 7 M urea and densitometric comparisons to standards of known concentration. Prepared ribozymes were stored at -70°C until needed.

Labeling of ribozymes

For studies of stability in tissue culture and in vivo biodistribution, ribozymes were internally labeled with [{alpha}-32P]CTP. In vitro transcription reactions, as described above, were performed in the presence of [{alpha}-32P]CTP (3000 Ci/mmol; NEN, Boston, MA). The concentration of [{alpha}-32P]CTP in the transcription reactions was maintained at 1 µM, compared with 1 mM for unlabeled CTP. This ratio resulted in high specific activity labeled ribozymes; it was purified by size exclusion chromatography as described above and quantitated by liquid scintillation counting (Beckman, Palo Alto, CA). Internally labeled ribozyme was diluted with unlabeled ribozyme in some experiments to achieve the correct specific activity.

Fluorescent labeling was accomplished by in vitro transcription in the presence of 0.1 mM Fluorescein-12-UTP (Roche, Indianapolis, IN), with a reduction of the concentration of UTP to 0.1 mM. This was predicted to result in approximately two molecules of Fluorescein-12-UTP incorporated into each ribozyme molecule, depending on the sequence of the particular ribozyme construct. Unincorporated nucleotides, including Fluorescein-12-UTP, were removed by chromatography as described above. The level of fluorescence was measured in a spectrofluorometer before use.

Kinetics

Initial rates of substrate cleavage were established for single turnover conditions. Ribozymes were all assayed at 40 nM, with a substrate concentration of 0.4 nM. RNA substrate for site 254 had the sequence 5'-CGGTGCCTATGTCTCAGCCTCTTCT-3'; RNA substrate for site 442 had the sequence 5'-TGTAGCCCACGTCGTAGCAAACCAC-3'. Substrates were synthesized by in vitro transcription of fully complementary DNA oligonucleotides. Substrates were 5'-end labeled by exchange phosphorylation with [{gamma}-32P]ATP (NEN) and T4 polynucleotide kinase (Promega). 32P end-labeled substrates were purified by electrophoresis on 12% polyacrylamide gels containing 7 M urea, followed by excision and elution into 1 mM EDTA. Excess salts and urea were removed by column chromatography over Sephadex G-25 (Pharmacia) before addition of purified, unlabeled substrate to the correct specific activity. Ribozyme and 32P end-labeled substrate were diluted to a final concentration in 10 mM MgCl2 and 50 mM Tris (pH 7.5) and individually heated briefly to 90°C to disrupt secondary structure. Ribozyme and substrate were then cooled to 37°C and combined. Aliquots of the reaction mixture were removed at 0, 1, 5, 30, and 120 min and mixed with a stop buffer of 5 mM EDTA, 97% formamide, and 0.01% bromphenol blue at 4°C. The percentage of the substrate remaining intact was determined by gel electrophoresis of the reaction aliquots and quantitated by autoradiography with storage phosphor screens (PhosphorImager, Molecular Dynamics, Sunnyvale, CA). The fraction of substrate uncleaved vs time were fit to a double exponential curve, y = m1e(-m2m0) + m3e(m4m0), where m1 = the fraction of the substrate cleaved at rate m2, = the initial rate of cleavage, m3 = the fraction of the substrate cleaved at rate m4, and m4 = the terminal rate of cleavage.

Mice and macrophages

Six-week-old female C57BL/6NCR mice were maintained as specific pathogen free in autoclaved cages in a laminar flow hood and given sterilized water to minimize "spontaneous" activation of macrophages. To produce responsive macrophages, 2 ml of sterile fluid thioglycollate broth (Difco, Detroit, MI) was injected i.p. After three days the resulting peritoneal exudate cells (PEC)6 were obtained by lavage with HBSS and plated at 5 x 105 cells/well in 96-well plates with Eagles minimal essential medium (EMEM) and 10% heat inactivated FBS. After 90 min, the wells were washed to remove nonadherent cells. The resulting cultures were 97% macrophages as determined by morphology and staining for nonspecific esterase.

Transfection in vitro

The cytofectins, 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-n,n-dimethyl-1-propanaminium trifluoroacetate (DOSPA, Lipofectamine, Life Technologies/BRL, Bethesda, MD), N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride (DOTMA, Lipofectin, Life Technologies/BRL), or N-[1-(2,3-dioloyloxy)propyl]-N,N,N-trimethylammonium methylsulfate (DOTAP) were mixed at 3:1 (w/w) with dioleoyl phosphatidylethanolamine (DOPE) in chloroform. Mixtures were rotary evaporated to form thin films, placed under vacuum overnight to remove residual chloroform, and hydrated with DMEM by vortex mixing to form a 2 nM lipid emulsion. An equal volume of ribozyme RNA was then added to make a final concentration of 80 µg/ml and the mixture was vortexed. The resulting liposome/RNA complexes in DMEM remained at 25°C for 30 min before further manipulation. Complexes were then added to macrophage cultures in serum-free DMEM and incubated at 37°C for 3 h. The cultures were gently rinsed once with fresh DMEM and medium containing 10% FBS added. Medium and serum endotoxin levels were <0.1 ng/ml as determined by the supplier; all other reagents contained <0.1 ng/ml endotoxin as quantified by the Limulus amebocyte lysate assay.

Transfection in vivo

Transfection reagents were prepared as described above and also included 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide (DMRIE, Vical, La Jolla, CA):DOPE, 1:1 (w/w) and dioctadecyamidoglycylspermine (DOGS, Transfectam; Promega):DOPE, 2:1 (w/w). An equal volume of ribozyme was added to achieve 80 µg/ml. After vortexing, 1 ml of the resulting liposome: RNA complexes were injected i.p. into mice previously treated with thioglycollate. PEC were harvested 3 h later by peritoneal lavage with HBSS. The exudates were plated at 1 x 105 cells/well in 96-well plates and allowed to adhere for 2 h before washing with HBSS to remove nonadherent cells.

Quantitation of ribozymes in cells and organs

Ribozymes, labeled internally with fluorescein or 32P and injected i.p., as described above, were quantitated in peritoneal macrophages and organs radiometrically. After various intervals, mice were asphyxiated with CO2, peritoneal cells were harvested by lavage, and ribozymes were counted as described above. Spleen, kidney, liver, intestine, lung, and pancreas were also harvested and weighed. Organs were homogenized on ice in a 10-fold excess of RNAzol (Tel-Test, Friendsville, TX). A volume of each homogenate equivalent to 10% of the original material was added to scintillation counting fluid (Beckman, Palo Alto, CA) to determine the amount of 32P associated with the tissue. The remainder of the homogenate was processed for extraction of total RNA, according to instructions from the manufacturer. 32P were assessed by scintillation counting in each step of the isolation to determine the efficiency of RNA recovery. The RNA isolation process resulted in recovery of >85% of the 32P from solid tissues and >95% from peritoneal exudate macrophages. The extracted RNA was separated by electrophoresis through 10% sequencing-size polyacrylamide gels containing 7 M urea as described above. The gels were run approximately half way such that no material was lost into the lower buffer tank. An aliquot of 32P-labeled ribozyme, which had not been injected, was used as a standard. Gels were exposed to storage phosphor screens overnight. The screens were quantitated using Imagequant software (Molecular Dynamics). Bands comigrating with the ribozyme standards and the total activity in each lane were quantitated. The fraction of ribozyme intact for each sample was determined by dividing the integrated density from the intact band by the integrated density of the entire lane. The total amount of intact ribozyme in each tissue was derived from the measured radioactivity by the following formula: (10 x DPM x (Mol/DPM)) x fraction intact/weight of tissue.

Cytokine production and quantitation

After transfection, macrophages isolated as described above were treated with 1 µg/ml phenol extracted LPS, Escherichia coli serotype 011:B4 in EMEM and 10% FBS to induce cytokine production. Aliquots of supernatants were harvested and replaced with fresh EMEM after 0, 2, 4, 8, 12, and 24 h of LPS stimulation and stored at -70°C. TNF-{alpha} was quantitated by a specific ELISA. Briefly, 96-well plates were coated with rabbit anti-mouse TNF-{alpha} serum at 1:1000 dilution (Genzyme, Cambridge, MA) followed by blocking with 1% powdered milk and incubation with the test supernatants. TNF-{alpha} was then detected using a murine TNF-{alpha}-specific hamster mAb (Genzyme). The ELISA was developed with goat anti-hamster IgG coupled to alkaline phosphatase (19). IL-1{alpha} was quantitated by an ELISA similar to that described for TNF-{alpha} with the substitution of rabbit anti-mouse IL-1{alpha} serum and murine IL-1{alpha}-specific hamster mAb (Genzyme) for the TNF-{alpha}-specific reagents.

RNA extraction and Northern blot analysis

Four hours after LPS stimulation macrophage monolayers were extracted with RNAzol (Tel-Test), as described by the manufacturer, to obtain total cellular RNA. The extraction procedure maintains the integrity of RNA with the presence of guanidine isothiocyanate to denature proteins, EDTA to chelate heavy metals and Mg2+, and low temperature. Our previous studies and those of others demonstrated that hammerhead ribozyme activity was not detectable in the absence of Mg2+ and was inhibited by low temperature (20, 21). RNA was then denatured by heating to 65°C for 15 min with 75% formamide and separated on a 1% agarose gel containing 2% formaldehyde (16). The gel was then stained with ethidium bromide, photographed, and transferred to Nytran membranes (Schleicher & Schuell, Keene, NH). The resulting blots were probed with 32P-labeled murine TNF-{alpha} cDNA probe prepared by random priming according to the manufacturer’s protocol (Pharmacia). Autoradiography was performed without enhancer screens to maximize resolution of individual bands.

Assessment of reagent toxicity

Following ribozyme/lipid treatment of macrophages and harvesting of supernatants, viability of the cells was assessed by incubation with 5 mg/ml of MTT. This compound is reduced by the mitochondrial dihydrogenases, the activity of which correlates well with cell viability (22). After 12 h, the absorbance of reduced MTT was measured at 585 nm.

Statistical analysis

Differences between treatments were tested for significance using Student’s t test. A p value of 0.05 or less was considered significant.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Kinetic parameters of ribozymes tested

Several permutations of the hammerhead ribozyme motif were evaluated for potential use with endogenous expression systems. Several alterations were tested because we have previously determined that excess RNA beyond the binding arms of the hammerhead ribozyme was detrimental to catalytic activity in vitro (16). Thus, both the self-processing and minimonomer versions were designed to splice themselves from longer transcripts, as might be required for expression from gene therapy vectors in vivo. The self-processing pathways are illustrated in Fig. 1Go. The ability of ribozymes to cleave the target RNA sequence was evaluated and the initial rates are summarized in Table IGo. The kinetic data were fit to double exponential decay curves; the rates observed for the first, more rapid phase of the cleavage reaction are reported. Rz254 initially cleaved 39% of the substrate with a rate of 0.17/min. The addition of the self-processing domain to rz254sp increased the initial fraction cleaved to 66% with a rate of 1.42/min. Rz442 initially cleaved 36% of its substrate with a rate of 0.48/min. Addition of a self-processing domain to rz442sp reduced the initial fraction cleaved and the rate slightly. Rz442, which was inserted into the variable domain of an autocircularizing hairpin ribozyme, rzmm442/24, also had a reduction in the initial fraction cleaved and the initial rate of cleavage to 23% and 0.16/min. The initial rate of cleavage for the ribozyme with the number of target recognition nucleotides reduced to 10, rzmm442/10, was at least 100-fold less catalytic than that of rzmm442/24. Controls, the mutant versions of the above ribozymes, had no detectable cleavage activity (data not shown).



View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 1. Schematics of self-processing ribozymes. A, Rz254sp was designed to process itself from a longer transcript, such as could be made efficiently by RNA polymerase III. The ribozyme was designed to be placed near the 3' end of the transcript and cleave the 5' portion at the site of the arrow. B, Rzmm442/24 was designed to cleave excess RNA both 5' and 3' of the ribozyme domain. C, The ribozyme then circularized so as to protect the ends from exonuclease activity.

 

View this table:
[in this window]
[in a new window]
  		Table I. Initial rate and fraction of substrate cleaved by ribozyme1

 
Ribozyme delivery to peritoneal macrophages in cell culture

Initially, we sought to determine whether cationic lipid could be used to deliver intact ribozymes to primary macrophages. For that, ribozyme RNA was prepared by in vitro transcription from the appropriate DNA templates. Murine peritoneal macrophages were treated in vitro with cationic lipid/RNA complexes at a charge ratio of 1:1. After 3 h, the complexes were removed and macrophages washed with HBSS containing RNase A to remove ribozymes on the outside of the plasma membrane. Fig. 2Go shows autoradiograms of ribozyme RNA extracted from murine peritoneal macrophages after various periods of time. Based on scintillation counting of the ribozyme bands cut from the gel, ~104 ribozyme molecules per cell were recovered 3 h after transfection. This represented ~5% of the ribozyme added in vitro. More than 50% of the ribozymes remained intact 24 h after the end of the 3-h transfection period. Therefore, the intracellular half-life could not be precisely determined, but was longer than 24 h.



View larger version (91K):
[in this window]
[in a new window]
  		FIGURE 2. Stability of ribozymes after cationic lipid mediated delivery to responsive murine macrophages. Lanes 1, 4, and 7, ribozymes immediately before mixing with cationic lipid; lanes 2, 5, and 8, ribozymes and degradation products extracted from peritoneal macrophages 3 h after addition; lanes 3, 6, and 9, ribozymes and degradation products extracted 24 h after transfection. Note that the full-length rz254 (95 bases) self processes, resulting in mature rz254 of 63 bases and a 32-base fragment of the polylinker sequence derived from the vector.

 
Specific inhibition of TNF-{alpha} secretion after ribozyme treatment

After in vitro transfection, macrophages were stimulated with LPS to induce TNF-{alpha} production. Fig. 3Go illustrates inhibition of TNF-{alpha} produced after treatment with DOTMA:DOPE complexed with various ribozymes directed to site 254 or 442 of murine TNF-{alpha} mRNA. Eight hours after LPS stimulation, the self-processing ribozymes, rz254sp and rz442sp, inhibited macrophage TNF-{alpha} secretion by 80%. In contrast, an irrelevant ribozyme targeted to human stromelysin inhibited secretion of TNF-{alpha} by 34%, a level similar to another control with lipid only. Rz254sp and rz442sp were the only constructs relative to their inactive homologues to significantly inhibit TNF-{alpha} secretion. Removal of the self-processing domains reduced the ability of rz254 and rz442 to inhibit TNF-{alpha}. After removal of those domains, catalytic activity did not differ from their inactive controls. Incorporation of rz442 into a minimonomer, rzmm442/24, did not change its inhibitory activity. Active and inactive versions of rzmm442/10, containing 10-bp recognition domains, inhibited TNF-{alpha} secretion by ~55% relative to sham-treated cells. However, when compared with cells treated with irrelevant ribozyme or lipid only, there were no significant differences.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 3. Inhibition of TNF-{alpha} secretion by ribozymes delivered to macrophages in culture. Data are the mean ± SD for inhibition of TNF-{alpha} secretion as determined by ELISA after treatment with ribozyme/DOTMA:DOPE complexes relative to sham treated cells. Sham treatment was macrophages in medium only. Those cells secreted ~75 ng/ml TNF-{alpha} after 8 h of stimulation. Cells not cultured with LPS secreted < 10 pg/ml TNF-{alpha}. *, p < 0.01 relative to inactive control; +, p<0.01 relative to irrelevant ribozyme.

 
To better characterize the inhibitory activities of some of the ribozymes tested, a dose response experiment was performed with the active rz254sp, the inactive rz254spd, or an irrelevant ribozyme (Fig. 4GoA). Rz254sp at ~17 nM (IC50 = 10.7 nM) inhibited 50% of the TNF-{alpha} secretion, a 58% lower concentration than required for the inactive ribozyme (IC50 = 24 nM). The inactive ribozyme inhibited significantly (p = 0.05) more TNF-{alpha} secretion than the irrelevant ribozyme at 51 nM. This finding indicates a possible base pairing sequence-specific effect not due to the catalytic activity of the ribozyme. The irrelevant ribozyme also inhibited some TNF-{alpha} secretion (IC50 = 56.3 nM). To assess target specificity, macrophage IL-1{alpha} production after LPS-stimulation was also measured. IL-1{alpha} secretion was not altered by the concentrations of cationic lipid/ribozyme treatments used in these experiments (Fig. 4GoB).



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 4. TNF-{alpha} and IL-1{alpha} secreted by LPS-stimulated macrophages following transfection in vitro with ribozymes. Peritoneal macrophages were transfected with 2.75 µg/ml DOTMA:DOPE alone or with increasing concentrations of the irrelevant ribozyme to TNF-{alpha} or IL-1{alpha} ({circ}), rz254sp ({square}), or rz254spd ({diamond}) complexed with DOTMA:DOPE. After 3 h macrophages were stimulated with 1 µg/ml LPS. Aliquots of supernatants were harvested 8 h after stimulation and assayed by an ELISA for TNF-{alpha} (A) or IL-1{alpha} (B). The maximum concentration of TNF-{alpha} recovered after LPS treatment with or without cytofectins was 83.5 ng/ml. Macrophages cultured in medium alone produced <10 pg/ml. Concentrations are means ± SD for one representative experiment of three.

 
Because toxicity of the cationic lipids or the lipid/RNA complex could lead to a reduction of TNF-{alpha} production, lipid alone, lipid/RNA, or lipid/RNA and LPS were assessed for alteration in cell viability. DOSPA:DOPE alone or in combination with any of the ribozymes tested at concentrations to 114 nM were not toxic as measured by the MTT assay for mitochondrial enzyme activity. Concentrations >114 nM inhibited macrophage reduction of MTT, indicating some toxicity (data not shown). LPS either alone or in combination with DOSPA, DOTMA, DOGS:DOPE, DMRIE:DOPE or ribozyme were more cytotoxic than the cationic lipid/ribozyme complex without LPS.

Intraperitoneal accumulation of ribozymes in macrophages and other sites

A significant challenge for use of preformed ribozymes in vivo is to achieve sufficient ribozyme concentrations within cells following systemic administration. Fig. 5Go demonstrates macrophage accumulation of intact ribozymes following i.p. administration of a cationic lipid/ribozyme complex. Peritoneal macrophages accumulated ~3 x 106 intact ribozyme molecules per cell at the concentration of DOSPA:DOPE/ribozyme tested, or ~6% of the administered ribozyme. They were distributed within the nuclei and cytoplasm of the majority of adherent macrophages 2 h after administration of the DOSPA:DOPE/ribozyme complex as detected by fluorescence microscopy (Fig. 6Go). With the cytofectins, DMRIE:DOPE, ~3 x 105 intact ribozymes accumulated per cell, and with DOTMA ~1.5 x 104 intact ribozymes per cell. Ribozymes administered without cationic lipid were not detectable within the macrophages. Spleen, kidney, liver, intestine, lung, and pancreas also accumulated some intact ribozyme when delivered as a complex with DMRIE:DOPE or DOSPA:DOPE. Those organs accumulated between 0.25 and 1.0% of the administered dose.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 5. Number of ribozymes taken up by macrophages in vivo after 8 h. 32P ribozymes were complexed with transfection lipid and 1 ml of the complex injected i.p. Macrophages were harvested after 8 h and ribozymes quantitated. Values represent the mean of intact ribozymes x 106/macrophage ± SD (n = 5).

 


View larger version (82K):
[in this window]
[in a new window]
  		FIGURE 6. Macrophages 2 h after i.p. administration of ribozyme. A, Responsive peritoneal macrophages after i.p. administration of fluorescent-ribozyme/DOSPA:DOPE complex. B, Epifluorescence of the same field as A. C, Macrophages 2 h after treatment with HBSS. D, Epifluorescence of the same field as C.

 
Inhibition of TNF-{alpha} secretion following i.p. ribozyme administration

To assess ribozyme efficacy following in vivo transfection, peritoneal macrophages were harvested 3 h after i.p. ribozyme administration and TNF-{alpha} secretion assessed by specific ELISA (Fig. 7GoA). Macrophages from mice treated with rz254sp produced 70% less TNF-{alpha} than macrophages from control mice treated with only HBSS. The inactive ribozyme, rz254spd, reduced TNF-{alpha} expression by 37%. Neither DOSPA:DOPE alone nor complexed with an irrelevant ribozyme were significantly (p > 0.05) inhibitory. There were no significant (p > 0.05) differences in the levels of IL-1{alpha} secreted by the same cell among the various treatment groups (Fig. 7GoB).



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 7. TNF-{alpha} and IL-1{alpha} secretion by macrophages transfected in vivo with ribozymes. TNF-{alpha} (A) and IL-1{alpha} (B) secretion by responsive macrophages harvested from mice 3 h after i.p. administration of ribozyme complexed with DOSPA:DOPE in 1 ml HBSS. {square}, HBSS only; {diamond}, DOSPA:DOPE only; {circ}, irrelevant rz + DOSPA:DOPE; {triangleup}, rz254sp + DOSPA:DOPE; {boxplus}, rz254spd + DOSPA:DOPE and treated with 1 µg/ml LPS. Cytokine secretion was measured by an ELISA. Results are from a single experiment, which was representative of three trials.

 
Accumulation of TNF-{alpha} degradation products after ribozyme treatment

If suppression of TNF-{alpha} secretion was due to cleavage of the TNF-{alpha} mRNA by the ribozymes, then mRNA cleavage products should be present within the cells. Therefore, Northern blot analysis was conducted with total cellular RNA extracted from macrophages 8 h after LPS stimulation or 11 h posttransfection (Fig. 8Go). Mature TNF-{alpha} mRNA should be ~1800 bases. Rz254sp should cleave the mRNA into fragments of ~250 and 1550 bases, and rz442sp into fragments of ~440 and 1360 bases (16). Macrophages from mice treated with the active ribozymes, rz254sp or rz442sp, had TNF-{alpha} mRNA degradation products of ~100 or 200 bases. RNA from all macrophages, which were treated with either active or inactive ribozyme, but not irrelevant ribozyme or control, had an additional hybridization product at ~2.6 kb for active ribozyme, or 3.0 kb for inactive ribozyme. Those are within the correct size range for primary transcripts of the TNF-{alpha} gene, 2960–3000 bases including polyadenylation.



View larger version (113K):
[in this window]
[in a new window]
  		FIGURE 8. Northern blot of RNA extracted from macrophages transfected in vivo with ribozymes. RNA was extracted from responsive peritoneal macrophages following i.p injection of ribozymes and stimulation with 1 µg/ml LPS in culture. RNA was separated, electrophoresed, and transferred to membranes, followed by probing with a 32P-labeled TNF-{alpha} cDNA.

 
PEC recruitment after treatment with cationic lipid/ribozyme complexes

The number of adherent peritoneal cells recovered from mice increased after treatment with 40 µg of rz442 complexed with DOSPA:DOPE, DMRIE:DOPE, or DOTMA:DOPE at a 3:1 charge ratio. Each of the complexes induced approximately a 400% increase in the number of peritoneal exudate cells recovered 24 h after treatment (Fig. 9Go).



View larger version (16K):
[in this window]
[in a new window]
  		FIGURE 9. Number of peritoneal exudate cells following i.p. administration of ribozyme/cationic lipid complexes. The mean ± SD (n = 5) of adherent PEC after injection of 40 µg of ribozyme complexed with DOSPA:DOPE ({circ}), DMRIE:DOPE ({square}), or DOTMA:DOPE ({diamond}).

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
We have demonstrated that anti-TNF-{alpha} ribozymes can inhibit TNF-{alpha} secretion in a sequence-specific and concentration-dependent manner. Furthermore, cationic lipids can be used to deliver these potentially therapeutic RNA molecules to cells in vitro and in vivo. After controlling for nonspecific inhibition due to toxicity of the cationic lipid/RNA complex, we have shown that ribozymes targeted to different sites of the TNF-{alpha} mRNA inhibited TNF-{alpha} production in culture. We now demonstrate the transfection of ribozymes into macrophages in vivo resulted in suppression of TNF-{alpha} production. Ribozymes accumulated in macrophages following i.p. administration were biologically active and inhibited TNF-{alpha} secretion by ~70%. Rz254sp and rz442sp both showed better inhibitory activity than their inactive controls, demonstrating that catalytic activity was required for maximal suppression. Irrelevant ribozyme did not significantly inhibit the cytokine secretion. Ribozymes delivered with DOSPA:DOPE to murine peritoneal macrophages as complexes were effective in suppressing TNF-{alpha} gene expression for a 24-h period.

The cleavage rates of the ribozymes tested in this study varied greatly under single turnover conditions. For rz442, addition of more sequence beyond the substrate recognition domains reduced the initial rate of catalysis. That may be due to improper folding of a larger structure, which could result in reduced, or no, cleavage of the substrate. In contrast to rz442sp, the catalytic activity of rz254sp was unexpected because with single turnover conditions the catalytic rate of rz254sp was faster than rz254. The latter had no additional sequences beyond the binding arms. The 5' half of the self-cleavage domain should compete with substrate for the binding arms, slowing the cleavage rate of rz254sp relative to rz254, but that did not occur in our experiments. This kinetics issue is being explored in additional studies.

Embedding rz442 within the minimonomer construct served two theoretical purposes. First, the covalently closed circle formed by the minimonomer should be stable to exonucleases, thus enhancing the in vivo half-life of the molecule. However, we were unable to demonstrate a greater half-life of rzmm442/24 within the time period studied, as rz442sp was quite stable in primary macrophages. Second, the minimonomer domain could act as a small, highly structured RNA carrier, which would allow self-processing from a longer transcript. However, the catalytic activity of rzmm442/24 was reduced by 66% relative to rz442. It is possible that further refinement of the 5' and 3' junctions of the hammerhead ribozyme within the minimonomer will allow for greater activity.

Our study of intracellular stability indicated that the ribozymes were quite stable when delivered as cationic-lipid complexes to cultured macrophages. Moreover, there was little additional self-processing activity observed for rz442sp after forming complexes with cytofectins. This may indicate that most of the ribozyme remained sequestered as a complex with the cationic lipid within the endosomes. This possibility is supported by the light micrographs which show a nonuniform cytoplasmic distribution of the ribozyme consistent with its association with the endosomes.

Ribozymes targeted to sites 254 and 442 of murine TNF-{alpha} mRNA were able to inhibit TNF-{alpha} secretion significantly better than their inactive counterparts or an active unrelated ribozyme. This finding demonstrates the requirement of catalytic activity for maximal inhibition. However, the inactive and irrelevant controls had some inhibitory activity. Up to 39% of the total inhibition observed for rz254sp and rz442sp was probably due to toxicity and other nonspecific causes. Enhanced inhibition by the inactive compared with the irrelevant ribozyme indicated that the inhibition of TNF-{alpha} secretion by rz254sp was partially due to a sequence-specific activity of the inactive ribozyme independent of its catalytic activity.

A dose-response study was used to evaluate the relative potencies of rz254sp, rz254spd, as compared with the irrelevant ribozyme. The lipid/ribozyme complexes used did not significantly inhibit IL-1{alpha} secretion, indicating that catalytic activity was potentially specific for TNF-{alpha}. The relative activities of the oligonucleotides indicated that the nonspecific, sequence specific, and ribozyme specific activities could be distinguished, but does not account for the sequence-specific, non-ribozyme effect. Inhibition due to an antisense effect was improbable because the inactive ribozyme was too short to interrupt the progress of ribosome translocation along the mRNA (23), and chemically incapable of stimulating RNase H to degrade the mRNA as would antisense DNA (24).

Rz254, rzmm442/10, and rzmm442/24 were unable to inhibit TNF-{alpha} secretion in a catalytically dependent manner. The inhibition observed for these ribozymes was either nonspecific or a combination of nonspecific and sequence-specific non-ribozyme effects. Rz254 was very similar in sequence to another ribozyme, mRz1, reported to inhibit TNF-{alpha} by 49.1% in culture at a concentration of 5 µM when complexed with the cytofectin, DOTAP (25). We also found this same ribozyme to inhibit TNF-{alpha} by 48.9%, but the inactive control also inhibited activity by 48.6%. Neither of these ribozymes were significantly more inhibitory than DOTMA:DOPE alone or the irrelevant ribozyme complexed with DOTMA:DOPE. Ribozymes mutated in the catalytic domain were not used as controls in the previous study (25). That control combined with the lack of statistical analysis may indicate that inhibition of TNF-{alpha} secretion by a ribozyme-dependent mechanism was not previously demonstrated. The catalytic activity of rz254 was improved by the addition of the self-processing domain in rz254sp. This may be due to relief of alternative secondary structures which can be predicted to form between the 5' binding arm and the ribozyme core in rz254.

Different cationic lipid formulations varied greatly in their ability to facilitate ribozyme uptake by peritoneal macrophages in vivo. DOTMA:DOPE was useful as a delivery reagent for primary macrophages in culture. In vivo, however, DOSPA:DOPE enhanced uptake of intact ribozyme by peritoneal macrophages by 10-fold. That increase may be due to the multiple positive charges associated with the spermine head group of DOSPA vs the single positive charge associated with the head group of DOTMA.

Treatment of macrophages with anti-TNF-{alpha} ribozymes in vitro and in vivo resulted in TNF-{alpha} mRNA degradation products. In addition, transfection with both active and inactive ribozyme, but not irrelevant ribozyme, resulted in the accumulation of primary transcripts of the TNF-{alpha} gene. That observation differs from what others have reported for plants (26) or mammals (13, 14, 15). The cleavage products were probably not produced during isolation of the cellular RNA, as the macrophages were lysed in the presence of guanidine isothiocyanate and EDTA. In addition, excess EDTA was present throughout RNA isolation and electrophoresis. Our previous studies have shown that cleavage of TNF-{alpha} mRNA by rz254sp or rz442sp among total cellular RNA in vitro requires at least 10 mM Mg2+ and extended incubation at 37°C (16). The observed 3.0 Kb TNF-{alpha} transcript may be due to the 2766-base primary transcript plus about 200 residues in the poly(A) tail (27). Cleavage by the ribozyme may have damaged the pre-mRNA and altered its normal processing pathway, which would allow primary transcripts to accumulate in the cell. That, however, does not account for the accumulation of primary transcript in cells that received inactive ribozyme. That phenomenon may be related to a sequence-specific, ribozyme-independent reduction of TNF-{alpha} protein production observed with inactive ribozyme both in vitro and in vivo. We could not rule out the possibility that the inactive ribozymes retained residual catalytic activity which could not be detected by in vitro enzymatic measurements, but was still present in the cells. Although complex intracellular conditions cannot be duplicated during in vitro measurements, others have shown that RNA binding proteins can enhance ribozyme catalysis in vitro (28). Another possible means for sequence specific activity of the inactive ribozymes may be to target the mRNA for modification or degradation by protein enzymes. For example, RNase P can cleave RNA molecules to which a structured RNA oligomer has hybridized (29, 30).

The selective destabilization of mRNA containing concatenated AUUUA motifs, of which TNF-{alpha} is an example (31), require CAP binding and translation for destabilization (32). In our study, all of the ribozymes cleaved such that the CAP and 5' untranslated region of the TNF-{alpha} mRNA were separated from the protein coding sequence and 3' untranslated region, including the AUUUA destabilizing element. The removal of all sequences required for interaction with ribosomes should exclude the remainder of the mRNA from selective degradation mediated by the AUUUA element. Exonuclease activity 5' to 3' would then be required to degrade the 3' cleavage product. Although uncapped mRNA transfected into cells may not be translated efficiently, they are not necessarily degraded rapidly (33).

We have demonstrated that hammerhead ribozymes complexed with cytofectins can suppress TNF-{alpha} production. Ribozymes delivered with DOSPA:DOPE and DOGS:DOPE were stable in activated macrophages. Recruitment of inflammatory cells into the peritoneal cavity by three different formulations of cationic lipids indicates that these delivery vehicles may create a proinflammatory environment when combined with ribozymes. Further studies will be required to modify the delivery formulations such that the size, protein binding characteristics, and lipid composition do not promote recruitment of inflammatory cells.


   Acknowledgments
 
We thank Drs. George Breuning and Neil E. Hubbard for helpful discussions and advice.


   Footnotes
 
1 This work was supported by National Institutes of Health Grant CA 47050 and the California Breast Cancer Research Program. Back

2 Current address: Molecular Design, 2451 Jonquil Court, Lafayette, CO 80026. Back

3 Current address: Department of Pathology, University of Maryland, 10 South Pine Street, 7th floor, MSTF, Baltimore, MD 21201. Back

4 Current address: Center for Engineering Plants for Resistance Against Pathogens, University of California, Davis, CA 95616. Back

5 Address correspondence and reprint requests to Dr. Kent L. Erickson, Department of Cell Biology and Human Anatomy, School of Medicine, University of California, Davis, CA 95616-8643. E-mail address: Back

6 Abbreviations used in this paper: PEC, peritoneal exudate cell; DMRIE, 1,2-dimyristyloxypropyl-3-dimethyl-hydroxyethyl ammonium bromide; DOGS, dioctadecyamidoglycylspermine; DOPE, dioleoylphosphatidylethanolamine; DOSPA, 2,3-dioleyloxy-N-[2(sperminecarboxamido)ethyl]-n,n-dimethyl-1-propanaminium trifluoroacetate; DOTAP, N-[1-(2,3-dioloyloxy)propyl]-N,N,N-trimethylammonium methylsulfate; DOTMA, N-[1-(2,3-dioleyloxy)propyl]-n,n,n-trimethylammonium chloride; EMEM, Eagle’s minimal essential medium. Back

Received for publication August 26, 1998. Accepted for publication June 4, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Masahiro, H., N. Higashi, H. Taki, T. Osawa. 1990. Cytolytic mechanisms of activated macrophages. J. Immunol. 144:1425.[Abstract]
  2. Waage, A., A. O. Aasen. 1992. Different role of cytokine mediators in septic shock related to meningococcal disease and surgery/polytrauma. Immunol. Rev. 127:220.
  3. Torti, F. M., B. Dieckmann, B. Beutler, A. Cerami, G. M. Ringold. 1985. A macrophage factor inhibits adipocyte gene expression: an in vitro model of cachexia. Science 229:867.[Abstract/Free Full Text]
  4. Feldmann, M, F. M. Brennan, R. O. Williams, A. P. Cope, D. L. Gibbons, P. D. Katsikis, R. N. Maini. 1992. Evaluation of the role of cytokines in autoimmune disease: the importance of TNF {alpha} in rheumatoid arthritis. Prog. Growth Factor Res. 4:247.[Medline]
  5. Sharief, M. K., E. J. Thompson. 1992. In vivo relationship of tumor necrosis factor-{alpha} to blood-brain barrier damage in patients with active multiple sclerosis. J. Neuroimmunol. 38:27.[Medline]
  6. Beutler, B., I. W. Milsark, A. C. Cerami. 1985. Passive immunization against cachectin/tumor necrosis factor protects mice from lethal effect of endotoxin. Science 229:869.[Abstract/Free Full Text]
  7. Maini, R. N., F. M. R. Brennan, C. Q. Williams, A. P. Chu, D. Cope, M. Gibbons, M. Elliott, M. Feldmann. 1993. TNF-{alpha} in rheumatoid arthritis and prospects of anti-TNF therapy. Clin. Exp. Rheumatol. Suppl. 8:S173.
  8. Been, M. D., T. R. Cech. 1986. One binding site determines sequence specificity of Tetrahymena pre-rRNA self-splicing, trans-splicing, and RNA enzyme activity. Cell 47:207.[Medline]
  9. Prasad, Y., J. B. Smith, P. A. Gottlieb, J. Bentz, G. Dinter-Gottlieb. 1992. Deriving a 67-nucleotide trans-cleaving ribozyme from the hepatitis delta virus antigenomic RNA. Antisense Res. Dev. 2:267.[Medline]
  10. Collins, R. A., J. E. Olive. 1993. Reaction conditions and kinetics of self-cleavage of a ribozyme derived from Neurospora VS RNA. Biochemistry 32:2795.[Medline]
  11. Haseloff, J., W. L. Gerlach. 1988. Simple RNA enzymes with new and highly specific endoribonuclease activities. Nature 334:585.[Medline]
  12. Feldstein, P. A., G. Breuning. 1993. Catalytically active geometry in the reversible circularization of "mini-monomer" RNAs derived from the complimentary strand of tobacco ringspot virus satellite RNA. Nucleic Acids Res. 21:1991.[Abstract/Free Full Text]
  13. Sioud, M., J. B. Natvig, O. Forre. 1992. Preformed ribozyme destroys tumor necrosis factor mRNA in human cells. J. Mol. Biol. 223:831.[Medline]
  14. Heidenreich, O., F. Eckstein. 1992. Hammerhead ribozyme-mediated cleavage of the long terminal repeat RNA of human immunodeficiency virus type 1. J. Biol. Chem. 267:1904.[Abstract/Free Full Text]
  15. Chen, S., C. S. Song, Y. Lavrovsky, B. Bi, R. Vellanoweth, B. Chatterjee, A. K. Roy. 1998. Catalytic cleavage of the androgen receptor messenger RNA and functional inhibition of androgen receptor by a hammerhead ribozyme. Mol. Endocrinol. 12:1558.[Abstract/Free Full Text]
  16. Kisich, K. O., S. J. Freedland, K. L. Erickson. 1997. Factors altering ribozyme-mediated cleavage of tumor necrosis factor-{alpha} mRNA in vitro. Biochem. Biophys. Res. Commun. 236:205.[Medline]
  17. Malone, R. W., P. L. Felgner, I. M. Verma. 1989. Cationic liposome-mediated RNA transfection. Proc. Natl. Acad. Sci. USA 86:6077.[Abstract/Free Full Text]
  18. Beckler, G.. 1992. Synthesis of large amounts of RNA using the ribo-max protocol. Promega Notes 39:12.
  19. Fischer, E., M. A. Marano, K. J. Van Zee, C. S. Rock, A. S. Hawes, W. A. Thomas, L. DeForge, J. S. Kenney, D. G. Remick, D. C. Bloedow. 1992. Interleukin-1 receptor blockade improves survival and hemodynamic performance in Escherichia coli septic shock, but fails to alter host responses to sublethal endotoxemia. J. Clin. Invest. 89:1551.
  20. Perreault, J. P., D. Labuda, N. Usman, J. H. Yang, R. Cedergreen. 1991. Relationship between 2'-hydroxyls and magnesium binding in the hammerhead RNA domain: a model for ribozyme catalysis. Biochemistry 30:4020.[Medline]
  21. Takagi, Y., K. Taira. 1995. Temperature-dependent change in the rate-determining step in a reaction catalyzed by a hammerhead ribozyme. FEBS Lett. 361:273.[Medline]
  22. van de Loosdrecht, A. A., R. H. Beelen, G. J. Ossenkoppele, M. G. Broekhoven, M. M. Langenhuijsen. 1993. A tetrazolium-based colorimetric MTT assay to quantitate human monocyte mediated cytotoxicity against leukemic cells from cell lines and patients with acute myeloid leukemia. J. Immunol. Methods 174:311.
  23. Brewer, G. 1994. Post-transcriptional considerations of gene expression: translation, mRNA stability, and poly(A) processing. In Gene Therapeutics: Methods and Applications of Direct Gene Transfer. J. A. Wolf, ed. Birkhauser, Boston, MA. pp. 40–59.
  24. Crooke, S. T., K. M. Lemonidis, L. Neilson, R. Griffey, E. A. Lesnik, B. P. Monia. 1995. Kinetic characteristics of Escherichia coli RNase H1: cleavage of various antisense oligonucleotide-RNA duplexes. Biochem. J. 312:599.
  25. Sioud, M.. 1996. Ribozyme modulation of lipopolysaccharide-induced tumor necrosis factor-{alpha} production by peritoneal cells in vitro and in vivo. Eur. J. Immunol. 26:1026.[Medline]
  26. Perriman, R., L. Graf, W. L. Gerlach. 1993. A ribozyme that enhances gene suppression in tobacco protoplasts. Antisense Res. Dev. 3:253.[Medline]
  27. Semon, D., E. Kawashima, C. V. Jongeel, A. N. Sakhov, S. A. Nedospasov. 1987. Nucleotide sequence of the murine TNF locus, including the TNF-{alpha} (tumor necrosis factor) and TNF–ß (lymphotoxin) genes. Nucleic Acids Res. 15:9083.[Free Full Text]
  28. Tsuchihashi, Z., M. Khosla, D. Herschlag. 1993. Protein enhancement of hammerhead ribozyme catalysis. Science 262:99.[Abstract/Free Full Text]
  29. Hough, R.F., B. L. Bass. 1994. Purification of the Xenopus laevis double-stranded RNA adenosine deaminase. J. Biol. Chem. 269:9933.[Abstract/Free Full Text]
  30. James, B. D., G. J. Olsen, J. Liu, N. R. Pace. 1988. The secondary structure of ribonuclease P RNA, the catalytic element of a ribonucleoprotein enzyme. Cell 52:19.[Medline]
  31. Collart, M. A., D. Belin, J. Vassali, S. de Kossodo, P. Vassali. 1986. {gamma}-Interferon enhances macrophage transcription of the tumor necrosis factor/cachectin, interleukin 1, and urokinase genes, which are controlled by short-lived repressors. J. Exp. Med. 164:2113.[Abstract/Free Full Text]
  32. Brewer, G., J. Ross. 1988. A shortening and degradation of the 3' AU-rich sequences of human c-myc mRNA in a cell-free system. Mol. Cell. Biol. 8:1697.[Abstract/Free Full Text]
  33. Stein-Elroy, O., T. R. Fuerst, B. Moss. 1989. Cap-independent translation of mRNA conferred by encephalomyocarditis virus 5' sequence improves the performance of the vaccinia virus/bacteriophage T7 hybrid expression system. Proc. Natl. Acad. Sci. USA 86:6126.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
 J. Leukoc. Biol.Home page
B. Burke, S. Sumner, N. Maitland, and C. E. Lewis
Macrophages in gene therapy: cellular delivery vehicles and in vivo targets
J. Leukoc. Biol., September 1, 2002; 72(3): 417 - 428.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
K. O. Kisich, L. Heifets, M. Higgins, and G. Diamond
Antimycobacterial Agent Based on mRNA Encoding Human {beta}-Defensin 2 Enables Primary Macrophages To Restrict Growth of Mycobacterium tuberculosis
Infect. Immun., April 1, 2001; 69(4): 2692 - 2699.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kisich, K. O.
Right arrow Articles by Erickson, K. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kisich, K. O.
Right arrow Articles by Erickson, K. L.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS