| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Dß2 Binds VCAM-1: Evidence for a Binding Interface Between I Domain and VCAM-1
*
ICOS Corp., Bothell, WA 98021; and
Department of Medicine, Division of Clinical Immunology, Johns Hopkins University School of Medicine, Baltimore, MD 21218
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Dß2, selectively binds ICAM-3
and does not appear to bind ICAM-1. We have reported recently that
Dß2 can support eosinophil adhesion to
VCAM-1. Here we demonstrate that expression of
Dß2 in a lymphoid cell that does not
express 4 integrins confers efficient binding to VCAM-1.
In addition, a soluble form of Dß2 binds
VCAM-1 with greater efficiency relative to ICAM-3. The I domain of D
contains a binding site for VCAM-1 since recombinant D I
domain binds specifically to VCAM-1. In addition, D mAb
that block cellular binding to VCAM-1 bind the D I
domain. Using VCAM-1 mutants we have determined that the binding site
on VCAM-1 for Dß2 overlaps with that of
4 integrins. Substitution of VCAM-1 aspartate at
position 40, D40, within the conserved integrin binding site,
diminishes binding to Dß2 and abrogates
binding to the D I domain. The corresponding integrin
binding site residue in ICAM-3 is also essential to
Dß2 binding. Finally, we demonstrate that
Dß2 can support lymphoid cell adhesion to
VCAM-1 under flow conditions at levels equivalent to those mediated by
4ß1. These results indicate that VCAM-1
can bind to an I domain and that the binding of
Dß2 to VCAM-1 may contribute to the
trafficking of a subpopulation of leukocytes that express
Dß2. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4 integrins to
endothelial VCAM-1 (2, 3, 4, 5). These interactions increase the
duration of leukocyte contact with endothelium and can support rolling
adhesion. ß2 and 4
integrins may then be activated by stimuli such as chemokines presented
on endothelium to support avid binding to endothelial ICAM-1 and
VCAM-1, respectively. The more avid binding of
ß2 and 4 integrins may
result in leukocyte arrest and extravasation.
Integrins are heterodimers that may possess two contact sites for CAMs.
The subunit of each of the ß2 integrins
CD11a (LFA-1), CD11b (Mac-1), CD11c, and D contains an approximate
200-residue A or I domain. The I domain is homologous to the A domains
in von Willebrand factor and repeats in cartilage matrix protein and
collagen (6). The crystal structures of CD11a and CD11b I
domains and von Willebrand factor A domains are very similar (7, 8). The I domains of CD11a and CD11b possess an essential
binding site for ICAM-1. I domain-specific Abs can block binding to
ICAM-1, and soluble recombinant I domain has been shown to bind
directly to ICAM-1 and to compete ICAM-1 binding (9, 10).
A cation binding site in the I domain, the metal-dependent adhesion
site (MIDAS),2 may
directly bind ICAM-1 (7, 11). Amino acid substitutions in
the MIDAS abrogate ICAM-1 binding (12, 13, 14). A conserved
integrin binding site or motif (IBS) in the amino-terminal ICAM-1
Ig-like domain is essential to ICAM-1-dependent adhesion and may form
the CD11a I domain contact site (11, 15, 16). In contrast,
the 4 subunit of
4ß1 and
4ß7 does not contain
an I domain and does not appear to bind ICAM-1. Binding to VCAM-1
appears to use residues within the seven amino-terminal repeats of
4 (17). It is interesting that
although VCAM-1 binds to 4 integrins, its
binding is dependent on an IBS highly homologous to that in ICAM-1
(18). The ß subunits also possess a cation binding site
that appears to interact directly with CAMs (19).
Substitution of residues in this site also abrogates CAM binding. Thus,
both and ß subunits contribute to a CAM binding site.
The 4 integrins can mediate adhesion under
flow and thus support early leukocyte contact with endothelium before
extravasation. Binding of 4 integrins to
endothelial VCAM-1 can support adhesion within the range of shear
stresses reported for postcapillary venules of 1.5–30
dynes/mm2 (20, 21). However, the
ß2 integrins CD11a/CD18 (LFA-1) and CD11b/CD18
(Mac-1) do not appear to support leukocyte adhesion to purified ICAM-1
under flow conditions with shear stresses >0.5
dynes/cm2 (22).
Previously we isolated a fourth member of the human
ß2 subfamily,
Dß2 (23).
Dß2 is expressed on
monocytes, macrophages, NK cells, a subpopulation of T and B cells,
basophils, eosinophils, and neutrophils (24). Overall
D is more closely related to CD11b and CD11c
(50–60% amino acid identity) than to CD11a (35% identity). The I
domain of D is also most closely related to the CD11b and CD11c I
domains. We have demonstrated that
Dß2 binds to ICAM-3,
but demonstrates weak or undetectable binding to ICAM-1
(23). Recently we reported that static adhesion of
eosinophils to VCAM-1 can be supported by
Dß2 (25).
Here we show that both cell surface and soluble recombinant
Dß2 bind to VCAM-1,
and this binding is blocked with D and VCAM-1
mAb. The D I domain appears to provide a
critical binding site for VCAM-1. We also demonstrate that
D binding to VCAM-1 supports adhesion under
both static and flow conditions. In addition, VCAM-1 mutants were used
to identify a VCAM-1 binding site for D that
overlaps with that for 4.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
D/CD18 and CAMs
A soluble form of
Dß2 was generated by
subcloning cDNA encoding residues encompassing the extracellular
domains into the expression vectors pcDNA.3 (Invitrogen, San Diego, CA)
and pDC1 (ICOS, Bothell, WA). The resulting plasmids were
electroporated into DG44 CHO cells (23). Transfectants
were selected in nucleoside-deficient medium with dialyzed serum and
800 µg/ml G418 for 2 wk before screening of supernatants for
D/CD18 in a sandwich ELISA using mAb that bind
- and ß-chains. Clonal populations were obtained by limiting
dilution culture in selective medium. Soluble protein was characterized
by Western blot analysis and SDS-PAGE analysis of affinity purified
material.
To generate a soluble recombinant VCAM-1 domain 1 and 2/Fc chimera (VCAM-2D), we inserted the first two domains of VCAM-1 in-frame with the Fc region of human IgG1 (hinge-CH2-CH3) in the expression plasmid pDC37 (ICOS). A mutation in domain 1 of VCAM-1 that replaced the aspartic acid, D40, of the VLA-4 binding site, with an alanine was engineered by PCR. Then the mutated domain 1 and the domain 2 of VCAM-1 were ligated to the IgG1 Fc (VCAM-2D, D40A) sequence and pDC37 as described above. VCAM-2D and VCAM-2D, D40A, were expressed in COS cells and purified from culture media.
Expression and purification of the D I domain
The boundaries of the D I domain were
defined based on alignment with previously determined sequences of
CD11a and CD11b I domains. This fragment was isolated from the
D cDNA by PCR amplification using the primers
GGAGGAGACATATGAAGAAGATGGACATCGTCTTCCT (5') and
CTCGAGGGTTCCCTCAACTGCATAGATC (3'). The resulting 580-nt
fragment was cloned into pCR2.1 (Invitrogen) for sequence verification
and then isolated by digestion with NdeI and XhoI
and subcloned into pET20b+. The insertion of the
I domain fragment at the NdeI site resulted in utilization
of the N-terminal methionine of pelB, which was removed in the
NdeI/XhoI digestion of the vector. Insertion into
the XhoI site allowed fusion of the C-terminal amino acids
of the I domain with the 6x His tag encoded by the plasmid.
Escherichia coli BL21 (DE3) cells were transformed with
pET20b+/DI and grown overnight in a volume of
2 ml of Luria Bertani (LB) broth containing 100 µg/ml ampicillin. One
milliliter of this culture was expanded in 50 ml of fresh broth for
growth to an OD 600 of 1.0 (4–6 h at 25 or 30°C. Expression occurred
independently of the presence of isopropyl
ß-D-thiogalactopyranoside. Cells were lysed by
sonication or use of B-PER reagent (Pierce, Rockford, IL), and soluble
and insoluble fractions were obtained by centrifugation of the lysate
at 15,000 rpm. SDS-PAGE analysis revealed that 
30% of the
D I domain was available in soluble
form.
The soluble fraction was loaded on a Q-Sepharose column
pre-equilibrated with 10 mM NaCl in 10 mM Tris, pH 7.5. Fractions were
obtained by elution with a linear gradient of 10–500 mM NaCl in 10 mM
Tris (pH 7.5). After analysis by SDS-PAGE, fractions eluting between
30–70 mM NaCl were pooled and applied to a 250-µl nickel column
(Qiagen, Chatsworth, CA). The column was washed with 5 ml of 20 mM
imidazole in 300 mM NaCl and 20 mM Tris (pH 7.5) before elution of the
D I domain with buffer containing 200 mM
imidazole. A PD-10 gel filtration column (Pharmacia Biotech,
Piscataway, NJ) equilibrated with PBS was used to remove imidazole. The
D I domain was determined to be >95% pure by
SDS-PAGE.
Generation of D Abs
BALB/c mice were immunized with the affinity-purified, soluble
form D/CD18 described above (26).
The chain specificity of IgG-positive hybridomas was determined in
a sandwich ELISA using soluble D/CD18 and
LFA-1. Briefly, soluble integrins were immobilized in 96-well
microtiter plates (Immulon IV, Corning, Medfield, MA) with the
F(ab)2 of a nonblocking anti-CD18 Ab (mAb
195N, ICOS). Following incubation of hybridoma supernatants with
immobilized integrin, bound IgG was detected with a goat anti-mouse
Fc-specific mAb. Hybridomas with reactivity to
D/CD18 only were cloned. The specificities of
D mAb 217I, 217K, 240I, and 212D, all IgG1,
were confirmed by flow cytofluorometric and Western blot analyses and
immunoprecipitation.
Recombinant protein binding assays
Soluble D/CD18 from culture
supernatants was immobilized on Immulon IV microtiter plates (Corning)
previously coated with 5 µg/ml 212D mAb in bicarbonate buffer (pH
9.5) and blocked with 3% fish skin gelatin. After 16 h at 4°C,
plates were washed and incubated for 1 h with 1–5 µg/ml Ab as
indicated. Biotinylated CAM/Fc was diluted in Tris, 150 mM NaCl buffer
(1 mM MgCl2, 1 mM CaCl2,
and 0.5 mM MnCl2) and added to plates at 100
µl/well at the concentrations indicated in Fig. 2
. Following a 90- to
120-min incubation at room temperature, bound CAMs were detected with
streptavidin-HRP complex and o-phenyldiamine substrate.
|
D mAb bind to
the I domain, the recombinant D and CD11b I
domains were plated separately in 96-well microtiter plates. Wells were
blocked with 2% fish skin gelatin (Sigma, St. Louis, MO) followed by
incubation with 1 µg/ml D-specific (217I and
240I, ICOS) or CD11b-specific (44AACB and OKM1, American Type Culture
Collection, Manassas, VA) mAb. An irrelevant isotype-matched control
mAb (IgG1) was also used. Bound mAb was detected with goat
anti-mouse Fc HRP conjugate and o-phenyldiamine
substrate. Binding of D mAb to the
D I domain and not the CD11b I domain
indicates that these adhesion-blocking D mAb
bind specifically to the D I domain.
To determine whether the D I domain binds VCAM-1, the I domain was
immobilized in nickel-chelated flow cells for surface plasmon resonance
(27). An NTA chip (BIAcore, Uppsala, Sweden) was charged
with 20 µl of 500 µM NiCl2 in eluent buffer
(10 mM HEPES, 0.15 M NaCl, and 0.005% surfactant P20, pH 3.0) at a
flow rate of 20 µl/min. The D I domain (200
nM) in eluent buffer was bound at a flow rate of 10 µl/min. Binding
resulted in 200 response units. CAM binding was determined in eluent
buffer with 1 mM MnCl2.
Generation of Dß2-expressing Jurkat
cells
Jurkat 77 (J77) cells were irradiated at 300 rad with a
60Co gamma source. Following 5 days of culture,
J774ß1-expressing
cells were depleted by panning on polystyrene plates coated with
4 mAb (A4.1, ICOS Corp.) and
ß1 mAb (K20 and 3S3). After panning,
nonadherent J77 cells were selected for further expansion. Three
sequential cycles of panning and expansion were performed to obtain an
enriched population of
J774ß1 null cells. To
obtain J77 clones lacking surface expression of
4 and ß1, cells from
the enriched nonadherent population were stained with the
ß1 mAb TS2/16, followed by FACS sorting of
single
J774ß1-
cells into a 96-well plate. After expansion, these clones were
subsequently analyzed for surface expression of
4ß1 by staining with
the aforementioned panel of anti-4 and
anti-ß1 mAbs. Those clones lacking
detectable surface expression of
4ß1 were then tested
in static adhesion assays to VCAM-1 to confirm the functional loss of
VLA-4 (data not shown). Stably transfected cells used in flow and
adhesion assays were obtained by transfection with full-length
D cDNA subcloned into the HindIII
and XhoI sites of pCDNA3 (Invitrogen). Ten million
J77/4- cells were
transfected by electroporation with 30 µg of plasmid DNA, followed by
selection in 1 mg/ml G418 (Life Technologies). The bulk population was
screened by FACS analysis using the Ab 212D. Clones were derived from
this population by one round of limiting dilution cloning.
Immunoprecipitation experiments were performed to confirm that the
D-chain was associated with CD18. Abs to
either chain precipitated the same two proteins (95 and 150 kDa) as
visualized by SDS-PAGE and Coomassie stain under reducing conditions,
and preclearance with Abs to either chain prevented immunoprecipitation
of these proteins by Abs to the other chain (data not shown).
Static cell adhesion assay
Static cell adhesion assays were performed as described previously (16). Microtiter plates (Immulon IV, Corning) were coated overnight with 5 µg/ml purified CAM/Fc or capture mAb in bicarbonate coating buffer (pH 9.5). Plates were blocked with 3% fish skin gelatin (Sigma) in Dulbecco’s PBS (Life Technologies, Grand Island, NY). Where relevant, Abs were incubated at 1 µg/ml for 1 h before cell addition. Cells were harvested by centrifugation and were resuspended in binding buffer (RPMI with 0.1% BSA) before addition to plates at 100,000/well (three wells per group). Binding was allowed to occur at 37°C for 30 min (Jurkat) before addition of 1% glutaraldehyde. After fixation for 1 h, plates were washed copiously with distilled water. Crystal violet solution (1% crystal violet in 10% absolute ethanol and 90% water) at 50 µl/well was added for 5 min. After copious washing, 100 µl/well destaining buffer (33% absolute ethanol in 66% sterile dH20) was added. After 12 h, signal was detected at 570 nm on a Dynatech MR500 plate reader (Chantilly, VA). Percent cell binding was calculated as A570 of all binding to CAM divided by A570 of cell binding to capture mAb x 100.
Flow adhesion assay
Borasilicate capillary assay tubes (Drummond Scientific, Broomall, MA) were cut into 2.5-cm lengths and soaked overnight in 95% ethanol. Tubes were then rinsed with sterile water. VCAM-1/Fc and ICAM-1/Fc were diluted to a concentration of 100 µg/ml in HBSS without Ca2+ and Mg2+ (Cellgro, Mediatech, Herndon, VA) buffered to pH 7 with 20 mM HEPES (Cellgro, Mediatech), and instilled into tubes. Tubes were incubated at 37°C in moist petri dishes for 1.5 h and then refrigerated for 30 min before use. Just before experiments, excess VCAM-1/Fc and/or ICAM-1/Fc was rinsed out of the tubes and replaced with the assay medium (HBSS with Ca2+ and Mg2+, 20 mM HEPES (pH 7), and 2% human serum). A silicone tubing loop and roller pump (Masterflex, Cole-Palmer, Vernon Hills, IL) was used to circulate J77 (T cell line Jurkat 77) cells through the CAM-coated assay tubes mounted on an inverted microscope stage. Just before assay J77 cells were centrifuged and resuspended in assay medium for a final loop concentration of 1 x 106 cells/ml.
The J77 cell lines were infused into the closed loop in independent
experiments. The J77 D cells were pretreated
for 10 min with an isotype type-matched control mAb (40 µg/ml) or an
D mAb mixture of 217I and 240I (20 µg/ml
each), and then infused into the loop system. Alternatively, a
VCAM-1/Fc tube was pretreated for 10 min at 37°C with VCAM-1 mAb
(130K and 130P, 20 µg/ml each of 130K and P, plus a 1/100 dilution of
the anti-VCAM-1 mAb 1G11 (Caltag)), and then untreated J77D
cells were infused into the loop system.
Interactions between the J77 cell lines and bound VCAM-1 were monitored by videomicroscopy and recorded on video tape for analysis. Interactions were monitored for 15 min; the shear rate for the first 5 min was 2 dynes/cm2; that for the last 10 min was1.2 dynes/cm2. The number of cells attached to the VCAM-1/Fc-coated substrate was determined at 1-min intervals by individual frame computer analysis of the recorded experiments, using NIH Image Software, Montana ImmunoTech Macros (Bozeman, MT), and an Apple Computer PowerMac 7100-66 (Cupertino, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Dß2-expressing cells to
VCAM-1
Previously we had demonstrated that
Dß2 can mediate static
adhesion of eosinophils to VCAM-1 (25). We further
characterize Dß2
binding to VCAM-1 here in both cell and recombinant protein systems.
For static and flow adhesion assays we used the T cell line Jurkat 77
(J77). J77 do not express 4ß7 (data not presented). To eliminate
the contribution of
4ß1 to VCAM-1 binding,
we generated an 4 null variant of Jurkat 77
(J774-).
J774- cells did not stain
with 4 mAb, whereas parental J77 clearly
express 4 (Fig. 1A).
J774- did not stain with
several 4 mAb (data not shown) indicating that
loss of 4 expression was not due to loss of a
specific 4 mAb epitope.
J774- also did not stain
with ß1 or ß7 mAb (data
not shown). D was expressed in
J774- to generate an
4-
D+ line
(J77D). Expression of
D in J77D was
2-fold less than that of 4 in parental
J77.
|
D was found to bind
efficiently to VCAM-1 (Fig. 1
B). As expected
J774- did not bind to
VCAM-1, but retained the ability to bind to ICAM-1 via LFA-1. The
binding of J77D to VCAM-1 was blocked
partially by the
Dß2-specific mAb 217I
and 240I. Together these D mAb completely
blocked binding. J77D binding to VCAM-1 was also blocked with CD18
and VCAM-1 mAb, but not by a VCAM-1 mAb that is nonblocking for
4 integrin binding (92C4D). Thus, expression
of Dß2 in
J774- cells confers binding
to VCAM-1. The identical pattern of results were obtained using CHO
cells expressing Dß2
(25) (data not presented).
Recombinant Dß2 binds to VCAM-1
To further demonstrate binding between
Dß2 and VCAM-1, we
used a cell-free assay. In this assay a secreted form of
Dß2, containing the
entire extracellular region, was captured with a nonblocking
D mAb, and the binding of biotinylated VCAM-1
was determined using strepavidin-HRP in a standard ELISA format. VCAM-1
bound to recombinant immobilized
Dß2 in a saturable
manner (Fig. 2A). The binding
of VCAM-1 was 6-fold greater than that of background binding to
ICAM-1 and 2-fold greater than the binding of ICAM-3. In this assay low
levels of Dß2 binding
to ICAM-1 were detected at the highest CAM concentration, 10 µg/ml.
The binding of Dß2 to
VCAM-1 was blocked with either D or CD18 mAb
(Fig. 2B). VCAM-1 possesses two binding sites for
4 integrins and thus may require two distinct
mAb for complete blocking (18). VCAM-1 binding to
Dß2 was also partially
blocked by one set of VCAM-1 mAb, 130K and 130P, and more completely by
another VCAM-1 mAb, 1G11B1 (Fig. 2C). The ability of the
different VCAM-1 mAb to block in this cell-free assay is similar to
that observed in cellular binding assays (Fig. 1B). In
contrast to Dß2,
immobilized recombinant LFA-1 does not bind to VCAM-1 (data not shown).
Thus, the specificity of recombinant
Dß2 binding to CAMs is
consistent with cell-based binding assays. In both cellular and
recombinant protein assays
Dß2 binds specifically
to VCAM-1 with greater efficiency than that of ICAM-3.
The binding site on VCAM-1 for D overlaps with that
of 4
To localize the binding site on VCAM-1 for
Dß2, we generated two
mutants based on the binding sites for 4
integrins. VCAM-1 possesses two binding sites for
4: one in domain 1 and the other in domain 4.
Both sites involve a critical aspartate residue in an identical IBS
motif, IDSPL. To remove the domain 4 IBS we deleted domains 3, 4, and 5
from the 5D VCAM-1 chimera resulting in a 2 domain VCAM-1 (VCAM-2D). To
disrupt the 4 binding site in domain 1, the
critical aspartic residue at position 40 was substituted with alanine
in VCAM-2D (VCAM-2D, D40A). The binding of
J77D to VCAM-2D was concentration dependent
and equivalent to that of VCAM-1 (Fig. 3). The binding of
J77D to VCAM-2D, D40A was decreased by 50%
relative to VCAM-2D. J77D binding to VCAM-1
was also equivalent to that of the parental J77 cells mediated by
4ß1. Neither
J77D nor J77 bound to ICAM-3 possessing a
substitution in the acidic residue of its IBS, E37A. Thus, the VCAM-1
binding site for Dß2,
when expressed in J77, does not require domain 4 and appears to overlap
with the site in domain 1 that interacts with
4ß1. Identical results
were obtained with CHO cells expressing
Dß2 (data not
presented).
|
D I domain binds blocking mAb and VCAM-1
The I domain of CD11a contains a critical binding site for ICAM-1.
To determine whether D I
domain contributes to
Dß2 binding to VCAM-1,
a soluble form of D I domain was produced
(Fig. 4A). The binding of the
D I domain to both D
blocking mAb and VCAM-1 was determined. The D
blocking mAb 217I and 240I bound to D I domain
as determined by ELISA (Fig. 4B). Binding was specific as
D mAb did not bind to a similar recombinant
CD11b I domain and CD11b mAb did not bind D I domain. Binding of
217I and 240I was noncompetitive (data not presented), indicating that
the I domain possesses two distinct epitopes present also on native
Dß2 and thus appears
to possess a native conformation. We have demonstrated that mAb 217I
and 240I block D binding to VCAM-1 (Fig. 1B). This suggests that D I domain
is a critical binding site for VCAM-1 interaction.
|
D I domain directly to VCAM-1 was
demonstrated by surface plasmon resonance (Fig. 4C). VCAM-1
did not bind to D I domain in the presence of
1 mM EDTA. Binding was specific, as there was no detectable interaction
with ICAM-1. LFA-1 I domain bound ICAM-1 Fc, but exhibited negligible
interaction with VCAM-1 Fc in the same system (data not presented).
VCAM-2D also interacted with D I domain at a
level similar to the 5 domain form of VCAM-1. In contrast, there was no
detectable binding of VCAM-2D, D40A to D I
domain. Thus, D I domain appears to contain a
binding site for VCAM-1, and similar to other integrin-CAM
interactions, binding is cation dependent.
The binding of Dß2 to VCAM-1 mediates
adhesion under flow conditions
VCAM-1 supports adhesion of leukocytes under flow conditions
through an interaction with 4 integrins. To
determine whether Dß2
can also support adhesion to VCAM-1 under flow conditions,
J77D was tested for binding in the presence of
shear stress (Fig. 5).
J77D and J77 bound to VCAM-1 at equivalent
levels at 2 dynes/mm2 (0–5 min) and at 1.2
dynes/mm2 (5–15 min). Binding of
J77D was blocked with
D and VCAM-1 mAb, but not by a nonblocking
CD18 mAb. Neither J77D nor J77 bound to ICAM-1
under flow conditions. Thus,
Dß2 expressed in
J77D binds specifically to VCAM-1 under flow
conditions. The level of binding was similar to that mediated by
4ß1 expressed on
J77.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Dß2 binding to VCAM-1
and by identifying critical structural components. Expression of
Dß2 in Jurkat
774- cells conferred
efficient adhesion to VCAM-1-coated substrates.
Dß2 supported adhesion
to VCAM-1 under both static and flow conditions and was blocked by
D and VCAM-1 mAb. In addition, recombinant
soluble Dß2 binds
VCAM-1 with greater efficiency relative to ICAM-3. The binding of
recombinant proteins was also specifically blocked by
D and VCAM-1 mAb. These mAb bind the D I
domain, implicating this domain in the VCAM-1 interaction. We
demonstrate that he D I domain indeed binds
directly to VCAM-1 and that the metal and structural requirements for
binding are similar to those for cellular adhesion. Thus, VCAM-1
appears to serve as a ligand for
Dß2 and
D I domain functions as an essential binding
site. VCAM-1 appears to be the highest affinity
Dß2 ligand described
to date. Previously we have indicated that VCAM-1 in solution did not
bind to CHO cells expressing
Dß2 (23).
This may have been due to differences in assays used. Previously we had
used VCAM-1 in solution. Here we used VCAM-1 that was immobilized, and
thus a substrate that can support a more avid interaction.
The binding of Dß2 to
VCAM-1 is unexpected and indicates that a CAM can interact with
different integrins by binding distinct -chain domains. The
binding of ß2 integrins to ICAMs has been well
characterized. These studies indicate that the A or I domain present in
the subunits of ß2 integrins is a critical
site for binding of ICAMs (9, 10). Substitution of I
domain amino acids in or proximal to those that coordinate cations, the
MIDAS, disrupts ICAM binding (12, 13, 14). ICAMs have not been
reported to bind non-I domain integrins. Conversely, VCAM-1 has not
previously been reported to bind to an I domain. VCAM-1 instead has
been shown to bind to the amino-terminal repeats in
4 that lacks an I domain (17).
The alignment of D and
4 amino-terminal repeats demonstrates
conservation of some residues that have been implicated in VCAM-1
binding (data not presented). Thus, although we demonstrate here that
VCAM-1 can interact with the D I domain, this
does not preclude the possibility that VCAM-1 might also interact with
D amino-terminal repeats.
The conservation of IBS on CAMs suggests a potential for VCAM-1 binding
to an I domain in a manner similar to ICAM-1. CAM Ig-like domains are
composed of two ß-sheets containing ß-strands abed or cfg.
Essential residues for integrin binding, the IBS, localize primarily to
the mostly flat face composed of ß-strands gfc (15, 28).
This binding face possesses two components. First, there is the
conserved IBS, a motif of approximately five amino acids, IETPL in
ICAM-1 and IDSPL in VCAM-1 (16, 18). This sequence,
located between ß-strands C–D, contains the invariable critical
acidic residues E or D that protrude from the binding face. The acidic
residue in the IBS has been suggested to form an additional
coordination site for cations in the I domain MIDAS. Replacing VCAM-1
IBS with that of ICAM-1 (29) or VCAM-1 with that of
MadCAM-1 IBS (30) does not disrupt integrin-specific
binding. Thus, this conserved motif that is essential to binding is not
key to integrin specificity. Secondly, there are other less conserved
CAM sequences on the binding face of VCAM-1 (29, 30),
ICAM-1 (15), and ICAM-3 (16, 31) that have
been shown to function in binding, and these have been proposed to
determine integrin specificity. Thus, the integrin binding face on
VCAM-1 closely resembles that on ICAM-1, which appears to bind to I
domain (11). One exception may be that D40 of VCAM-1
protrudes somewhat further from the binding face relative to the
corresponding functional residue E34 on ICAM-1 (28).
Because we have demonstrated that VCAM-1 D40 functions in binding to
the D I domain, the D
I domain must accommodate the somewhat extended presentation of D40.
The substitution D40A results in a 50% decrease in binding to
D and a complete loss in
4ß1-specific binding.
This indicates that additional residues in VCAM-1 and
D contribute to binding.
We find that Dß2
binding to VCAM-1 can support cell adhesion under flow conditions.
Interactions between leukocytes and endothelium play a critical role in
leukocyte trafficking and occur in a broad range of shear stresses,
2–30 dynes/mm2 or less, depending on the
particular vascular bed. At very low shear stresses under 0.5
dynes/mm2, ß2 integrins
may support adhesion to ICAM-1 (32, 33). In contrast, we
find that at 2 and 1.2 dynes/mm2,
Dß2 mediates adhesion
to VCAM-1 at levels equivalent to that of
4ß1 (Fig. 5). Thus,
Dß2 may contribute to
the tethering of leukocytes at different in vivo sites where VCAM-1 is
expressed. Spleen and liver constituitively express VCAM-1, consistent
with the localization of D-expressing
macrophages in normal individuals (34). Thus,
D binding to VCAM-1 may contribute to both the
homing and the retention of leukocytes in certain tissues. Recently, we
have demonstrated that
Dß2 can mediate
adhesion of eosinophils to VCAM-1 and that this interaction might
function in chronic inflammation (25).
|
Acknowledgments |
|---|
D mAb production,
and Alice Dersham for manuscript preparation. |
Footnotes |
|---|
2 Abbreviations used in this paper: MIDAS, metal-dependent adhesion site; IBS, integrin binding site; CAM, cellular adhesion molecule.
Received for publication April 7, 1999. Accepted for publication June 1, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4 integrins mediate lymphocyte attachment and rolling under physiologic flow. Cell 80:413.[Medline]
-subunit of integrin CR3 (CD11b/CD18). Cell 80:631.[Medline]
Lß2) integrin. Proc. Natl. Acad. Sci. USA 92:10277.4 subunit in the upper face of the ß-propeller mode 1. Proc. Natl. Acad. Sci. USA 94:7198.Lß2 and Mß2 ligand interactions. J. Biol. Chem. 271:23729.dß2, binds preferentially to ICAM-3. Immunity 3:683.[Medline]
dß2) on human leukocytes and mast cells. J. Allergy Clin. Immunol. 99:5386.
dß2 integrin is expressed on human eosinophils and functions as an alternative ligand for vascular cell adhesion molecule 1 (VCAM-1). J. Exp. Med. 188:2187.4ß1). J. Cell Biol. 124:601.4 integrin binding interfaces on VCAM-1 and MAdCAM-1: integrin binding footprints identify accessory binding sites that play a role in integrin specificity. J. Biol. Chem. 272:19429.This article has been cited by other articles:
|
|
 |
|
  Y. Miyazaki, M. Bunting, D. M. Stafforini, E. S. Harris, T. M. McIntyre, S. M. Prescott, V. S. Frutuoso, F. C. Amendoeira, D. de Oliveira Nascimento, A. Vieira-de-Abreu, et al. Integrin {alpha}D 2 Is Dynamically Expressed by Inflamed Macrophages and Alters the Natural History of Lethal Systemic Infections J. Immunol., January 1, 2008; 180(1): 590 - 600. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Sadhu, H. J. Ting, B. Lipsky, K. Hensley, L. F. Garcia-Martinez, S. I. Simon, and D. E. Staunton CD11c/CD18: novel ligands and a role in delayed-type hypersensitivity J. Leukoc. Biol., June 1, 2007; 81(6): 1395 - 1403. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. R. Barthel, D. S. Annis, D. F. Mosher, and M. W. Johansson Differential Engagement of Modules 1 and 4 of Vascular Cell Adhesion Molecule-1 (CD106) by Integrins {alpha}4beta1 (CD49d/29) and {alpha}Mbeta2 (CD11b/18) of Eosinophils J. Biol. Chem., October 27, 2006; 281(43): 32175 - 32187. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. P. Yakubenko, S. P. Yadav, and T. P. Ugarova Integrin {alpha}Dbeta2, an adhesion receptor up-regulated on macrophage foam cells, exhibits multiligand-binding properties Blood, February 15, 2006; 107(4): 1643 - 1650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. G. Kallapur, T. J. M. Moss, M. Ikegami, R. L. Jasman, J. P. Newnham, and A. H. Jobe Recruited Inflammatory Cells Mediate Endotoxin-induced Lung Maturation in Preterm Fetal Lambs Am. J. Respir. Crit. Care Med., November 15, 2005; 172(10): 1315 - 1321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Ulyanova, L. M. Scott, G. V. Priestley, Y. Jiang, B. Nakamoto, P. A. Koni, and T. Papayannopoulou VCAM-1 expression in adult hematopoietic and nonhematopoietic cells is controlled by tissue-inductive signals and reflects their developmental origin Blood, July 1, 2005; 106(1): 86 - 94. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Oatway, Y. Chen, J. C. Bruce, G. A. Dekaban, and L. C. Weaver Anti-CD11d Integrin Antibody Treatment Restores Normal Serotonergic Projections to the Dorsal, Intermediate, and Ventral Horns of the Injured Spinal Cord J. Neurosci., January 19, 2005; 25(3): 637 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wu, J. R. Rodgers, X.-Y. D. Perrard, J. L. Perrard, J. E. Prince, Y. Abe, B. K. Davis, G. Dietsch, C. W. Smith, and C. M. Ballantyne Deficiency of CD11b or CD11d Results in Reduced Staphylococcal Enterotoxin-Induced T Cell Response and T Cell Phenotypic Changes J. Immunol., July 1, 2004; 173(1): 297 - 306. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Gris, D. R. Marsh, M. A. Oatway, Y. Chen, E. F. Hamilton, G. A. Dekaban, and L. C. Weaver Transient Blockade of the CD11d/CD18 Integrin Reduces Secondary Damage after Spinal Cord Injury, Improving Sensory, Autonomic, and Motor Function J. Neurosci., April 21, 2004; 24(16): 4043 - 4051. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. P. Moiseeva Adhesion receptors of vascular smooth muscle cells and their functions Cardiovasc Res, December 1, 2001; 52(3): 372 - 386. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Papayannopoulou, G. V. Priestley, B. Nakamoto, V. Zafiropoulos, and L. M. Scott Molecular pathways in bone marrow homing: dominant role of {alpha}4{beta}1 over {beta}2-integrins and selectins Blood, October 15, 2001; 98(8): 2403 - 2411. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. B. Carson-Walter, D. N. Watkins, A. Nanda, B. Vogelstein, K. W. Kinzler, and B. St. Croix Cell Surface Tumor Endothelial Markers Are Conserved in Mice and Humans Cancer Res., September 1, 2001; 61(18): 6649 - 6655. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Bouvard, C. Brakebusch, E. Gustafsson, A. Aszodi, T. Bengtsson, A. Berna, and R. Fassler Functional Consequences of Integrin Gene Mutations in Mice Circ. Res., July 30, 2001; 89(3): 211 - 223. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Koni, S. K. Joshi, U.-A. Temann, D. Olson, L. Burkly, and R. A. Flavell Conditional Vascular Cell Adhesion Molecule 1 Deletion in Mice: Impaired Lymphocyte Migration to Bone Marrow J. Exp. Med., March 19, 2001; 193(6): 741 - 754. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. G. Wagner and R. A. Roth Neutrophil Migration Mechanisms, with an Emphasis on the Pulmonary Vasculature Pharmacol. Rev., September 1, 2000; 52(3): 349 - 374. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Tachimoto, M. M. Burdick, S. A. Hudson, M. Kikuchi, K. Konstantopoulos, and B. S. Bochner CCR3-Active Chemokines Promote Rapid Detachment of Eosinophils from VCAM-1 In Vitro J. Immunol., September 1, 2000; 165(5): 2748 - 2754. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. G. Higgins, M. Cernadas, K. Tan, A. Irie, J.-h. Wang, Y. Takada, and M. B. Brenner The Role of alpha and beta Chains in Ligand Recognition by beta 7 Integrins J. Biol. Chem., August 11, 2000; 275(33): 25652 - 25664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. S. Harris, T. M. McIntyre, S. M. Prescott, and G. A. Zimmerman The Leukocyte Integrins J. Biol. Chem., July 28, 2000; 275(31): 23409 - 23412. [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
