| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Medical Microbiology, University of Ulm, Ulm, Germany; and
Department of Immunology and Infectious Diseases, Harvard School of Public Health, and Department of Medicine, Harvard Medical School, Boston, MA 02115
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Some 10- to 100-nm multimeric protein particles effectively prime class
I-restricted CTL of different species when injected as exogenous Ags in
low doses without adjuvants. This has been shown, e.g., for
heat-inactivated virus particles (22, 23, 24), yeast-derived
HIV-1 V3:Ty virus-like particles (25), hepatitis B surface
Ag (HBsAg)3
(26, 27, 28), recombinant parvovirus-like particles
(29), or HIV-1 gag particles (30, 31). A single injection of a low dose of HBsAg particles without
adjuvants into H-2d BALB/c mice efficiently
primes a CTL response (26, 27, 28). The CTL primed in this
response display the CD3+ TCR
ß
CD4- CD8+ phenotype,
recognize the S28–39 epitope of HBsAg, and are
Ld restricted. We have shown that macrophages and
dendritic cells support CTL priming to exogenous HBsAg particles in
vivo (32). We have reviewed the evidence for priming CTL
by exogenous Ag (33).
Very little is known about the CD4+ T cell dependence of priming CD8+ CTL responses to exogenous Ag. One report showed that "cross-priming" of CTL is subjected to regulation by CD4+ T cells (34). Data on the CD4+ T cell dependence of CD8+ CTL responses to exogenous Ags will help us to define conditions under which these Ags can either induce tolerance or prime a potentially protective response. This is particularly important in designing CTL-stimulating vaccines using exogenous, recombinant Ags in immunodeficiency conditions. The identification of adjuvants that can bypass the CD4+ T cell dependence of CTL priming to exogenous Ag will contribute to the development of such vaccines.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
BALB/cJ mice (H-2d) were bred and kept under standard pathogen-free conditions in the animal colonies of Ulm University (Ulm, Germany). Breeding pairs of these mice were obtained from Bomholtgard (Ry, Denmark). BALB/c STAT4-/- "knockout" (KO) mice were generated by Dr. M. J. Grusby (Department of Immunology and Infectious Diseases, Harvard School of Public Health and Department of Medicine, Harvard Medical School, Boston, MA) (35). A breeding colony of these mice was established in Ulm. Female mice were used at 10–16 wk of age.
Cell lines and vector constructs
The H-2d mastocytoma cell line P815 (TIB-64) was obtained from the American Type Culture Collection (ATCC, Manassas, VA). The BMGneo vector was a generous gift of Drs. Y. Karasuyama and F. Melchers, Basel, Switzerland) (36). The establishment of HBsAg (subtype ayw)-expressing P815/S transfectants has been described (26).
Recombinant HBsAg
HBsAg, subtype ayw, was produced in the Hansenula polymorpha host strain RB10 (37). HBsAg particles were purified from crude yeast extracts by adsorption to silica gel, column chromatography, and isopyknic ultracentrifugation (37). HBsAg particles were obtained from Dr. K. Melber (Rhein Biotech, Düsseldorf, Germany).
Peptides
The synthetic 12-mer S28–39 peptide IPQSLDSWWTSL of HBsAg that binds to Ld was synthesized in an Applied Biosystems (Foster City, CA) peptide synthesizer model 431A and purified by reverse-phase HPLC. The peptide were dissolved in a DMSO solution at a concentration of 10 mg/ml and diluted with culture medium for use. 51Cr-labeled cells (105) suspended in 250 µl serum-free UltraCulture medium (cat. no. 12-725F; BioWhittaker, Walkersville, MD) were incubated with 10-7-10-9 M of this peptide for 1 h. Subsequently, cells were washed and used as targets in cytotoxic assays.
HBsAg-encoding plasmid DNA used for nucleic acid vaccination
The HBsAg-encoding XhoI/BglII fragment of HBV (subtype ayw) was obtained from plasmid pTKTHBV2 (a generous gift of Dr. M. Meyer, Munich, Germany) and cloned into the XhoI/BamHI-cut pCI vector (cat. no. E1731; Promega). In the generated plasmid pCI/S, the HBsAg is expressed under control of the human CMV immediate early promoter.
In vivo suppression of CD4+ T cells in mice
CD4+ T cells were suppressed in mice by three injections of the anti-CD4 mAb YTS 191.1. Two days before, at the time of, and two days after the vaccination, mice were i.p. injected with 200 µl PBS containing 100 µg Ab. Flow cytometric analyses of PBMC populations demonstrated that >99% of the CD4+ T cells expressing the respective phenotype were deleted for 4–6 days, about 4% of CD4+ T cells reappeared at day 8 posttreatment, and 5–6% CD4+ T cells reappeared 2 wk posttreatment.
Protein immunization of mice
Mice were injected once i.m. or s.c. (into the base of the tail) with the indicated dose of recombinant HBsAg in 200 µl PBS.
In some experiments, 5 µg HBsAg were mixed with either 50 µg of the oligonucleotide (ODN) TCATTGGAAAACGTTCTTCGGGGCG containing one CpG-immunostimulating sequence (ISS), or with 50 µg of the ODN TCATTGGAAAAGGTTCTTGGGGGGG (ISS*) containing no ISS, or with 50 µg of the ODN TCmATTGGAAAACmGTTCmTCmGGGGCmG (ISSM) containing methylated CpG motives (38). The phosphorothioate-modified ODNs were produced by MWG-Biotech (Ebersberg, Germany). HBsAg mixed with the ODN was injected into mice without adding further adjuvants.
In some experimental groups, HBsAg was coadministered with 1000 U
recombinant murine IFN-
(cat. no. 1276905; Boehringer, Mannheim,
Germany), or 100 ng recombinant murine IL-12 (cat. no. 19361V;
PharMingen, Hamburg, Germany).
Nucleic acid immunization of mice
We injected 50 µl of 1 µg/µl plasmid DNA in PBS into each tibialis anterior muscle (39, 40, 41). All mice received bilateral i.m. injections once.
In vitro restimulation of primed, HBsAg-specific CTL
Spleens were removed from immunized mice 8 days postvaccination.
Single cell suspensions were prepared in -MEM tissue culture medium
supplemented with 10 mM HEPES buffer, 5 x
10-5 M 2-ME, antibiotics, and 10% v/v FCS (Life
Technologies, Eggenstein, Germany). A selected batch of Con
A-stimulated rat spleen cell supernatant (2% v/v) was added to the
culture medium. Responder cells (3 x 107)
were cocultured with 1 x 106 irradiated,
syngeneic P815/S transfectants. Coculture was performed in 10 ml medium
in upright 25-cm2 tissue culture flasks in a
humidified atmosphere/7% CO2 at 37°C. After 5
days of culture, CTL were harvested, washed, and assayed for
HBsAg-specific cytolytic reactivity. All CTL lines generated displayed
the CD3+ CD4-
CD8+ TCRß+
phenotype.
Cytotoxic assay
Serial dilutions of effector cells were cultured with 2 x 103 51Cr-labeled targets in 200 µl round-bottom wells. Specific cytolytic activity of cells was tested in short-term 51Cr-release assays against P815/S transfectant or peptide-pulsed P815 targets. After a 3.5-h incubation at 37°C, 50 µl of supernatant was collected for gamma radiation counting. The percentage specific release was calculated as [(experimental release - spontaneous release)/(total release - spontaneous release)] x 100. Total counts were measured by resuspending target cells. Spontaneously released counts were always less than 15% of the total counts. Data shown are the mean of triplicate cultures. The SD of triplicate data was always less than 20% of the mean.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The HBsAg system is a well-characterized model to study
cross-priming of CTL to exogenous Ag. The injection of low doses of
native HBsAg lipoprotein particles (without adjuvants) by different
routes efficiently primes murine MHC-I-restricted CTL (26, 27). This is confirmed by the data shown in Fig. 1
. A single s.c. injection of HBsAg
(without adjuvants) into H-2d BALB/c mice primed
a CTL response (Fig. 1A). Similar responses were primed by
single i.m. or s.c. injections of 2–10 µg HBsAg into BALB/c mice
(data not shown). This S28–39-specific,
Ld-restricted CTL reactivity was readily detected
as early as 5 days postvaccination in lymph node and spleen cells from
immunized mice (data not shown).
|
E). Neither repeated in vitro restimulations
nor increasing the dose of HBsAg used for vaccination revealed evidence
for CTL priming in CD4+ T cell-depleted mice
(data not shown). The number of independently performed experiments for
each group is listed in table I. These data showed that priming
MHC-I-restricted CTL responses to exogenous HBsAg in "high
responder" BALB/c mice is CD4+ T cell
dependent. The findings confirm data from another Ag system that
"cross-presentation" of peptides in the context of MHC-I molecules
to CD8+ CTL is CD4+ T cell
dependent (34).
|
ODNs containing ISS override the CD4+ T cell dependence of CD8+ CTL priming by exogenous HBsAg
ODNs with ISS enhance the immunogenicity of Ags in mice and tend
to bias immune responses toward the Th1 phenotype (42, 43). A single s.c. injection of 5 µg recombinant HBsAg mixed
with 50 µg ISS-containing ODN into CD4+ T
cell-competent H-2d BALB/c mice enhanced CTL
priming in response to injection of this exogenous Ag (Fig. 1, A and B). Injection of the same dose of HBsAg
mixed with 50 µg ODN containing mutant, nonstimulating sequences
(ISS*) or methylated ISS (ISSM) had no detectable influence on CTL
priming by exogenous HBsAg (Fig. 1, C and D).
In the next series of experiments we immunized
CD4+ T cell-depleted BALB/c mice with exogenous
HBsAg. A CD8+ CTL response to exogenous HBsAg was
not primed by an injection of 5 µg exogenous HBsAg in the absence
of CD4+ "helper" T cells (Fig. 1E). This CTL response was completely restored when HBsAg
mixed with ISS-containing ODN (ISS + ODN) was injected into
CD4+ T cell-depleted mice (Fig. 1F).
Exogenous HBsAg mixed with ODN containing mutated, nonstimulating
sequences (ISS*) or methylated CpG sequences (ISSM) could not
reconstitute the CTL response to exogenous Ag in mice lacking
CD4+ T cells (Fig. 1, G and
H). These data indicate that ODN containing ISS can override
the CD4+ T cell dependence of the
CD8+ CTL response to exogenous HBsAg.
ISS-containing ODN efficiently induce the Th1 cytokines IL-12 and
IFN- (43, 44, 45, 46, 47). When we injected HBsAg particles mixed
with either 100 ng recombinant murine IL-12, or
103 units recombinant murine IFN-, we could
not prime CTL responses to this exogenous viral Ag in
CD4+ T cell-depleted BALB/c mice (data not
shown). We therefore vaccinated IL-12-unresponsive
STAT4-/- KO BALB/c mice (35) with
exogenous HBsAg to find evidence for a role of IL-12 in CTL priming in
this system.
Vaccination of IL-12-nonresponsive STAT4-/- BALB/c mice with exogenous HBsAg primes CD8+ CTL responses only in the presence of immune-stimulating ODN
A single s.c. injection of 5 µg or 10 µg HBsAg particles
without adjuvants into CD4+ T cell-competent
BALB/c mice specifically and efficiently primed CTL (Fig. 1A). In contrast, no evidence for priming of a
HBsAg-specific CTL response was detectable after injections of 5 µg
HBsAg into congenic, IL-12-unresponsive
STAT4-/- BALB/c mice (Fig. 2A). The injection of 10 µg
or 20 µg HBsAg into these genetically engineered "knockout" mice
also failed to prime CTL although this vaccination stimulated high and
specific serum Ab responses against HBsAg (data not shown). This
suggested that IL-12 plays a role in CTL priming to exogenous Ag.
ODN-containing ISS facilitated priming of CTL to exogenous HBsAg in an
IL-12-deficient environment. We could prime CTL from
STAT4-/- KO mice to exogenous HBsAg by
adjuvanting it with ISS-containing ODN (Fig. 2B). Using this
vaccine formulation, HBsAg-specific,
Ld-restricted CD8+ CTL
reactivity was efficiently induced in STAT4-/-
KO mice by a single injection of 5 µg adjuvanted, exogenous
HBsAg.
|
C).
Unexpectedly, the coadministration of ODN with exogenous HBsAg
successfully induced specific and MHC-I-restricted CTL responses also
in CD4+ T cell-depleted
STAT4-/- KO mice (Fig. 2D). This
indicated that ISS-containing ODN facilitate CTL priming to exogenous
HBsAg in the absence of CD4+ T cells and in the
absence of a functional IL-12 response. Priming Ld-restricted, HBsAg-specific CTL by DNA vaccination is CD4+ T cell dependent
DNA vaccination is the most efficient way available to prime
MHC-I-restricted CTL to HBsAg in different mouse strains (39, 40, 41, 48, 49, 50, 51, 52, 53, 54, 55). We have shown that the i.m. and the s.c. injection of
50–100 µg "naked" plasmid DNA into mice elicits potent CTL
responses of defined epitope and restriction specificity
(56). This was confirmed in experiments in which we
injected s.c. or i.m. a single dose of 100 µg DNA of the plasmid
pCI/S (encoding the small surface Ag of HBV) into BALB/c mice. Both
vaccination protocols induced readily detectable HBsAg-specific CTL
responses (Fig. 3, A and
B). When mice were depleted of CD4+ T
cells, none of the DNA vaccination protocols tested primed this
anti-viral CTL response (Fig. 3, C and D).
Neither the pretreatment of the muscle with cardiotoxin before the
plasmid DNA injection (39) nor extending the in vitro
restimulation period of in vivo primed spleen cells revealed evidence
of CTL priming in CD4+ T cell-depleted,
vaccinated mice (data not shown). These data demonstrate that
CD8+ CTL priming by DNA vaccination is dependent
on CD4+ T cell "help" and therefore resembles
the helper-dependence of cross-primed CTL responses. Furthermore, the
data indicate that the efficient priming of murine CTL responses by DNA
vaccination cannot be explained by the potent adjuvanticity of
codelivered bacterial CpG-containing DNA.
|
HBsAg-specific CTL responses could not be primed in
IL-12-unresponsive STAT4-/- KO BALB/c mice by
injecting exogenous HBsAg lipoprotein particles (Fig. 2A).
In contrast, the i.m. injection of HBsAg-encoding pCI/S plasmid DNA
into STAT4-/- KO mice readily primed CTL
specific for this viral surface protein (Fig. 3E). The
elicited cytolytic effector cells expressed the
CD8+ phenotype and were specific for the S28–39
epitope of HBsAg recognized in the context of Ld
(data not shown). The i.m. and the s.c. routes of plasmid DNA injection
were equally effective (data not shown). IL-12 is therefore not a
critical cytokine required for CTL priming by DNA vaccination.
As in normal, IL-12-responsive BALB/c mice (Fig. 3, A and
D), efficient priming of HBsAg-specific CTL by DNA
vaccination was also CD4+ T cell dependent in
IL-12-unresponsive STAT4-/- KO BALB/c mice
(Fig. 3F). Also, under these conditions, the bacterial
plasmid DNA could not provide an adjuvant stimulus that was as
efficient as ISS-containing ODN in facilitating CTL priming to
HBsAg.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The data in Fig. 1, A and E, show that priming of
the CTL response to exogenous HBsAg particles requires
CD4+ T cell "help." Mice injected with
various doses of exogenous HBsAg without adjuvants failed to generate
specific CTL reactivity against HBsAg in the absence of
CD4+ T cells. This was observed irrespective of
the route (s.c. vs i.m.) of immunization. We tested this because the
CD4+ T cell dependence of CTL responses may
differ with different routes of immunization (68). We
could not test the intradermal route because this type of vaccination
stimulates exclusively Th2 responses without priming detectable
CD8+ CTL reactivity (data not shown). Toxicity of
the anti-CD4 Ab treatment in vivo is unlikely because
CD8+ CTL precursors could be primed in treated
mive in the presence of ODNs, and we did not see an effect of this Ab
treatment on serum Ab levels (data not shown). Our data reproduce in a
viral Ag system the only previously published report on the
CD4+ T cell dependence of "cross-priming"
in a transgenic autoantigen system. These reports showed that
the induction of a CD8+ cytotoxic T
lymphocyte response by cross-priming requires cognate
CD4+ T cell help and that class I-restricted
cross-presentation of exogenous self Ags in the absence of
CD4+ T cell "help" leads to deletion of
autoreactive CD8+ T cells (34, 69).
CpG-containing ODNs have been reported to be potent enhancers of specific immunity in mice immunized with recombinant HBsAg (70, 71). ODN with ISS efficiently reconstituted the CD8+ CTL response to exogenous HBsAg in CD4+ T cell-depleted BALB/c mice. ODN showed this effect when it was mixed with HBsAg (without further adjuvants) and delivered i.m. or s.c. (R. Schirmbeck, unpublished observation). Control experiments demonstrated that nonmethylated ODN with well-established ISS motifs were required to observe this "adjuvant effect." ODN may facilitate priming of CTL responses by activating dendritic cells in a way similar to signals physiologically delivered by Ag-stimulated CD4+ T cells (72). The activation of dendritic cells seems to involve CD40/CD40 ligand (CD154) interactions, (73, 74) as well as cytokines. "Activation" results in "presentation-competent" dendritic cells that can activate naive CD8+ CTL precursors.
CD4+ T cell-competent,
STAT4+/+ BALB/c mice generated a CTL response to
exogenous HBsAg, but CD4+ T cell-competent,
STAT4-/- KO BALB/c mice did not (Table I). This suggested a critical role for
IL-12 in this type of CTL priming. Activation of APC may operate
through the release of IL-12 by dendritic cells and/or IFN- by NK
cells or macrophages (42, 43, 75, 76, 77, 78). We could not
reproduce the "adjuvant effect" of ODN by mixing HBsAg with
recombinant IL-12 or IFN- (data not shown). This indicates that
either ODN operate by a mechanism independent of these two Th1
cytokines, or ODN-induced release of these cytokines in situ is more
stimulatory (e.g., relative quantities of bioactive factor or the
kinetic of release) than exogenously substituted cytokines. The
efficacy of ODN as an adjuvant in priming CTL to exogenous HBsAg in
STAT4-/- KO mice shows that at least part of
its mechanism of action is IL-12 independent and may operate either by
other IFN--inducing cytokines (e.g., IL-18) or by directly inducing
an IFN- response.
CTL priming to HBsAg by DNA vaccination was CD4+ T cell dependent but IL-12 independent. Evidence has been presented that i.m. DNA vaccination operates through a "cross-priming" mechanism (63, 64, 65). This may explain the CD4+ T cell-dependent nature of this type of CTL priming. If this assumption is valid, s.c. DNA vaccination would also stimulate immune responses through "cross-priming." The data point to a fundamental (and unexplained) difference between delivering exogenous HBsAg with ISS-containing ODN as adjuvants, and delivering an HBsAg-encoding plasmid vaccine as "naked" DNA. Bacterial plasmid DNA is immunostimulatory, and insect DNA has been shown to support priming of naïve CD8+ CTL precursors (79). We found that bacterial pCI plasmid DNA mixed with HBsAg particles facilitated priming of HBsAg-specific CTL in "low responder" H-2b mice (R. Schirmbeck, unpublished data). Injecting a mixture of (titrated amounts of) ISS-containing ODN and 100 µg pCI/S plasmid DNA i.m. completely suppressed the immunogenicity of HBsAg (R. Schirmbeck, unpublished observation) confirming a previously published report (80). The pCI/S plasmid DNA contains 20 immunostimulating CpG motives (16 within the pCI vector and 4 within the HBsAg-encoding XhoI/BglII fragment). Three of the motifs in the pCI vector DNA contain the 5' AACGTT 3' sequence identical to the one we used in the ODN. It is difficult to compare the relative efficacy of the adjuvant effects of synthetic nuclease-protected (PTO-modified), single-stranded ODN vs plasmid DNA. The described data in the HBsAg system indicate that the "adjuvant effect" of 100 µg pCI/S plasmid DNA is not comparable to that of 10–50 µg synthetic ODN. CTL priming by exogenous HBsAg delivered with ISS-containing ODN was CD4+ T cell independent, but CTL priming to HBsAg by genetic vaccination was CD4+ T cell dependent.
The described data have practical implications for the design of CTL-stimulating vaccine formulations in immunodeficiency conditions such as AIDS. In the absence of CD4+ T cell "help," CD8+ CTL can be efficiently primed in a milieu deficient in the Th1 cytokine IL-12 by exogenous Ag formulated with ISS-containing ODN. Its surprising potency may carry the risk of activating autoreactive immune phenomena by bypassing CD4+ T cell help. This risk may be low in situations of "relative Th1 CD4+ T cell immunodeficiency." Under such conditions, formulations using ODN adjuvants are expected to prove more efficient than DNA-based vaccination.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Jörg Reimann, Department of Medical Microbiology and Immunology, University of Ulm, Helmholtzstrasse 8/1, D-89081 Ulm, Germany. E-mail address:
3 Abbreviations used in this paper: HBsAg (S), small hepatitis B surface Ag; HBV, hepatitis B virus; MHC-I, MHC class I molecule; ODN, oligodeoxynucleotide; ISS, immunostimulating sequence; ISSM, methylated ISS; KO, knockout.
Received for publication March 8, 1999. Accepted for publication June 7, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-facilitated rejection of murine B16 melanomas. J. Immunol. 161:897. and increases the toxicity of lipopolysaccharides. J. Immunol. 156:4570.[Abstract]
production by stimulation of interleukin-12 and tumor necrosis factor-. Cell. Immunol. 167:72.[Medline]
. Proc. Natl. Acad. Sci. USA 93:2879.This article has been cited by other articles:
|
|
 |
|
  P. Riedl, A. Wieland, K. Lamberth, S. Buus, F. Lemonnier, K. Reifenberg, J. Reimann, and R. Schirmbeck Elimination of Immunodominant Epitopes from Multispecific DNA-Based Vaccines Allows Induction of CD8 T Cells That Have a Striking Antiviral Potential J. Immunol., July 1, 2009; 183(1): 370 - 380. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bochtler, C. Wahl, R. Schirmbeck, and J. Reimann Functional Adaptive CD4 Foxp3 T Cells Develop in MHC Class II-Deficient Mice J. Immunol., December 15, 2006; 177(12): 8307 - 8314. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W.-P. Woo, T. Doan, K. A. Herd, H.-J. Netter, and R. W. Tindle Hepatitis B surface antigen vector delivers protective cytotoxic T-lymphocyte responses to disease-relevant foreign epitopes. J. Virol., April 1, 2006; 80(8): 3975 - 3984. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Lindell, T. A. Moore, R. A. McDonald, G. B. Toews, and G. B. Huffnagle Generation of Antifungal Effector CD8+ T Cells in the Absence of CD4+ T Cells during Cryptococcus neoformans Infection J. Immunol., June 15, 2005; 174(12): 7920 - 7928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Boisgerault, P. Rueda, C. M. Sun, S. Hervas-Stubbs, M. Rojas, and C. Leclerc Cross-Priming of T Cell Responses by Synthetic Microspheres Carrying a CD8+ T Cell Epitope Requires an Adjuvant Signal J. Immunol., March 15, 2005; 174(6): 3432 - 3439. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Mason, H. Ariga, R. Neal, D. Valdecanas, N. Hunter, A. M. Krieg, J. K. Whisnant, and L. Milas Targeting Toll-like Receptor 9 with CpG Oligodeoxynucleotides Enhances Tumor Response to Fractionated Radiotherapy Clin. Cancer Res., January 1, 2005; 11(1): 361 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Milas, K. A. Mason, H. Ariga, N. Hunter, R. Neal, D. Valdecanas, A. M. Krieg, and J. K. Whisnant CpG Oligodeoxynucleotide Enhances Tumor Response to Radiation Cancer Res., August 1, 2004; 64(15): 5074 - 5077. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Spies, H. Hochrein, M. Vabulas, K. Huster, D. H. Busch, F. Schmitz, A. Heit, and H. Wagner Vaccination with Plasmid DNA Activates Dendritic Cells via Toll-Like Receptor 9 (TLR9) but Functions in TLR9-Deficient Mice J. Immunol., December 1, 2003; 171(11): 5908 - 5912. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schirmbeck, P. Riedl, R. Zurbriggen, S. Akira, and J. Reimann Antigenic Epitopes Fused to Cationic Peptide Bound to Oligonucleotides Facilitate Toll-Like Receptor 9-Dependent, but CD4+ T Cell Help-Independent, Priming of CD8+ T Cells J. Immunol., November 15, 2003; 171(10): 5198 - 5207. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Dayball, J. Millar, M. Miller, Y. H. Wan, and J. Bramson Electroporation Enables Plasmid Vaccines to Elicit CD8+ T Cell Responses in the Absence of CD4+ T Cells J. Immunol., October 1, 2003; 171(7): 3379 - 3384. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Krishnan, S. Sad, G. B. Patel, and G. D. Sprott Archaeosomes Induce Enhanced Cytotoxic T Lymphocyte Responses to Entrapped Soluble Protein in the Absence of Interleukin 12 and Protect against Tumor Challenge Cancer Res., May 15, 2003; 63(10): 2526 - 2534. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 U. Kumaraguru, C. D. Pack, and B. T. Rouse Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. K. Datta, V. Redecke, K. R. Prilliman, K. Takabayashi, M. Corr, T. Tallant, J. DiDonato, R. Dziarski, S. Akira, S. P. Schoenberger, et al. A Subset of Toll-Like Receptor Ligands Induces Cross-presentation by Bone Marrow-Derived Dendritic Cells J. Immunol., April 15, 2003; 170(8): 4102 - 4110. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Stober, I. Jomantaite, R. Schirmbeck, and J. Reimann NKT Cells Provide Help for Dendritic Cell-Dependent Priming of MHC Class I-Restricted CD8+ T Cells In Vivo J. Immunol., March 1, 2003; 170(5): 2540 - 2548. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. D. Davis, M. Jefford, P. Parente, and J. Cebon Rational approaches to human cancer immunotherapy J. Leukoc. Biol., January 1, 2003; 73(1): 3 - 29. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Gierynska, U. Kumaraguru, S.-K. Eo, S. Lee, A. Krieg, and B. T. Rouse Induction of CD8 T-Cell-Specific Systemic and Mucosal Immunity against Herpes Simplex Virus with CpG-Peptide Complexes J. Virol., June 5, 2002; 76(13): 6568 - 6576. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Cho, J. W. Youn, and Y. C. Sung Cross-Priming as a Predominant Mechanism for Inducing CD8+ T Cell Responses in Gene Gun DNA Immunization J. Immunol., November 15, 2001; 167(10): 5549 - 5557. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. E. Hamilton, A. R. Tvinnereim, and J. T. Harty Listeria monocytogenes Infection Overcomes the Requirement for CD40 Ligand in Exogenous Antigen Presentation to CD8+ T Cells J. Immunol., November 15, 2001; 167(10): 5603 - 5609. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Wang, C. C. Norbury, R. Greenwood, J. R. Bennink, J. W. Yewdell, and J. A. Frelinger Multiple Paths for Activation of Naive CD8+ T Cells: CD4-Independent Help J. Immunol., August 1, 2001; 167(3): 1283 - 1289. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. Kumar, J. Maglione, J. Thatte, B. Pederson, E. Sercarz, and E. S. Ward Induction of a type 1 regulatory CD4 T cell response following V{beta}8.2 DNA vaccination results in immune deviation and protection from experimental autoimmune encephalomyelitis Int. Immunol., June 1, 2001; 13(6): 835 - 841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Kröger, D. Ortmann, T. U. Krohne, L. Mohr, H. E. Blum, H. Hauser, and M. Geissler Growth Suppression of the Hepatocellular Carcinoma Cell Line Hepa1-6 by an Activatable Interferon Regulatory Factor-1 in Mice Cancer Res., March 1, 2001; 61(6): 2609 - 2617. [Abstract] [Full Text]
|
|
|
|
|
|
K. Chan, D. J. Lee, A. Schubert, C. M. Tang, B. Crain, S. P. Schoenberger, and M. Corr The Roles of MHC Class II, CD40, and B7 Costimulation in CTL Induction by Plasmid DNA J. Immunol., March 1, 2001; 166(5): 3061 - 3066. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schirmbeck, X. Zheng, M. Roggendorf, M. Geissler, F. V. Chisari, J. Reimann, and M. Lu Targeting Murine Immune Responses to Selected T Cell- or Antibody-Defined Determinants of the Hepatitis B Surface Antigen by Plasmid DNA Vaccines Encoding Chimeric Antigen J. Immunol., January 15, 2001; 166(2): 1405 - 1413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Krishnan, S. Sad, G. B. Patel, and G. D. Sprott Archaeosomes Induce Long-Term CD8+ Cytotoxic T Cell Response to Entrapped Soluble Protein by the Exogenous Cytosolic Pathway, in the Absence of CD4+ T Cell Help J. Immunol., November 1, 2000; 165(9): 5177 - 5185. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Schirmbeck, J. Wild, D. Stober, H. E. Blum, F. V. Chisari, M. Geissler, and J. Reimann Ongoing Murine T1 or T2 Immune Responses to the Hepatitis B Surface Antigen Are Excluded from the Liver that Expresses Transgene-Encoded Hepatitis B Surface Antigen J. Immunol., April 15, 2000; 164(8): 4235 - 4243. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
