The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH
The Journal of Immunology, 1999, 163: 1733-1736.
Copyright © 1999 by The American Association of Immunologists

CUTTING EDGE

Cutting Edge: IL-4 Production by Mast Cells Does Not Require c-maf1

Melanie A. Sherman, Tammy Y. Nachman and Melissa A. Brown2

Emory University School of Medicine, Department of Experimental Pathology, Graduate Programs in Immunology and Molecular Pathogenesis and Genetics and Molecular Biology, Atlanta, GA 30322


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results and Discussion
 References
 
The c-maf transcription factor is selectively expressed in IL-4-producing Th2 cells. It has been implicated in IL-4 gene transcription based on its ability to directly activate the IL-4 gene in nonexpressing B cells and to promote IL-4-induced Th2 differentiation. However, it has not been definitively shown that IL-4 production by other cells is dependent on the presence of c-maf. Here, we show that IL-4-producing mast cells do not express the c-maf factor. Furthermore, mutation of a defined c-maf binding site within the proximal IL-4 promoter, which profoundly affects transcription in T cells, has no effect on expression of a reporter gene driven by the IL-4 promoter in mast cells. These results demonstrate that c-maf and its target binding site are not required for IL-4 production in all cell types and delineate additional cis- and trans-acting elements that contribute to the cell-type specific transcriptional regulation of IL-4.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results and Discussion
 References
 
The ability of a host to effectively eliminate an invading pathogen depends on the generation of appropriate effector-specific immune responses. Subsets of CD4+ T cells distinguished by their cytokine expression control this decision. Although still poorly defined, early events in an infection involving IL-4 signaling pathways direct the development of these T cell subsets and subsequent cytokine release (for review, see Ref. 1). Th2 cells, which express IL-4 as well as IL-5, IL-6, IL-10, and IL-13, are considered to be protective against extracellular parasites, can down-regulate Th1-mediated autoimmune disease, and promote allergic responses. Bystander non-B, non-T cells (2) such as mast cells and basophils, as well as T cells themselves (3) can produce IL-4 and influence the Th differentiation decision. Thus, understanding the control of IL-4 expression in all IL-4 producing cell types is of great interest.

C-maf, a member of the AP-1 family of transcription factors, has been identified as one of the factors responsible for Th2-specific expression of IL-4 (4). This conclusion is based on several observations: 1) c-maf is expressed in Th2 but not Th1 cells (4); 2) a c-maf binding site, termed MARE, is located within the IL-4 proximal promoter, and mutation of this site significantly reduces IL-4 promoter-mediated transcriptional activation (5); 3) recombinant c-maf specifically associates with this site (4); 4) cotransfection of c-maf and NF-AT expression constructs into B cells can induce ectopic IL-4 expression (4); 5) overexpression of c-maf in vivo results in a significant increase in Th2 cytokines and an inhibition of Th1 cytokines such as IFN-{gamma} (6). Taken together, these results implicate c-maf as a critical factor in regulating the pattern of cytokine expression by T cells through its direct action on IL-4 transcription. In this report, we provide evidence that c-maf and the c-maf binding site (MARE) within the proximal IL-4 promoter does not contribute to IL-4 gene expression in mast cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results and Discussion
 References
 
Cell culture and stimulation

Culture conditions for CFTL15 and bone marrow-derived mast cells (BMMC),3 M12.4.1 B cells, P815- and ABFTL3-transformed mast cells, as well as DO11.10 Th1 and Th2 cells and Jurkat T cells have been described previously (7, 8, 9, 10). Mast cells were stimulated with 1 µg/ml ionomycin (Calbiochem, La Jolla, CA), and T cells were stimulated with 20 ng/ml PMA and ionomycin.

RNA expression analysis

Northern analysis was performed with a c-maf-specific probe corresponding to nucleotides 2263–2680 (11) and a murine IL-4 cDNA probe corresponding to nucleotides 40–412 (12). RT-PCR was performed using the following primers: actin, TGTTACCAACTGGGACGCA (forward) and GGATGGCTACGTACATGGCT (reverse); and c-maf, GTGATGGCTCTTTTGAATTGGG (forward) and AGAGGCTGGGAAACACAGCAAG (reverse).

Nuclear extract preparation and EMSA

CFTL15 and DO11.10 Th1 and Th2 nuclear extracts were prepared and analyzed by EMSA as described previously (13) using the following oligonucleotide probes: MARE, GGAATTGCTGACTCAGCATTACT; AP-1, CGCTTGATGAGTCAGCCGGAA; STAT6 (control), TGATTTCACAGGAAAATT; ARE (-88 to -60 of IL-4 promoter), CTGGTGTAATAAAATTTTCCAATGTAAAC.

IL-4 promoter activity assays

Transient transfections of the -302 IL-4 promoter/chloramphenicol acetyl transferase (CAT) construct have been previously described (13). Briefly, 5 x 106 DO11.10 Th2 cells or CFTL15 mast cells were electroporated with 20 µg of plasmid DNA at 270 V and 260 µF (T cells) or 450 V and 400 µF (mast cells) in a 0.4-cm gap cuvette using a BTX (San Diego, CA) electroporator. The next day, cells were stimulated for 24 h, and then cells were harvested and whole-cell extracts were prepared. CAT activity was determined using a liquid scintillation assay. Equal amounts of protein were used from each extract, and the results are representative of at least three experiments. Data are presented as "percent wild-type"; in T cells the cpm for the -302 wild-type plasmid ranged from 1246 to 2306 cpm. PCAT basic promoterless control plasmid was consistently <20% of this number. The cpms ranged between 5565 to 6425 for the -302 construct in mast cells. Mutations within the MARE binding site at -43 to -38 were generated by site-directed mutagenesis using a "Quick change" kit according to the manufacturer’s protocol (Stratagene, La Jolla, CA). Primers: wild-type IL-4 (-52 to -38), CCCTTGGTTTCAGCAACTTTAACTC; mutant IL-4 (-52 to -38), CCCTTGGTTGACACAACTTTAACTC (mutant nucleotides are bold).


   Results and Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
References
 
Mast cells do not express c-maf mRNA

It was previously shown that c-maf is expressed in Th2 clones but not Th1 clones and is induced during in vitro Th2 differentiation (4). To determine whether this factor is expressed in mast cells, Northern blot analysis was performed using RNA from several T and mast cell lines. As shown in Fig. 1GoA, c-maf mRNA is observed in both unstimulated EL-4 T cells and the DO11.10 Th2 line. However, no message is detectable in any mast cell line or the DO11.10 Th1 cell line. Activation of the mast cells, which induces significant amounts of IL-4 mRNA, has no effect on c-maf expression (Fig. 1GoB). A more sensitive RT-PCR analysis, using c-maf-specific primers, also failed to detect c-maf expression in mast cells (Fig. 1GoC).



View larger version (32K):
[in this window]
[in a new window]
  		FIGURE 1. Mast cells do not express c-maf. A, Total RNA (20 µg) from unstimulated T and mast cells (as indicated) was used in Northern blot analysis with a c-maf probe. B, CFTL15 mast cells and EL-4 T cells were stimulated for 18 h, and 10 µg of total RNA was used in Northern blot analysis. The filter was hybridized first with a c-maf specific probe, then stripped and reprobed for IL-4. C, RT-PCR analysis of c-maf in T and mast cells.

 
The IL-4 MARE element is critical for promoter function in T cells but not mast cells

A half-MARE site is located in the IL-4 promoter adjacent to an essential NF-AT element (4, 5). This region maps to a Th2-specific footprint in the IL-4 promoter and can bind recombinant c-maf protein (4). Using high-resolution mutagenesis of this region, Hodge et al. demonstrated that the MARE sequence must be intact for inducible transcription of a CAT reporter gene driven by the IL-4 promoter (5). C-maf belongs to the maf subfamily of AP-1 proteins and can bind to the MARE sequence as a homodimer or heterodimer with other AP-1 family members (14). Although c-maf is not present in mast cells, it is possible that the MARE element acts through another related factor to control IL-4 transcription. To test this possibility, mutations were introduced in the MARE site in the context of the -302 to +5 bp IL-4 promoter fragment fused to a CAT reporter gene. This mutation disrupts c-maf binding to this site as assessed by gel shift analysis (4, 5). As shown in Fig. 2Go, the MARE mutation abrogates promoter activity in DO11.10 T cell lines, but has little effect on promoter function in CFTL15 mast cells.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 2. The MARE site is required for IL-4 promoter function in T cells but not mast cells. A, Schematic representation of a portion of the proximal regulatory region of the IL-4 promoter indicating the introduced mutations in the MARE element. B, DO11.10 Th2 cells and CFTL15 mast cells were transiently transfected with each construct, then stimulated for 24 h before CAT activity was measured. Results are representative of at least three independent experiments performed with each cell type.

 
EMSA experiments were also performed with a consensus MARE DNA probe and nuclear extracts from T and mast cells. Nuclear extracts from Th2 cells form a specific complex, whereas Th1 extracts form a much weaker and slower migrating complex (Fig. 3Go). However, mast cell extracts do not form specific complexes with the MARE probe. These same extracts can form complexes with the IL-4 ARE (P1) oligonucleotide probe, which binds NF-AT (8, 15) (data not shown), attesting to the integrity of the extract preparation. Together, these results indicate that mast cells do not contain MARE binding factors and that the MARE element within the IL-4 proximal promoter is not a site of IL-4 gene regulation in mast cells.



View larger version (93K):
[in this window]
[in a new window]
  		FIGURE 3. The MARE oligonucleotide binds constitutively to T cell but not mast cell nuclear proteins. EMSA was performed with a radiolabeled MARE probe and nuclear extracts from DO11.10 Th1 and Th2 cells and CFTL15 mast cells. Unlabeled competitor oligonucleotides (100-fold excess) were included to show specificity of binding.

 
It is becoming clear that the mechanisms used by T and mast cells to control IL-4 production are different, reflecting the distinct extracellular signals that elicit IL-4 and the unique role each cell type has in the immune response. In fact, several lines of evidence indicate that mast cells are subject to less stringent control of their IL-4 gene expression than T lymphocytes. T cells, the classic "adaptive" immune cells, require three cell divisions to become fully activated and produce large amounts of IL-4 (16). In contrast, mast cells do not require priming and can induce IL-4 gene transcription within 90 min of stimulation (17). They also constitutively store IL-4 in granules that are poised for immediate release upon cell activation (18). These functional differences can be explained on a molecular level by the unique subset of transcription factors that regulate IL-4 in these two cell types. Normal mast cells do not express either c-maf, as shown here, or GATA-3 (19), demonstrating that these factors are restricted to the Th2 subset and likely ensure a controlled Th2 response. IL-4 gene expression in both T and mast cells is dependent on the inducible activation of NF-AT (8, 15, 20); however, there is evidence that each cell type employs distinct NF-AT isoforms (10, 15). AP-1, which comprises the NF-AT complex at the P1 site and is essential for full promoter activity in T cells, does not act at this site in mast cells. (8). IL-4 production by mast cells is also independent of STAT6 (17). Furthermore, a regulatory element in the second intron binds factors selectively expressed in mast cells including PU.1 and GATA-1 and -2 and exhibits mast cell specific activity in in vitro enhancer-reporter assays (21). Its constitutive activity in these assays may reflect its ability to confer low-level constitutive expression on the IL-4 promoter.

Why would more indiscriminate production of IL-4 by mast cells be permissible, given that the inappropriate or dysregulated production of this cytokine could be harmful to the host? We suggest that unconstrained mast cell-derived IL-4 is not detrimental for three reasons. First, mast cells release much less IL-4 as T cells on a per cell basis (M. Sherman, unpublished observations). Second, although mast cells are concentrated mainly at the host/environment interface (such as the skin and gut), at the initial infection their number is low (22) compared with the massive lymphocytic infiltration seen at later stages of infection. Third, recent data from our laboratory (17) support the idea that mast cells have evolved an inhibitory feedback loop for IL-4 production. A truncated IL-4-induced STAT6 isoform, uniquely expressed in mast cells, binds to and represses the IL-4 promoter in these cells. This idea is further supported by the observation that STAT6-deficient mice have increased IL-4-induced mastocytosis (23). Thus, despite the lack of controls on early expression of IL-4 in activated mast cells, there appears to be an intrinsic mechanism to regulate late expression of this cytokine in an immune response.

Based on studies of infections in mast cell-deficient mice, it has been proposed that mast cells act as innate "sentinels" that initiate and regulate the ensuing protective response (24, 25, 26). This model is supported by data showing that mast cells can be activated by bacterial or parasitic Ags (27, 28), they can migrate to primary lymphoid organs after activation (29), and they can process and present Ags to T cells via class II MHC molecules (30). Our results fit with this model, suggesting that the rather indiscriminate release of IL-4 by mast cells early in an infection could induce or expand T cells for an effective late-phase Th2 response to pathogens.


   Acknowledgments
 
We thank Dr. Judy Kapp for providing DO11.10 cells, John Hural and Doris Powell for technical assistance, and Ginny Secor for critical reading of the manuscript.


   Footnotes
 
1 This research was supported by National Institutes of Health Grant CA 47992. M.A.S. is a fellow of the Cancer Research Institute and a scholar of the Leukemia Society of America. Back

2 Address correspondence and reprint requests to Dr. Melissa A. Brown, Department of Experimental Pathology, Emory University School of Medicine, Woodruff Memorial Building, Room 7311, 1639 Pierce Drive, Atlanta, GA 30322. E-mail address: Back

3 Abbreviations used in this paper: BMMC, bone marrow-derived mast cells; CAT, chloramphenicol acetyl transferase. Back

Received for publication April 16, 1999. Accepted for publication June 4, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

  1. O’Garra, A.. 1998. Cytokines induce the development of functionally heterogeneous T helper cell subsets. Immunity 8:275.[Medline]
  2. Conrad, D. H., S. Z. Ben-Sasson, G. Le Gros, F. D. Finkelman, W. E. Paul. 1990. Infection with Nippostrongylus brasiliensis or injection of anti-IgD antibodies markedly enhances Fc-receptor-mediated interleukin 4 production by non-B, non-T cells. J. Exp. Med. 171:1497.[Abstract/Free Full Text]
  3. Rincon, M., J. Anguita, T. Nakamura, E. Fikrig, R. A. Flavell. 1997. Interleukin (IL)-6 directs the differentiation of IL-4-producing CD4+ T cells. J. Exp. Med. 185:461.[Abstract/Free Full Text]
  4. Ho, I.-C., M. Hodge, J. W. Rooney, L. H. Glimcher. 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85:973.[Medline]
  5. Hodge, M. R., J. W. Rooney, L. H. Glimcher. 1995. The proximal promoter of the IL-4 gene is composed of multiple essential regulatory sites that bind at least two distinct factors. J. Immunol. 154:6397.[Abstract]
  6. Ho, I.-C., D. Lo, L. H. Glimcher. 1998. c-maf promotes T helper cell type 2 (Th2) and attenuates Th1 differentiation by both interleukin 4-dependent and -independent mechanisms. J. Exp. Med. 188:1859.[Abstract/Free Full Text]
  7. Murphy, K. M., A. B. Heimberger, D. Y. Loh. 1990. Induction by antigen of intrathymic apoptosis of CD4+ CD8+ TCRlo thymocytes in vivo. Science 250:1720.[Abstract/Free Full Text]
  8. Tara, D., D. L. Weiss, M. A. Brown. 1995. Characterization of the constitutive and inducible components of a T cell activation responsive element. J. Immunol. 154:4592.[Abstract]
  9. Brown, M. A., J. H. Pierce, C. J. Watson, J. Falco, J. N. Ihle, W. E. Paul. 1987. B cell stimulatory factor-1/interleukin-4 mRNA is expressed by normal and transformed mast cell lines. Cell 50:809.[Medline]
  10. Sherman, M. A., D. R. Powell, D. L. Weiss, M. A. Brown. 1999. NF-ATc isoforms are differentially expressed and regulated in murine T and mast cells. J. Immunol. 162:2820.[Abstract/Free Full Text]
  11. Kurschner, C., J. I. Morgan. 1995. The maf proto-oncogene stimulates transcription from multiple sites in a promoter that directs Purkinje neuron-specific gene expression. Mol. Cell. Biol. 15:246.[Abstract]
  12. Lee, F., T. Yokota, T. Otsuka, P. Meyerson, P. Meyerson, D. Villaret, T. Coffman, D. Mosmann, N. Rennick, C. Roehm, A. Zlotnick Smith, K. Arai. 1986. Isolation and characterization of a mouse interleukin cDNA clone that expresses B-cell stimulatory factor activities and T-cell and mast cell-stimulating activities. Proc. Natl. Acad. Sci. USA 83:2061.[Abstract/Free Full Text]
  13. Tara, D., D. L. Weiss, M. A. Brown. 1993. An activation responsive element in the murine interleukin-4 gene is the site of an inducible DNA-protein interaction. J. Immunol. 151:3617.[Abstract]
  14. Sakai, M., J. Imaki, K. Yoshida, A. Ogata, Y. Matsushima-Hibiya, Y. Kuboki, M. Nishizawa, S. Nishi. 1997. Rat maf related genes: specific expression in chondrocytes, lens and spinal cord. Oncogene 14:745.[Medline]
  15. Weiss, D., J. Hural, D. Tara, L. Timmerman, G. Henkel, M. Brown. 1996. Nuclear factor of activated T cells is associated with a mast cell Interleukin 4 transcription complex. Mol. Cell. Biol. 16:228.[Abstract]
  16. Bird, J. J., D. R. Brown, A. C. Mullen, N. H. Moskowitz, M. A. Mahowald, J. R. Sider, T. F. Gajewski, C.-R. Wang, S. L. Reiner. 1998. Helper T cell differentiation is controlled by the cell cycle. Immunity 9:229.[Medline]
  17. Sherman, M. A., V. H. Secor, S. K. Lee, R. D. Lopez, M. A. Brown. 1999. STAT6-independent production of IL-4 by mast cells. Eur. J. Immunol. 29:1235.[Medline]
  18. Bradding, P., I. H. Feather, P. H. Howarth, R. Mueller, J. A. Roberts, K. Britten, J. P. A. Bews, T. C. Hunt, Y. Okayama, C. H. Heusser, G. R. Bullock, M. K. Church, S. T. Holgate. 1992. Interleukin-4 is localized to and released by human mast cells. J. Exp. Med. 176:1381.[Abstract/Free Full Text]
  19. Zon, L. I., M. F. Gurish, R. L. Stevens, C. Mather, D. S. Reynolds, K. F. Austen, S. H. Orkin. 1991. GATA-binding transcription factors in mast cells regulate the promoter of the mast cell carboxypeptidase A gene. J. Biol. Chem. 266:22948.[Abstract/Free Full Text]
  20. Rooney, J. W., T. Hoey, L. H. Glimcher. 1995. Coordinate and cooperative roles for NF-AT and AP-1 in the regulation of the murine IL-4 gene. Immunity 2:473.[Medline]
  21. Henkel, G., M. A. Brown. 1994. PU.1 and GATA: components of a mast cell-specific interleukin 4 intronic enhancer. Proc. Natl. Acad. Sci. USA 91:7737.[Abstract/Free Full Text]
  22. Kitamura, Y., S. Go, K. Hatanaka. 1978. Decrease of mast cells in W/Wv mice and their increase by bone marrow transplantation. Blood 52:447.[Abstract/Free Full Text]
  23. Urban, J. F., N. Noben-Trauth, D. D. Donaldson, K. B. Madden, S. C. Morris, M. Collins, F. D. Finkelman. 1998. IL-13, IL-4R{alpha}, and STAT6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity 8:255.[Medline]
  24. Malaviya, R., T. Ikeda, E. Ross, S. N. Abraham. 1996. Mast cell modulation of neutrophil influx and bacterial clearance at sites of infection through TNF-{alpha}. Nature 381:77.[Medline]
  25. Lantz, C. S., J. Boesiger, C. H. Song, N. Mach, T. Kobayashi, R. C. Mulligan, Y. Nawa, G. Dranoff, S. J. Galli. 1998. Role for interleukin-3 in mast cell and basophil development and in immunity to parasites. Nature 392:90.[Medline]
  26. Echtenacher, B., D. Mannel, L. Hultner. 1996. Critical protective role of mast cells in a model of acute septic peritonitis. Nature 381:75.[Medline]
  27. Abraham, S. N., R. Malaviya. 1997. Mast cells in infection and immunity. Infect. Immun. 65:3501.[Medline]
  28. Bidri, M., I. Vouldoukis, M. D. Mossalayi, P. Debre, J.-J. Guillosson, D. Mazier, M. Arock. 1997. Evidence for direct interaction between mast cells and Leishmania parasites. Parasite Immunol. 19:475.[Medline]
  29. Wang, H.-W., N. Tedia, A. R. Lloyd, D. Wakefield, H. P. McNeil. 1998. Mast cell activation and migration to lymph nodes during induction of an immune response in mice. J. Clin. Invest. 102:1617.[Medline]
  30. Frandji, P., C. Oskeritzian, F. Cacraci, J. Lapeyre, R. Peronet, B. David, J.-G. Guillet, S. Mecheri. 1993. Antigen-dependent stimulation by bone marrow-derived mast cells of MHC class II-restricted T cell hybridoma. J. Immunol. 151:6318.[Abstract]



This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
R. Yagi, S. Tanaka, Y. Motomura, and M. Kubo
Regulation of the Il4 Gene Is Independently Controlled by Proximal and Distal 3' Enhancers in Mast Cells and Basophils
Mol. Cell. Biol., December 1, 2007; 27(23): 8087 - 8097.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
L. Chen, W. He, S. T. Kim, J. Tao, Y. Gao, H. Chi, A. M. Intlekofer, B. Harvey, S. L. Reiner, Z. Yin, et al.
Epigenetic and Transcriptional Programs Lead to Default IFN-{gamma} Production by {gamma}{delta} T Cells
J. Immunol., March 1, 2007; 178(5): 2730 - 2736.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
S. Monticelli, D. U. Lee, J. Nardone, D. L. Bolton, and A. Rao
Chromatin-based regulation of cytokine transcription in Th2 cells and mast cells
Int. Immunol., November 1, 2005; 17(11): 1513 - 1524.
[Abstract] [Full Text] [PDF]

Home page
 ChestHome page
R. Taha, Q. Hamid, L. Cameron, and R. Olivenstein
T Helper Type 2 Cytokine Receptors and Associated Transcription Factors GATA-3, c-MAF, and Signal Transducer and Activator of Transcription Factor-6 in Induced Sputum of Atopic Asthmatic Patients
Chest, June 1, 2003; 123(6): 2074 - 2082.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. A. Sherman, D. R. Powell, and M. A. Brown
IL-4 Induces the Proteolytic Processing of Mast Cell STAT6
J. Immunol., October 1, 2002; 169(7): 3811 - 3818.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
Z. Wu, D. R. Turner, and D. B. G. Oliveira
Antioxidants inhibit mercuric chloride-induced early vasculitis
Int. Immunol., March 1, 2002; 14(3): 267 - 273.
[Abstract] [Full Text] [PDF]

Home page
 J. Leukoc. Biol.Home page
E. D. White, R. P. Andrews, and G. K. K. Hershey
Sulfhydryl-2 domain-containing protein tyrosine phosphatase-1 is not a negative regulator of interleukin-4 signaling in murine mast cells
J. Leukoc. Biol., May 1, 2001; 69(5): 825 - 830.
[Abstract] [Full Text]

Home page
 J. Immunol.Home page
J. A. Hural, M. Kwan, G. Henkel, M. B. Hock, and M. A. Brown
An Intron Transcriptional Enhancer Element Regulates IL-4 Gene Locus Accessibility in Mast Cells
J. Immunol., September 15, 2000; 165(6): 3239 - 3249.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. Masuda, T. Matsuguchi, K. Yamaki, T. Hayakawa, M. Kubo, W. J. LaRochelle, and Y. Yoshikai
Interleukin-15 Induces Rapid Tyrosine Phosphorylation of STAT6 and the Expression of Interleukin-4 in Mouse Mast Cells
J. Biol. Chem., September 15, 2000; 275(38): 29331 - 29337.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sherman, M. A.
Right arrow Articles by Brown, M. A.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*UniGene
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS