| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Los Alamos National Laboratory, Los Alamos, NM; and
National Jewish Medical and Research Center and University of Colorado Health Sciences Center, Denver, CO
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
CBD is characterized by hypersensitivity to beryllium measured by the
lymphocyte proliferation test (LPT) (8, 9). Lung T cells
from CBD patients proliferate in vitro specifically in response to
beryllium, with an increase in total T cells, in
CD4+ T cells, and in CD4/CD8 ratio
(10). Because CD4+ T cells, i.e.,
helper cells, predominate in the response to beryllium, it was
hypothesized that the TCRs, with the help of CD4 molecules, recognize
hapten-tagged peptides (peptides with a chemical or metal group
attached to amino acid residues) presented by the MHC HLA class II.
This interaction on the surface of APCs triggers T cell activation and
proliferation. This hypothesis was supported by the finding that the
proliferation of beryllium T cell lines was blocked only by the
anti-HLA class II Ab, but not by anti-HLA class I Ab
(10) and that a much higher rate of T cell subset
expansions occurred in the bronchoalveolar lavage from CBD patients
compared with the control group (11). Thus, not
surprisingly, an association was found between CBD cases and an HLA
class II gene, specifically in the HLA-DPB1 locus (12, 13). Although over 95% of the CBD patients were found to have a
glutamic acid residue encoded at the 69th position of the mature
HLA-DPB1 protein, 30–45% of the control group (exposed but not
affected) also expressed the same amino acid. With the low prevalence
of CBD, the majority of beryllium-exposed
Glu69-carrying individuals do not develop the
disease, which suggests that the presence or absence of
Glu69 is not the sole susceptibility factor for
disease development. In this study, we sought to extend these findings
to widen the difference between CBD individuals from controls and find
a marker or markers that may eventually be useful for determining
individual susceptibility to development of CBD. We report here that
other positions on the HLA-DPB1 gene, in addition to the
Glu69 marker, also appear to play an important
role in the disease. In addition, the HLA-DPA1 gene, which encodes for
the 
-chain of the HLA-DP heterodimer complex, appears also to be
involved.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The DNA samples carrying Glu69 (either heterozygous or homozygous) in the DPB1 gene were further analyzed for precise assignment of both alleles from each individual to reveal the possible differences in the allelic distribution between the disease group and the control group. The designation of alleles of each individual was obtained by a comparison of all polymorphic positions in the determined sequence with all known allele sequences retained in the existing HLA-DP database along with their heterozygous combinations (15). Ambiguous DPB1 allele combinations were further resolved by a second round of direct sequencing of selectively amplified alleles using group-specific primers. To specifically amplify one allele of the individuals who have an ambiguous allele combination, either primers complementary to position 69 or to positions 84–87 were used in combination with one generic 5' primer (UG19). The choice of using group-specific primers complementary to which position (69 or 84–87) depended on the information obtained from the first-round DNA sequencing in which generic intron primers (UG19 and UG21) were used at both 5' and 3' ends. Three position 84–87-specific primers were designed: Gly84R (GCTGCAGGGTCATGGGCCCGC), Asp84R (GCTGCAGGGTCACGGCCTCGT), and Val84R (GCTGCAGGGTCATGGGCCCGA). Two of these three primers were chosen for each DNA sample according to the information from the first-round DNA sequencing. Three position 69-specific primers were designed: Glu69R (CTGTCCGGCACTGCCCGCTC), Lys69R (CTGTCCGGCACTGCCCGCTT), and Arg69R (CTGTCCGGCACTGCCCGCC). Two of these three primers were chosen for each DNA sample according to the information from the first-round DNA sequencing. Because exon 2 of the HLA-DPA1 gene has less variation and fewer allelic types than exon 2 of the DPB1 gene, one round of sequencing of PCR products of the DPA1 exon 2 amplified by two generic primers (DPA1Fil GCTTTGACCACTTGCATATTCAAACTGA and DPA1Ri2 CCTTCCAGTTGGGCTACAGA) for all alleles was sufficient for precise allele assignment of every DNA sample.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Table I
shows the frequencies of
individuals carrying at least one copy of GAG (Glu) at position 69 of
their DPB1 genes from the disease group (95%) and the control group
(45%). These data are consistent with published data on the frequency
of the Glu69 marker in the CBD and unaffected
individuals (12).
|
After first-round automated DNA sequencing of exon 2 of the
HLA-DPB1 gene using the generic intron primers UG19 and UG21, the
non-Glu69-carrying individuals were removed from
subsequent analysis. The DNA samples that carried the
Glu69 marker were further analyzed for precise
allele assignment of Glu69-carrying alleles as
described in Materials and Methods. Fig. 1, A and B, is an
example of how the ambiguous DPB1 allele combinations were resolved by
a second round of DNA sequencing in which the exon 2 of HLA-DPB1 genes
was selectively amplified by group-specific primers. Different alleles
from three DNA samples (two homozygous samples, sample A and B, and one
heterozygous sample, sample C) were specifically PCR amplified only by
the group-specific 3' primers (Gly84R or
Asp84R) that were perfectly complementary to the
corresponding alleles shown in Fig. 1A, and therefore a
complete separation of all the polymorphic positions of a heterozygous
DNA sample (sample C shown in Fig. 1A) was obtained during
the second-round automated DNA sequencing shown in Fig. 1B.
|
, most people in the control
group have "type A" amino acid and nucleic acid sequences (Gly Gly
Pro Met; GGC GGG CCC ATG) at the position 84–87 of their
Glu69-containing alleles (23/34 if both
heterozygous and homozygous Glu69-carrying
individuals are included or 22/33 if only heterozygous
Glu69-carriers are included). However, most
people in the CBD group have a different sequence denoted "type B"
sequences (Asp Glu Ala Val; GAC GAG GCC GTG, 16/19 both heterozygous
and homozygous Glu69 individuals or 11/14
heterozygous Glu69 individuals only).
Furthermore, as shown in Table III, most
individuals in the control group have type A sequences (Leu Phe Gly;
CTT TTC GGA) at positions 8, 9, and 11 of their
Glu69-containing alleles (24/34 both homozygous
and heterozygous Glu69 carriers or 23/33
heterozygous Glu69 carries only), while most
people in the CBD group have type B sequences (Val His Leu, GTG CAC
TTA; or Val Tyr Leu, GTG TAC TTA; 15/19 both homozygous and
heterozygous Glu69 carriers or 10/14 heterozygous
Glu69 carries only). All of the individuals from
both groups who have type A sequences at the position 84–87 also have
type A sequences at positions 8, 9, and 11. Representatives of such
alleles are almost exclusively DPB1 allele *0201 in these two groups
with only one exception, which is allele *0202, a sister allele with a
very similar protein structure to *0201 (aa 35 Phe in *0201 was
substituted by Leu in *0202, and aa 55 Asp in *0201 was substituted by
Glu in *0202). Most people (10/12 in the control group and 15/16 in the
CBD group) with type B amino acid sequences at the position 84–87 also
have type B sequences at positions 8, 9, and 11. Representatives of
such alleles are DPB1 allele *1701, *1001, *0901, *1301, and *0601.
Table IV is the DPB1 allele distribution
of Glu69-carrying individuals from the disease
and the control groups. Because the non-*0201
Glu69-carrying alleles are relatively rare
alleles in the whole population, and, because of the small sample
number of these alleles in this study, we did not compare any
individual rare alleles between the disease the control groups.
Instead, the rare Glu69-carrying alleles were
grouped into one group, called the "non-*0201
Glu69-carrying alleles" group. This group was
compared with a group of the most common
Glu69-carrying allele, *0201, in phenotypic
frequency between the disease and the control groups as shown in Table IV. This comparison was done to be more meaningful statistically. It is
also more reasonable biologically since the current hypothesis about
the susceptibility to CBD is based on the HLA-DP structural genes and
these rare Glu69-carrying DPB1 alleles have
common protein/DNA sequences at the aa positions 8–11 and 84–87,
which are different from those of allele *0201. As shown in Table IV,
the phenotypic frequency of non-*0201
Glu69-carrying alleles in
Glu69 carriers showed a dramatic increase in the
disease group (84.21%) compared with the control group (35.29%),
while the phenotypic frequency of *0201 alleles in
Glu69 carriers showed a substantial decrease in
the CBD group (42.11%) compared with the control group (67.65%). The
major differences between these two types of alleles (*0201, commonly
seen in the control group, and non-*0201, commonly seen in the CBD
group) involve a change of 7 amino acids (positions 8, 9, 11, and
84–87). Three of these 7 amino acid changes (positions 9, 84, and 85)
are changes between different amino acid groups, i.e., from hydrophobic
to hydrophilic amino acids. In addition, a change from Ala to Pro at
position 86 may also be important. These differences could alter the
folding property of the 
-chain of the DPB1 gene and also affect the
binding property to the -chain coded by the DPA1 gene. As for allele
*1901, which has the same sequence at positions 84–87 with non-*0201
Glu69-carrying alleles but the same sequence at
position 8–11 with allele *0201, we grouped it into the more
susceptible category, non-*0201, which was more conservative for the
risk estimation. In this study, it will not affect the statistics
significantly to group allele *1901 into either group (*0201 or
non-*0201) because allele *1901 has a nearly identical phenotypic
frequency in the disease (5.26%) and the control (5.88%) groups shown
in Table IV.
|
|
|
2 = 22.3, corrected (6)
p < 0.0006; odds ratio = 14; confidence interval,
4.0–49.4). The p value was corrected for the total number
of six different non-*0201 Glu69 DPB1 alleles
compared, indicated in the parentheses. This extremely high frequency
(50% of alleles *1701, *0901, or *1001 in CBD patients) is well above
any recorded previously (16, 17, 18, 19, 20, 21, 22). There are no significant
differences in the allele distribution of DPB1 genes among our control
individuals compared with the existing data bases with relevant ethnic
groups (16, 17, 18, 19, 20, 21, 22). In both our control group and in the
published literature, *0401 is the most common DPB1 allele in the total
population, and *0201 is the most common
Glu69-carrying DPB1 allele. Alleles *1701, *0901,
and *1001 differ from other non-*0201 Glu69
alleles (*1301 and *0601) at the aa position 9, or both positions 9 and
55–56, suggesting that these positions specifically are related to the
process of disease development among these non-*0201
Glu69 carriers. Association of HLA-DPB1 alleles with -DPA1 alleles
The -chain of the HLA-DPB1 gene must form a heterodimer complex
with the -chain of the DPA1 gene to have Ag-binding and -presenting
properties. Because these two genes are physically separated by only
1–2 kb (23, 24) and show strong linkage disequilibrium
(16), we also sequenced the DPA1 genes from all of the DNA
samples that contained Glu69 alleles in their
DPB1 loci. It was found that almost all of the DPB1 allele *0201
carriers (22/22 in the control group and 7/8 in the CBD group) have at
least one allele *0103 of their DPA1 gene. By comparison, most
non-*0201 Glu69 allele carriers (12/13 in the
control group and 14/16 in the CBD group) have at least one DPA1 *02
allele (predominantly *02011). The DPB1 *0201 allele was reported to be
exclusively associated with the DPA1 allele *01 (16), but
among the 30 *0201 Glu69-carriers from our
control and CBD groups, there was one exception observed, which does
not have an *01 DPA1 allele but has a homozygous *02011 DPA1 allele.
This very rare exception was a CBD case individual, which further
suggests that the DPA1 *02 allele might facilitate disease development.
The main differences between DPA1 *0103 and *02011 alleles involves
three amino acids at positions 31, 50, and 83. All of these three amino
acid changes are changes between different amino acid groups (from
hydrophobic to hydrophilic or from uncharged to charged amino acids).
These differences might affect the folding property of the -chain of
the HLA-DP genes and the dimer formation between the -chain and the
-chain of the HLA-DP genes. We speculate that the dimers formed by
both structurally different -chain and -chain may completely
alter the properties of the binding pocket for the Ag, thereby causing
different susceptibilities to CBD.
High susceptibility to CBD contributed by homozygous Glu69 carriers
Another observation from our experiments is that homozygous
Glu69 carriers were found almost exclusively in
the CBD group (Table I
). Six
Glu69/Glu69 individuals out
of 20 individuals were found in the CBD group, compared with only 1 of
75 in the control group. On the contrary, the heterozygous individuals,
who have one Glu69-containing allele and one
non-Glu69-containing allele, were found only
slightly more frequently in the CBD group (13 of 20) than in the
control group (33 of 74). This finding suggests to us that
Glu69 alone is not sufficient for the disease
susceptibility and that some other factors must also be involved in the
disease development. Interestingly, among these six
Glu69/Glu69 from the CBD
group, only one of them was homozygous for *0201. The other five have
one *0201 allele and one non-*0201 Glu69-carrying
allele. If we remove the
Glu69/Glu69 individuals
from both groups, the frequency of heterozygous *0201 individuals in
the CBD group (2 of 14) does not show an increase compared with the
control group (22 of 74) but rather shows a substantial decrease. By
comparison, the heterozygous non-*0201 Glu69
carriers do show a substantial increase in the CBD group (11 of 14)
over the control group (11 out 74). This suggests that the DPB1 allele
*0201 is not a major disease allele but the rare non-*0201
Glu69-carrying alleles are. The very high
susceptibility of
Glu69/Glu69 individuals to
CBD is therefore mainly due to the presence of non-*0201
Glu69 alleles. It may also indicate the absence
of a protective effect conferred by non-Glu69
alleles, predominantly DPB1 allele *0401, an allele that was reported
to have some protective function against allergic asthma
(25).
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the previous landmark study (12), the Glu69 marker was shown to be highly associated with CBD (97%), but also showed a high association with the control group. The specific major disease allele was claimed to be the most common Glu69-carrying HLA-DPB1 allele, *0201. There are several possible reasons for the different conclusions reached here in this study and in the Richeldi et al. study. (12). First, a less sensitive technique was used in the original studies by Richeldi et al. (partial regional group-specific hybridization vs two rounds whole-exon two DNA sequencing). Second, a limited set of probes was used and a limited number of regions were determined in the Richeldi et al. study. To correctly assign the HLA-DP alleles by hybridization with group-specific oligonucleotides, more probes and more variable regions in addition to regions C (coding for aa 55–57) and D (coding for aa 69), and especially regions A (coding for aa 8–11) and F (coding for aa 84–87), should have been used, as reported in the literature before 1993 by other researchers (14, 26, 27). Third, the unnecessary single nucleotide insertion compared with the previous literature (14, 26, 27) in three (DB14, DB18 and DB19) of four group-specific oligonucleotides used by Richeldi et al. probably further reduced the accuracy of the allele assignment.
Fig. 2 is a schematic illustration of
several typical haplotypes commonly seen in CBD patients
(Glu69 and non-Glu69
individuals) and the control group (Glu69 and
non-Glu69 individuals). The rarest allele
combination seen in the control group or total population, the
Glu69/Glu69 individual, has
a very high frequency in CBD and is followed by a relatively rare
allele combination, heterozygous non-*0201 Glu69
alleles, which also has a higher frequency in the CBD sample. The sum
of these two rare groups
(Glu69/Glu69 and non-*0201
Glu69 heterozygotes) accounts for 85% of the CBD
sample, but only for 16% of the control sample
(2 = 35.446, corrected (4)
p < 0.0004; odds ratio = 29.8; confidence
interval = 7.6–117.5). On the contrary, the most common allele
combination (non-Glu69 individuals, predominantly
Lys69/Lys69) seen in the
control group (54.7%) or total population is not found frequently in
CBD (5%). It is followed by the relatively common allele combination,
*0201 Glu69/non-Glu69
individuals, which is found at substantially lower frequencies in CBD
(10%) than in controls (29.3%). The dramatic differences in
Glu69 allele frequencies between CBD and control
groups strongly implicate a genetic risk factor in the development of
CBD and further may explain why CBD incidence does not correlate very
well with the exposure levels. Based on our results, the disease
predictive value of having the Glu69 marker is
only 0.36. By comparison, the CBD predictive value for having non-*0201
Glu69 alleles is 0.57, and the predictive value
of having two Glu69-containing alleles is 0.85.
These results support the hypothesis that it is not the mere presence
of Glu69, per se, but the allele types and their
copy number (homozygous or heterozygous) that confer greatest
susceptibility to development of CBD in beryllium-exposed
individuals.
|
. It
would be of interest retrospectively to determine the allele type
combination of those CBD patients as well as their histories of
beryllium exposure. The approach of allele designation used here is
powerful for addressing future mechanistic and structural studies of
beryllium interactions with tissue. Screening of detailed allele
designation at HLA-DP loci among beryllium workers would provide a very
useful tool for measuring genetic risk. Such a screening tool could be
incorporated into existing CBD prevention programs, which now focus
mainly on exposure risk and early disease detection with the lymphocyte
proliferation test. It may also prove to be useful for the development
of diagnostic tools for susceptibility to other DPB1
Glu69-related diseases (28, 29, 30)
where a higher predictive value than dichotomous testing for the
presence or absence of a single marker would be desirable. By far the
most important contribution from our findings is the potential impact
that they may have on the use of genetic information to prevent further
cases of CBD from occurring. Although legal and ethical issues must be
addressed, the CBD-HLA case may, in the future, lead to the first
example for use of a genetic screening test in the workplace to
virtually eliminate or drastically reduce the occurrence of an
occupational disease.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Babetta L. Marrone, LS-5, M888, Life Science Division, Los Alamos National Laboratory, Los Alamos, NM 87545. E-mail address:
3 Abbreviations used in this paper: CBD, chronic beryllium disease; LPT, lymphocyte proliferation test.
Received for publication December 14, 1998. Accepted for publication May 24, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
gene. Nucleic Acids Res. 13:7515. gene and the region between the DP 1 and DP 1 genes: comparison of the 5' ends of HLA class II genes. Nucleic Acids Res. 13:1607. and DP- loci. J. Immunol. 141:4024.[Abstract]
chain. Eur. J. Immunol. 27:2741.[Medline]This article has been cited by other articles:
|
|
 |
|
  D C Christiani, A J Mehta, and C-L Yu Genetic susceptibility to occupational exposures Occup. Environ. Med., June 1, 2008; 65(6): 430 - 436. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Fontenot, T. S. Keizer, M. McCleskey, D. G. Mack, R. Meza-Romero, J. Huan, D. M. Edwards, Y. K. Chou, A. A. Vandenbark, B. Scott, et al. Recombinant HLA-DP2 Binds Beryllium and Tolerizes Beryllium-Specific Pathogenic CD4+ T Cells J. Immunol., September 15, 2006; 177(6): 3874 - 3883. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Bill, D. G. Mack, M. T. Falta, L. A. Maier, A. K. Sullivan, F. G. Joslin, A. K. Martin, B. M. Freed, B. L. Kotzin, and A. P. Fontenot Beryllium Presentation to CD4+ T Cells Is Dependent on a Single Amino Acid Residue of the MHC Class II {beta}-Chain J. Immunol., November 15, 2005; 175(10): 7029 - 7037. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. T. Sawyer, C. E. Parsons, A. P. Fontenot, L. A. Maier, M. M. Gillespie, E. B. Gottschall, L. Silveira, and L. S. Newman Beryllium-Induced Tumor Necrosis Factor-{alpha} Production by CD4+ T Cells Is Mediated by HLA-DP Am. J. Respir. Cell Mol. Biol., July 1, 2004; 31(1): 122 - 130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. Maier, D. S. McGrath, H. Sato, P. Lympany, K. Welsh, R. du Bois, L. Silveira, A. P. Fontenot, R. T. Sawyer, E. Wilcox, et al. Influence of MHC CLASS II in Susceptibility to Beryllium Sensitization and Chronic Beryllium Disease J. Immunol., December 15, 2003; 171(12): 6910 - 6918. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Gamerdinger, C. Moulon, D. R. Karp, J. van Bergen, F. Koning, D. Wild, U. Pflugfelder, and H. U. Weltzien A New Type of Metal Recognition by Human T Cells: Contact Residues for Peptide-independent Bridging of T Cell Receptor and Major Histocompatibility Complex by Nickel J. Exp. Med., May 19, 2003; 197(10): 1345 - 1353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Iannuzzi, M. J. Maliarik, L. M. Poisson, and B. A. Rybicki Sarcoidosis Susceptibility and Resistance HLA-DQB1 Alleles in African Americans Am. J. Respir. Crit. Care Med., May 1, 2003; 167(9): 1225 - 1231. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. C. McCanlies, K. Kreiss, M. Andrew, and A. Weston HLA-DPB1 and Chronic Beryllium Disease: A HuGE Review Am. J. Epidemiol., March 1, 2003; 157(5): 388 - 398. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Amicosante, F. Berretta, A. Franchi, P. Rogliani, C. Dotti, M. Losi, R. Dweik, and C. Saltini HLA-DP-unrestricted TNF-{alpha} release in beryllium-stimulated peripheral blood mononuclear cells Eur. Respir. J., November 1, 2002; 20(5): 1174 - 1178. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Malcolm Taylor, S. Dearden, P. Ravetto, M. Ayres, P. Watson, A. Hussain, M. Greaves, F. Alexander, O. B. Eden, and UKCCS Investigators Genetic susceptibility to childhood common acute lymphoblastic leukaemia is associated with polymorphic peptide-binding pocket profiles in HLA-DPB1*0201 Hum. Mol. Genet., July 1, 2002; 11(14): 1585 - 1597. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. P. Fontenot, L. A. Maier, S. J. Canavera, T. B. Hendry-Hofer, M. Boguniewicz, E. A. Barker, L. S. Newman, and B. L. Kotzin Beryllium Skin Patch Testing to Analyze T Cell Stimulation and Granulomatous Inflammation in the Lung J. Immunol., April 1, 2002; 168(7): 3627 - 3634. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. D. ROSSMAN, J. STUBBS, C. W. LEE, E. ARGYRIS, E. MAGIRA, and D. MONOS Human Leukocyte Antigen Class II Amino Acid Epitopes . Susceptibility and Progression Markers for Beryllium Hypersensitivity Am. J. Respir. Crit. Care Med., March 15, 2002; 165(6): 788 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. du Bois The Genetic Predisposition to Interstitial Lung Disease : Functional Relevance Chest, March 1, 2002; 121(2007): 14S - 20S. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Saltini, L. Richeldi, M. Losi, M. Amicosante, C. Voorter, E. van den Berg-Loonen, R.A. Dweik, H.P. Wiedemann, D.C. Deubner, and C. Tinelli Major histocompatibility locus genetic markers of beryllium sensitization and disease Eur. Respir. J., October 1, 2001; 18(4): 677 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. A. MAIER, R. T. SAWYER, R. A. BAUER, L. A. KITTLE, P. LYMPANY, D. MCGRATH, R. DUBOIS, E. DANILOFF, C. S. ROSE, and L. S. NEWMAN High Beryllium-stimulated TNF-alpha Is Associated with the -308 TNF-alpha Promoter Polymorphism and with Clinical Severity in Chronic Beryllium Disease Am. J. Respir. Crit. Care Med., October 1, 2001; 164(7): 1192 - 1199. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Nemery, A. Bast, J. Behr, P.J.A. Borm, S.J. Bourke, Ph. Camus, P. De Vuyst, H.M. Jansen, V.L. Kinnula, D. Lison, et al. Interstitial lung disease induced by exogenous agents: factors governing susceptibility Eur. Respir. J., July 1, 2001; 18(32_suppl): 30S - 42s. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Lombardi, C. Germain, J. Uren, M. T. Fiorillo, R. M. du Bois, W. Jones-Williams, C. Saltini, R. Sorrentino, and R. Lechler HLA-DP Allele-Specific T Cell Responses to Beryllium Account for DP-Associated Susceptibility to Chronic Beryllium Disease J. Immunol., March 1, 2001; 166(5): 3549 - 3555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Tarlo, K. Rhee, E. Powell, E. Amer, L. Newman, G. Liss, and N. Jones Marked Tachypnea in Siblings With Chronic Beryllium Disease due to Copper-Beryllium Alloy Chest, February 1, 2001; 119(2): 647 - 650. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. P. Fontenot, M. Torres, W. H. Marshall, L. S. Newman, and B. L. Kotzin Beryllium presentation to CD4+ T cells underlies disease-susceptibility HLA-DP alleles in chronic beryllium disease PNAS, October 23, 2000; (2000) 220430797. [Abstract] [Full Text]
|
|
|
|
|
|
A. P. Fontenot, M. Torres, W. H. Marshall, L. S. Newman, and B. L. Kotzin Beryllium presentation to CD4+ T cells underlies disease-susceptibility HLA-DP alleles in chronic beryllium disease PNAS, November 7, 2000; 97(23): 12717 - 12722. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
