| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Department of Immunology, St. Jude Children’s Research Hospital, Memphis, TN 38105;
Department of Molecular and Cell Biology, University of California, Berkeley, CA 94720; and
Department of Pathology, University of Tennessee, Memphis, TN 38163
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4 TCR expression.
Moreover, this expansion of V4+CD8+ T cells
does not depend on the MHC haplotype of the infected animal. Using a
panel of lacZ-inducible T cell hybridomas, we have
detected V4-specific T cell stimulatory activity in the spleens of
MHV-68-infected mice. We show that the appearance and quantity of this
activity correlate with the establishment and magnitude of latent viral
infection. Furthermore, on the basis of Ab blocking studies as well as
experiments with MHC class II, 2-microglobulin
(2m) and TAP1 knockout mice, the V4-specific T cell
stimulatory activity does not appear to depend on conventional
presentation by classical MHC class I or class II molecules. Taken
together, the data indicate that during latent infection, MHV-68 may
express a T cell ligand that differs fundamentally from both
conventional peptide Ags and classical viral
superantigens. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
HV-68)5 is a
natural pathogen of small rodents and provides an important
experimental model for studying the immune response to a
gammaherpesvirus in its natural host. Intranasal (i.n.) inoculation
results initially in a lytic infection in the lung that is quickly
cleared by cytolytic CD8+ T cells (1, 2). However, MHV-68 is able to establish lifelong latency in B
cells (3, 4, 5), although it has been reported that other
cell types can also be latently infected under some circumstances
(6, 7, 8). Latent virus is first detected in the spleen
around 6 days after infection, peaks on day 13 at a frequency of about
1/104 spleen cells, and then stabilizes and is
maintained at a level of about 1/106 spleen cells
(3, 9, 10).
Well after the clearance of lytic virus from the lung, an infectious
mononucleosis-like syndrome appears. This is characterized by
splenomegaly, which depends on both CD4+ T cells
and B cells (5, 10, 11) and a lymphocytosis comprised
largely of activated CD8+ T cells
(12). The activated CD8+ T cells in
the peripheral blood and spleen are predominantly those expressing
V4+ TCR, and this TCR phenotype is observed in
mice with multiple MHC haplotypes (12). Recent analysis of
CD8+ T cell specificity for major epitopes
expressed during the lytic phase of the infection has shown that the
expansion of V4+CD8+ T
cells does not appear to result from an outgrowth of cells that
responded to dominant epitopes during the acute phase of infection
(13). Although the striking V bias and the lack of
apparent MHC restriction are consistent with stimulation by a viral
superantigen, only CD8+ T cells are stimulated,
suggesting a role for MHC class I. In the present report we have
investigated the MHC presentation requirements for the V4-specific
stimulatory activity.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
C57BL/6J (B6), B6,129-TAP1tm1Arp
(TAP1-/-) (14), C57BL/6J-B2
mtm1Unc
(2m-/-)
(15), BALB/cByJ (BALB/c), and C3H/HeJ (C3H) mice were
purchased from The Jackson Laboratory (Bar Harbor, ME). B
cell-deficient µMT mice (16) and H-2
IAb-deficient C2D mice (17)
(licensed from GenPharm International, Mountain View, CA) were bred at
St. Jude Children’s Research Hospital. Mice were housed under specific
pathogen-free conditions, until MHV-68 infection, and in BL3
containment after infection. Female mice, between 8 and 16 wk of age,
were used in most experiments.
Virus stocks
The original stock of MHV-68 (clone G2.4), obtained from Prof. A. A. Nash (Edinburgh, U.K.), was grown in owl monkey kidney cells (OMK, 1566CRL, American Type Culture Collection (ATCC), Manassas, VA) and titrated by plaque assay on NIH-3T3 cells (ATCC CRL1568), essentially as previously described (10).
Infection and sampling
Mice were anesthetized with 2,2,2-tribromoethanol (avertin) and infected i.n. with 400–600 PFU of virus in a total volume of 30–40 µl. At various times after infection, blood was obtained from the retro-orbital sinus or axilla, and spleen cells were taken for flow cytometry or latent virus titers and/or to test their ability to stimulate hybridomas.
Infectious center assay
The frequency of latently infected cells was estimated by an infectious center assay, based on spontaneous reactivation upon culture with a susceptible cell line, as previously described (10). Briefly, single-cell suspensions were incubated on monolayers of NIH-3T3 cells, and then overlaid with carboxymethyl-cellulose/2x medium. Following 5–6 days of culture, the carboxymethyl-cellulose overlay was removed, and plaques were quantitated after methanol fixation and Giemsa staining. Samples were simultaneously assayed for infectious virus after freeze/thawing to confirm the absence of infectious virus in the samples.
Hybridomas
Peripheral blood and spleen cells were obtained from mice 39
days after MHV-68 infection and cultured for 1–3 days in IL-2 before
fusion. The cells were fused with the
TCR
--,
CD8-expressing, lacZ-inducible BW5147 fusion partner,
BWZ.36/CD8 (18, 19). Eleven
V4+CD8+ hybridomas were
obtained that expressed -galactosidase following stimulation with
immobilized anti-TCR mAb (H57-597) (20). MHC class
I-restricted, lacZ-inducible T cell hybridomas with known
peptide specificity were generated from a fusion of day 9
bronchoavelolar lavage and mediastinal lymph nodes from MHV-68-infected
mice with BWZ.36/CD8, and have been described previously
(21). They include hybrid 4951.5 (MHV-68
gB604–612/Kb-specific) and hybrid 49100.2 (MHV-68 ORF
6487–495/Db-specific). A Sendai virus MHC class
II-restricted, lacZ-inducible hybridoma, 5204H5 (Sendai
virus
HN421–436/I-Ab-specific),
has been described in detail previously (22).
Sequencing of V4 cDNAs
RNA was extracted from hybridoma cells using a kit from Qiagen
(Valencia, CA). One hundred nanograms of RNA was reverse transcribed by
random hexamer priming, and the resulting cDNA was amplified by PCR
(Perkin-Elmer, Norwalk, CT), using oligonucleotides complementary to
V4 (GCAGGTCCAGTCGACCCGCCGAAAT) and C (CTTGGGTGGAGTCACATTTCT).
The PCR products were cloned using the TOPO TA cloning kit (Invitrogen,
Carlsbad, CA). Three insert-containing colonies were picked for each
hybrid and grown for plasmid DNA extraction (Qiagen). The inserts were
sequenced using the M13–21 and reverse primers and TaqFS dye
terminator chemistry. The sequences were analyzed using the Wisconsin
Package GCG software (Genetics Computer Group, Madison, WI). CDR3
length was determined as previously described (23).
J elements were identified using the published genomic sequences
(24, 25).
Single cell T cell activation assay
The lacZ-inducible T cell hybridomas (1 x
105/well) were plated in 96-well flat-bottom
microtiter plates in complete tissue culture medium (26)
with up to 2.5 x 106 spleen cells/well as a
source of APCs. In most experiments APCs were titrated by making a
series of 2-fold dilutions in the wells before adding the hybridoma
cells. Unless otherwise indicated, spleen cell preparations were first
depleted of T cells by incubation with the IgM anti-Thy1 mAb AT83
(27) and a mixture of rabbit and guinea pig complement
(Cedarlane Laboratories, Madison, WI). For stimulation of
peptide-specific hybridomas, syngeneic spleen cells were pulsed with a
previously determined optimal concentration of the relevant peptide
(see below). After 12–24 h of culture at 37°C, the medium was
removed, and the cells were washed once with PBS and fixed with cold
2% formaldehyde/0.2% glutaraldehyde for 5 min. The fixative was
removed, and the cells were washed once more with PBS.
-Galactosidase activity was detected in individual T cells by adding
50 µl of PBS containing 5 mM potassium ferrocyanide, 5 mM potassium
ferricyanide, 2 mM MgCl2, and 1 mg/ml of the
chromogenic substrate 5-bromo-4-chloro-3-indolyl
-D-galactopyranoside (X-Gal) to each well and
incubating the plates at 37° for 6–12 h (18). Blue
cells were counted using an inverted tissue culture microscope.
Some experiments using
2m-/- stimulator cells
were conducted in chemically defined, protein-free medium
(MaxiCell/Hybridoma-PF, Atlanta Biologicals, Norcross, GA) to reduce
the possibility of transfer of 2m from the
medium. Preliminary experiments established that the hybridoma
viability was poor (ranging between 10 and 50% viable cells) after
overnight incubation in chemically defined medium, so it was not
possible to preculture the hybridoma cells in the absence of serum.
Instead, hybridoma cells were washed three times in the absence of
serum before setting up the assay in MaxiCell medium.
Reproducibility of the hybridoma assay was assured by analysis of replicate wells, analysis of individual infected mice as the source of stimulator cells within the same experiment, analysis of reactivity of more than one hybridoma in the same experiment, and/or analysis of separate, repeat experiments. A response >3 SD over the mean background of multiple (>10) experiments was considered positive. This value varied for each individual hybridoma, and was 5, 27, 59, 15, and 21 for hybridomas 4BH-62, 4BH-91, 4BH-98, 4BH-102, and 5BH-11, respectively.
Ab blocking
T cell-depleted spleen cells from naive or 14 days postinfection
B6 mice were plated at 2 x 105 APCs/well
and incubated in 150 µl of complete tissue culture medium
(26) with anti-Kb,
-Db, or -IAb Abs or their
respective isotype/ascites controls for 1 h at 37°C. Hybridoma
cells (105) were then added to each well in a
volume of 100 µl, and the plates were incubated overnight. The
hybridoma response was measured using the single-cell lacZ
assay described above. The Abs used were Y3(anti-Kb, ascites)
(28), AF6-88.5 (anti-Kb,
purified protein, PharMingen, San Diego, CA) (29), MKQ8
(anti-Db, ascites, provided by Dr. T. Potter,
National Jewish Center, Denver, CO), 34-5-3
(anti-Ad,b, purified protein, PharMingen)
(30), F23.1 (anti-V8, ascites) (31),
and mouse IgG2a,
(purified protein, PharMingen). MHV-68 and Sendai
virus peptide-specific hybridomas (see above) were used as positive
controls for blocking by the Abs; 4 x 105
APCs/well were incubated in 100 µl of complete tissue culture medium
with a quantity of each peptide previously determined to give a
measurable response (MHV-68 gB604–612, 0.32 µg/ml; MHV-68
ORF 6487–495, 0.06 µg/ml; Sendai virus
HN421–436, 0.12 µg/ml) for 1 h at 37°C.
The appropriate Abs were then added, and the rest of the assay was
performed as described above. Each Ab was also tested for nonspecific
inhibition of every hybrid used. No such spurious blocking was observed
(data not shown).
Flow cytometry
Hybridomas were analyzed for V4 and CD8 expression by
single-color flow cytometry, and peripheral blood cells from infected
mice (4–16 wk after infection) were analyzed for the percentage of
V4+ cells among CD8+ T
cells, using two-color flow cytometry. The Abs specific for TCR V4
(KT-4) (32) and CD8 (53–6.72)
(33) were purchased from PharMingen. Live cells were
gated and analyzed on a FACScan flow cytometer (Becton Dickinson,
Mountain View, CA), and the data were analyzed using CellQuest software
(Becton Dickinson Immunocytometry Systems, San Jose, CA).
Directly conjugated Abs for cell sorting were purchased from
PharMingen. Spleen cells were first incubated with
anti-CD16/CD32 (FcBlock, PharMingen) and normal mouse serum
(Pel-Freeze), and then stained with FITC-conjugated anti-CD45R/B220
(RA3–6B2) and PE-conjugated anti-CD11b (Mac-1, M1/70). FITC- or
PE-positive cells were sorted on a FACStarPlus
equipped with a high speed sorting module. As a control for loss of T
cell stimulatory activity that might result from the physical stress of
the sorting, cells were mock sorted using a large gate on forward and
side scatter. In separate experiments, staining with these Abs without
sorting was shown to have no effect on T cell stimulation (data not
shown).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4+CD8+ T cell hybridomas derived from
latently MHV-68-infected mice
The late kinetics of
V4+CD8+ T cell
expansion, and the report that the cells were not the outgrowth of
cells responding in the acute infection (13) led to the
hypothesis that V4+CD8+
T cells are stimulated by an Ag expressed during latent infection.
Because there is no viable in vitro model for latent MHV-68 infection,
latently infected mice were used to test this hypothesis. We reasoned
that the stimulatory ligand might be found only in the small fraction
of spleen cells that is latently infected, thus necessitating a very
sensitive assay system for the detection of rare APC. Therefore, we
used the BWZ.36 CD8 fusion partner, into which an inducible
NF-AT-responsive lacZ construct has been transfected, to
generate a panel of
V4+CD8+ hybridomas from
the spleen cells of mice 36 days after infection. The resulting
Ag-specific hybridomas are substantially more sensitive than
conventional hybrids due to the ability to detect activation of
individual T cells, presumably by individual APCs (18).
Altogether 11 V4+CD8+
hybridomas that responded to TCR ligation were generated, and five were
chosen for further study, based on their stability and growth
characteristics.
Initial analysis of the reactivity of the hybridomas showed that they
responded specifically to MHV-68-infected spleen cells 14 days after
infection (Table I
), a time point when
spleen cells harbor latent virus, but not to spleen cells or cell lines
that had been acutely infected with MHV-68 in vitro (data not shown).
It should be noted that the low frequency of responding hybridomas
(usually <1%) is consistent with stimulation by rare APC. In
addition, each hybridoma expressed a different TCR V4 -chain CDR3
region (Table II), consistent with a
polyclonal response.
|
|
). In addition,
the use of FACS-sorted populations of B220+ cells
or Mac-1+ cells as APC established that the V4
stimulatory activity was in the B220+ population,
but not in the Mac-1+ population (Fig. 1). However, B cell depletion had little
effect on the stimulatory activity, suggesting that presenting cells
other than B cells may also contribute to the T cell activation (Table I). This is consistent with the reports that although B cells may be
the predominant site of MHV-68 latency (3, 4, 5), they are
not the only cells harboring latent virus (6, 7, 8). In
addition, the <2-fold enrichment of B cells accomplished by T cell
depletion could not account for the dramatic increase in stimulatory
capability, implicating additional, as yet unknown, interactions.
|
4 stimulatory activity was also
examined. As predicted from our earlier data (12) showing
that V4 expansion occurs in mouse strains expressing multiple MHC
haplotypes, the stimulatory ability of the spleen cells was not MHC
restricted, in that spleen cells from infected BALB/c
(H-2d) and CBA (H-2k) mice
stimulated the panel of hybridomas that had been made from B6
(H-2b) mice (Table III). Interestingly, the weaker hybridoma
stimulation by C3H spleen cells reflects the reduced levels of V4
expansion characteristic of H-2k mice (C. L.
Hardy and M. A. Blackman, manuscript in preparation).
|
). Thus, the kinetics
of the V4+CD8+
stimulatory activity in the spleen correlates with the peak of viral
latency in the spleen, as measured by the infectious center assay
(10, 34), and directly precedes the expansion of
V4+CD8+ T cells in vivo
(10).
|
4+ T cell hybridomas,
and this correlates with reduced viral load
Previous studies had shown that there was no expansion of
V4+CD8+ T cells in mice
that are functionally deficient for the H-2 IAb
gene (12), and that the peak of latent virus in the
spleens of these mice was at least 10-fold lower than that in control
B6 animals (10). Thus, it was of interest to test the
ability of spleen cells from these MHC class II-deficient mice to
stimulate the V4+CD8+
hybridomas. The data in Fig. 2 show the
reactivity of a representative hybridoma to a titration of APC from
spleen cells 14 days after infection of B6 and MHC class II-deficient
mice. The results show that while T cell-depleted spleen cells from MHC
class II-deficient mice 14 days after infection did stimulate the
hybridoma, they were 
10-fold less effective than B6 spleen
cells.
|
). The data (Fig. 3, C and D) confirm the 10-fold difference in
the peak levels (day 13) of latency in B6 and class II-deficient mice
described previously (10). Significantly, the data show a
general correlation between the magnitude of latency and the hybridoma
stimulatory ability of the spleen cells from MHC class II-deficient
mice between 11–21 days after infection (Fig. 3, B and
D).
|
4 hybridomas could be stimulated in
the absence of MHC class II, and that the reduction in stimulation was
not a consequence of the absence of class II, but, rather, of the lower
numbers of stimulatory cells in the MHC class II-deficient mice. To
confirm the independence of hybridoma stimulation from MHC class II
expression, Ab blocking studies were conducted. As shown in Fig. 4, an
anti-I-Ab,d Ab (34-5-3) failed to block the
stimulation of two V4 hybridomas by day 14 spleen cells (Fig. 4, B and C). However, the same Ab blocked a control
hybridoma that recognizes a Sendai virus peptide,
HN421–436, in association with
I-Ab (Fig. 4A). Taken together, these
data suggest that the reduced stimulation of the V4 hybridomas by
infected spleen cells from MHC class II-deficient mice is a consequence
of reduced Ag, rather than a dependence on MHC class II for
presentation. This argues against
V4+CD8+ T cell expansion
being driven by a viral superantigen presented by MHC class
II.
|
4 T cell stimulatory activity is apparently not dependent on
expression of classical MHC class I molecules
Ag-specific stimulation of CD8+ T cells is
dependent upon peptide presentation by MHC class I molecules. In
addition, although superantigens are normally presented by MHC class II
molecules (35, 36, 37), there is recent evidence to suggest
that, under some circumstances, at least some superantigens can be
presented by MHC class I molecules (38, 39). Therefore, we
looked for a requirement for MHC class I molecules in the stimulation
of the V4+CD8+ T cell
hybridomas by MHV-68-infected spleen cells. Classical MHC class I
molecules are dependent on TAP1 for peptide loading and cell surface
expression (14, 40, 41, 42). In addition,
2m is generally required for MHC class I
expression, although there is partial expression of some molecules,
such as murine CD1 and H-2Db, in the absence of
2m (43, 44, 45, 46). Therefore, the
ability of MHV-68-infected TAP1-/- and
2m-/- mice to
stimulate the panel of hybridomas was examined. The representative
experiment presented in Table V shows
comparable stimulation by T-depleted spleen cells from day 14
postinfection control B6 and
2m-/- mice and clearly
reduced, but unambiguous, stimulation by spleen cells from
TAP1-/- mice.
|
2m could be
provided exogenously from the serum in the tissue culture medium, the
2m-/- experiment was
repeated in serum-free medium (Fig. 5).
Not unexpectedly, there was a significant drop in the hybridoma
reactivity to both the MHV-68-infected B6 and
2m-/- spleen cells
(Fig. 5A), probably due to the loss in cell viability in the
absence of serum during the 18-h assay (data not shown). It should be
noted that in contrast to data shown in Table V, the response of the
hybridomas to MHV-68-infected
2m-/- spleen cells in
these experiments was significantly reduced compared with
MHV-68-infected B6 spleen cells. The reason for this discrepancy is
unclear. The key point, however, is that the loss of activity in
response to the infected
2m-/- spleen cells was
proportional to the loss for the infected B6 spleen cells (Fig. 5B), and there was still clear hybridoma stimulation in
response to infected
2m-/- spleen
cells.
|
2m-/-
and TAP1-/- mice have severely reduced numbers
of CD8+ T cells, it has been shown that there is
a diverse TCR repertoire, in terms of V representation (47, 48). Analysis of
V4+CD8+ T cell levels in
the blood of MHV-68-infected mice show elevated levels, compared with
uninfected controls, in six of six TAP1-/- mice
and five of eight
2m-/- mice (Fig. 6). The absence of V4 expansion in
some 2m-/- mice may
reflect a reduced TCR repertoire, but the fact that at least some
individuals responded confirms the ability of the ligand to be
expressed in vivo in the absence of 2m. These
in vivo experiments argue against the possibility that the hybridoma
stimulation is a consequence of an in vitro artifact, such as exogenous
acquisition of 2m.
|
2m-/- and
TAP1-/- mice to stimulate the hybridomas
suggested that the stimulatory ligand was not presented by a classical
MHC class I molecule. However, because of the possibility of leaky MHC
class I expression in these MHV-68-infected knockout animals, we tested
the class I MHC independence of the V4 T cell stimulatory activity
in Ab blocking experiments. Thus, the ability of mAbs specific for
H-2Db (MKD8) and H-2Kb (Y3)
to block the stimulation of conventionally restricted hybridomas and
two representative
V4+CD8+ T cell
hybridomas was tested. The data show complete and titratable blocking
of the conventional peptide-reactive, class I-restricted hybridomas
(Fig. 7, A and D), but only
partial blocking of the
V4+CD8+ hybridomas at
higher Ab concentrations (Fig. 7, B, C, E, and
F). Similar results were obtained with another
Kb-specific Ab (AF6-88.5; data not shown).
Control experiments demonstrated the specificity of the Ab blocking
(data not shown). The partial blocking of the response of the
V4+ hybridomas by the individual MHC class
I-specific Abs was not additive, nor was the partial blocking additive
upon addition of the MHC class II Ab used in Fig. 4 (data not shown).
Although these blocking data are consistent with the interpretation
that the MHC class I molecules are not required for presentation,
negative data do not allow us to rule out the possibility that the
specificities of the blocking Abs used are inappropriate. Taken
together with the analysis of the
2m-/- and
TAP1-/- mice, however, these data suggest that
the ligand for the
V4+CD8+ T cells is not
being presented in a conventional manner by the classical MHC class I
molecules H-2Kb and H-2Db
or nonclassical MHC class I molecules that are dependent on
2m or TAP1 for their expression and
function.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
4+CD8+ T cells in the
peripheral blood and spleen during the infectious mononucleosis phase
of MHV-68 infection, after the clearance of lytic virus from the lung
and the establishment of latency in the spleen. An intriguing aspect of
the V4 expansion is that it occurs in mouse strains expressing
different MHC haplotypes, although to varying extents
(12). Possible explanations for the MHC-unrestricted
presentation include 1) a viral superantigen binding to nonpolymorphic
regions of MHC class II molecules, 2) presentation by a nonclassical
MHC molecule with limited polymorphism, 3) expression of a ligand that
could directly stimulate
V4+CD8+ T cells in the
absence of any presenting molecule, 4) presentation of a promiscuous
peptide that could bind to MHC class I molecules representing several
MHC haplotypes, or 5) virally induced expression of a self peptide
presented by self MHC. Although the latter two possibilities are
consistent with presentation in a non-MHC-restricted manner, they would
not necessarily explain the strong V4 bias of the reactive T cells
in all mouse strains.
In the current studies we set out to identify the role of classical MHC
class I and class II molecules in the expansion of
V4+CD8+ T cells. The
data suggest that stimulation of
V4+CD8+ hybridomas
generated from infected animals during the mononucleosis stage of
infection does not require classical MHC class I or class II molecules.
In addition, the data showing
V4+CD8+ T cell expansion
and stimulation of V4 hybridomas by spleen cells from
MHV-68-infected 2m-deficient mice suggest that
presentation is not mediated by a nonclassical MHC molecule that is
dependent on 2m for expression. Finally, the
V4+CD8+ T cell expansion
in MHV-68-infected TAP1-deficient mice and the ability of APC from
these animals to stimulate the hybridomas suggest that presentation of
a TAP1-dependent peptide is not required. Thus, these data support the
conclusion that the stimulatory ligand either does not require
presentation by MHC class I molecules or is presented by a
nonpolymorphic, nonclassical MHC molecule that is not dependent upon
TAP1 or 2m for its expression or function.
Groh et al. (49, 50) have recently described
stress-inducible, nonclassical, TAP1- and
2m-independent class I MHC proteins that
stimulate human V
1+ T cells. Although
no murine or viral homologues of these proteins are known, the
expression of a similar ligand with V4 specificity during MHV-68
infection would explain all of our observations.
The absence of a requirement for MHC class II argues strongly against
stimulation by a conventional viral superantigen (51, 52, 53, 54).
However, several recent reports have suggested that MHC class I
molecules can present superantigens (38, 39), and there
are other reports suggesting alternative binding sites or direct T cell
activation in the absence of any presenting molecule
(55, 56, 57, 58, 59). The Ab blocking data argue against the
possibility that a viral superantigen is being presented by MHC class I
or class II molecules. However, it is possible that the presentation is
different and is unaffected by Abs that inhibit normal peptide
presentation. It is difficult to rule out this possibility in the
absence of information about the structure of the ligand. In addition,
our experiments do not rule out the possibility that MHV-68 expresses a
viral superantigen or induces the expression of an endogenous
superantigen that is capable of directly activating
V4+CD8+ T cells.
The absence of a role for MHC class II molecules is in seeming
contradiction to our previous report, in which we had shown that there
was no V4+CD8+ T cell
expansion in MHC class II-/- mice
(12). This could have been due to the absence of MHC class
II and/or the absence of CD4+ T cells. Our
previous CD4 depletion studies from day 11 of infection showed that
CD4+ T cells were not required, at least at the
later stages of the infection, and supported the conclusion that the
expansion was dependent on MHC class II expression. However, more
recent data show that CD4 depletion from the time of infection prevents
expansion of V4+CD8+ T
cells (data not shown), suggesting an important role for
CD4+ T cells in the V4 expansion early in the
infection. The data presented in the present report strongly argue
against a requirement for MHC class II. Further studies are in progress
to define the role of CD4+ T cells in the
expansion of V4+CD8+ T
cells.
A second major conclusion from these studies is that there is a general
correlation between V4 stimulatory capacity and the peak of latency,
as assessed by the infectious centers assay. Although it is likely that
only a subset of latently infected cells can be reactivated in vitro,
the hybridoma stimulatory activity appears to correlate with latently
infected cells that are measured by this assay. However, because the
elevated levels of
V4+CD8+ T cells in vivo
are sustained for several months after infection, a key question is why
we only detect V4 hybridoma stimulatory activity at the peak of
latency. It is possible that the threshold number of cells required for
hybridoma stimulation exceeds that required for in vivo expansion, or
that stimulation in vivo at later time points is occurring at a site
other than the spleen, such as the lymph nodes or the bone marrow.
Alternatively, it is possible that
V4+CD8+ T cells in vivo
are long-lived, and that there is a switch in the pattern of latent
gene expression, analogous to that described for EBV, resulting in the
absence of the stimulatory gene product at later time points. Analysis
of the viral genomic sequence shows that MHV-68 does not express
homologues of the EBV latency genes (60). Therefore,
characterization of the genes expressed in MHV-68 latency, which is
underway in several laboratories (61, 62, 63, 64), will facilitate
distinguishing these possibilities.
A summary of the key events in the viral pathogenesis of MHV-68
infection is presented in Fig. 8. A likely scenario is that expansion
of V4+CD8+ T cells is
independent of Ags expressed during the acute stages of infection. With
the establishment of latency and concurrent splenomegaly, there are new
viral genes expressed that drive the in vivo V4 expansion. The week
lag between maximal stimulatory activity in the spleen and
V4+ T cell expansion in vivo may reflect a low
precursor frequency of reactive V4+ T cells.
However, after the peak of latency, either the pattern of latency gene
expression changes or the numbers of latently infected cells in the
spleen drops below the threshold necessary for in vitro activation of
V4+CD8+ hybridomas.
Despite this, the
V4+CD8+ T cells in the
blood persist, either due to a long life-span of the T cells or to a
low level of Ag expression in the spleen that is sufficient to sustain
V4 activation in vivo, but is not sufficient to stimulate hybridomas
in vitro, or to a reservoir of latently infected cells elsewhere in the
mouse.
|
4 component of the CD8+ T cell expansion in
MHV-68 mononucleosis, in that
V4+CD8+ T cells did not
react with recently identified lytic (13, 21) or latent
(64) (E. Usherwood and D. L. Woodland, unpublished observations)
epitopes. In addition, the data reported in this paper showing that
stimulation of the
V4+CD8+ T cell
hybridomas is not dependent on classical MHC class I or II molecules
further argue against this possibility. However, there is a non-V4
component of the mononucleosis (12), and it remains
possible that these cells represent outgrowth of cells responding to
the acute lytic infection.
Finally, our data show that the stimulatory activity in the spleen is
found in B cells, a major reservoir of MHV-68 latency
(3, 4, 5). However, the stimulatory activity is not exclusive
to B cells, consistent with reports that other cell types can also
serve as reservoirs for latent virus. For example, latent virus has
been detected in epithelial cells in the lung (6). Also,
i.p., but not i.n., infected µMT mice that lack mature B cells have
been shown to harbor latent virus, predominantly in macrophages
(7, 8). Experiments are in progress to test whether these
or other latently infected cell types can stimulate the V4
hybridomas. It is intriguing that T cell depletion results in higher
levels of stimulation than can be accounted for by simple enrichment,
raising the interesting possibility that T cells are exerting some sort
of negative regulatory control. This possibility is currently under
investigation.
In conclusion, stimulation of
V4+CD8+ T cells during
the mononucleosis stage of MHV-68 infection is driven by a ligand that
is expressed in spleen cells at the peak of viral latency and is
unusual in that it appears to be independent of conventional MHC class
I or class II molecules for presentation. The identity of this ligand
is currently under investigation.
Note added in proof.
MHV-68 infection of mice that lack expression of the nonclassical MHC
class I molecule CD1 (c,129S-Cd1tm1Gru) induced a 3-fold
increase in V4+CD8+ T cells, indicating that
the stimulatory ligand does not require presentation by CD1.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Argonex Pharmaceuticals, 706 Forest Street, Suite 1, Charlottesville, VA 22903.
3 Current address: Parke-Davis Pharmaceutical Research, 2800 Plymouth Road, Ann Arbor, MI 48105.
4 Address correspondence and reprint requests to Dr. Marcia A. Blackman, Department of Immunology, St. Jude Children’s Research Hospital, 332 North Lauderdale, Memphis, TN 38105. E-mail address:
5 Abbreviations used in this paper: MHV-68, murine gammaherpesvirus-68; i.n., intranasal; 2m, 2-microglobulin.
Received for publication December 29, 1998. Accepted for publication May 24, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-herpesvirus infection. Eur. J. Immunol. 29:1059.[Medline]
2m, MHC class I proteins, and CD8+ T cells. Science 248:1227. T cell receptors. J. Immunol. 142:2736.[Abstract]
polypeptide. Cell 37:1101.[Medline]
-chain constant- and joining-region genes. Nature 310:387.[Medline]
4+ CD8+ T-cell population and the H-2d haplotype. Immunogenetics 31:333.[Medline]
1 domain of the human histocompatibility antigen HLA-DR. Proc. Natl. Acad. Sci. USA 88:9954. chain residues critical for binding staphylococcal enterotoxins A and E. J. Exp. Med. 175:415.2 microglobulin negative cells. J. Exp. Med. 176:829.2 microglobulin. J. Exp. Med. 160:317.2-microglobulin in the intracellular transport and surface expression of murine class I histocompatibility molecules. J. Immunol. 142:2796.[Abstract]
2-Microglobulin is not required for cell surface expression of the murine class I histocompatibility antigen H-2Db or of a truncated H-2Db. Proc. Natl. Acad. Sci. USA 83:7447.2-microglobulin mutant mice. Eur. J. Immunol. 25:174.[Medline]
T cells. Science 279:1737. elements in the absence of MHC class II molecules. Cell. Immunol. 152:348.[Medline]
This article has been cited by other articles:
|
|
 |
|
  A. G. Evans, J. M. Moser, L. T. Krug, V. Pozharskaya, A. L. Mora, and S. H. Speck A gammaherpesvirus-secreted activator of V{beta}4+ CD8+ T cells regulates chronic infection and immunopathology J. Exp. Med., March 17, 2008; 205(3): 669 - 684. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. L. Tarakanova, F. Suarez, S. A. Tibbetts, M. A. Jacoby, K. E. Weck, J. L. Hess, S. H. Speck, and H. W. Virgin IV Murine Gammaherpesvirus 68 Infection Is Associated with Lymphoproliferative Disease and Lymphoma in BALB {beta}2 Microglobulin-Deficient Mice J. Virol., December 1, 2005; 79(23): 14668 - 14679. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. C. Braaten, R. L. Sparks-Thissen, S. Kreher, S. H. Speck, and H. W. Virgin IV An Optimized CD8+ T-Cell Response Controls Productive and Latent Gammaherpesvirus Infection J. Virol., February 15, 2005; 79(4): 2573 - 2583. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Obar, S. G. Crist, E. K. Leung, and E. J. Usherwood IL-15-Independent Proliferative Renewal of Memory CD8+ T Cells in Latent Gammaherpesvirus Infection J. Immunol., August 15, 2004; 173(4): 2705 - 2714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Flano, C. L. Hardy, I.-J. Kim, C. Frankling, M. A. Coppola, P. Nguyen, D. L. Woodland, and M. A. Blackman T Cell Reactivity during Infectious Mononucleosis and Persistent Gammaherpesvirus Infection in Mice J. Immunol., March 1, 2004; 172(5): 3078 - 3085. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. I. Macrae, E. J. Usherwood, S. M. Husain, E. Flano, I.-J. Kim, D. L. Woodland, A. A. Nash, M. A. Blackman, J. T. Sample, and J. P. Stewart Murid Herpesvirus 4 Strain 68 M2 Protein Is a B-Cell-Associated Antigen Important for Latency but Not Lymphocytosis J. Virol., September 1, 2003; 77(17): 9700 - 9709. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Gangappa, S. B. Kapadia, S. H. Speck, and H. W. Virgin IV Antibody to a Lytic Cycle Viral Protein Decreases Gammaherpesvirus Latency in B-Cell-Deficient Mice J. Virol., October 17, 2002; 76(22): 11460 - 11468. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Flano, D. L. Woodland, M. A. Blackman, and P. C. Doherty Analysis of Virus-Specific CD4+ T Cells during Long-Term Gammaherpesvirus Infection J. Virol., August 15, 2001; 75(16): 7744 - 7748. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. T. Belz and P. C. Doherty Virus-Specific and Bystander CD8+ T-Cell Proliferation in the Acute and Persistent Phases of a Gammaherpesvirus Infection J. Virol., May 1, 2001; 75(9): 4435 - 4438. [Abstract] [Full Text]
|
|
|
|
|
|
E. J. Usherwood, D. J. Roy, K. Ward, S. L. Surman, B. M. Dutia, M. A. Blackman, J. P. Stewart, and D. L. Woodland Control of Gammaherpesvirus Latency by Latent Antigen-Specific Cd8+ T Cells J. Exp. Med., October 2, 2000; 192(7): 943 - 952. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. L. Hardy, S. L. Silins, David. L. Woodland, and M. A. Blackman Murine {gamma}-herpesvirus infection causes V{beta}4-specific CDR3-restricted clonal expansions within CD8+ peripheral blood T lymphocytes Int. Immunol., August 1, 2000; 12(8): 1193 - 1204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Flano, S. M. Husain, J. T. Sample, D. L. Woodland, and M. A. Blackman Latent Murine {gamma}-Herpesvirus Infection Is Established in Activated B Cells, Dendritic Cells, and Macrophages J. Immunol., July 15, 2000; 165(2): 1074 - 1081. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Liu, E. J. Usherwood, M. A. Blackman, and D. L. Woodland T-Cell Vaccination Alters the Course of Murine Herpesvirus 68 Infection and the Establishment of Viral Latency in Mice J. Virol., December 1, 1999; 73(12): 9849 - 9857. [Abstract] [Full Text]
|
|
|
|
|
|
E. Flano, D. L. Woodland, and M. A. Blackman Requirement for CD4+ T Cells in V{beta}4+CD8+ T Cell Activation Associated with Latent Murine Gammaherpesvirus Infection J. Immunol., September 15, 1999; 163(6): 3403 - 3408. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
, B220+ sort; 
, Mac1+ sort; dotted line,
background.
, MHV-68-infected MHC class II-deficient APCs. Similar results were
obtained with hybridoma 4BH-98 (data not shown). The data shown are
from a single experiment, representative of three.
