|
|
||||||||
Department of Immunohematology and Blood Bank, Leiden University Medical Center, Leiden, The Netherlands
| Abstract |
|---|
|
|
|---|
induced MHC class I transactivation through the ISRE of HLA-A, HLA-B,
HLA-C, and HLA-F. This is congruent with the binding of IFN regulatory
factor-1 to the ISREs of these loci upon IFN-
treatment. Sp1 was
shown to bind to the CG-rich sequences in the ISRE regions of HLA-B,
HLA-C, and HLA-G. The putative E box 5' of the ISRE in most HLA-B
alleles was shown to bind the upstream stimulatory factors (USF) 1 and
2. The Sp1 and USF binding sites did not influence IFN-
-induced
transactivation. However, the USF binding site played a suppressive
role in the constitutive expression of HLA-B. The locus-specific
transcriptional control through the ISRE could be an important
mechanism in the differential regulation of classical and nonclassical
MHC class I expression, which determines adequate Ag presentation upon
pathogenic challenge. | Introduction |
|---|
|
|
|---|
,
) and type II (
) IFNs are potent regulators of antiviral
activities and cell proliferation and differentiation. Therefore, they
play a central role in the immune response (1, 2). IFN-
exerts its biological effects through the signal transduction pathway,
which involves binding to its receptor, activation of Janus kinases
(Jak) 1 and 2, and phosphorylation of latent Stat1 (reviewed in Refs.
3, 4). A homodimer of activated Stat1 can bind to the
IFN-
activation site
(GAS),4 or, in
combination with p48 (also called ISGF3
), to the IFN-stimulated
response element (ISRE), thereby transactivating genes bearing either
of these sequences in their promoter (5, 6). p48 and other
transcription factors of the IFN regulatory factor (IRF) family, such
as IRF-1, IRF-2, and IFN consensus sequence binding protein (ICSBP),
are induced by this route. They form a group of secondary transcription
factors that regulate gene transcription in a positive (IRF-1) or
negative (IRF-2 and ICSBP) manner or act as helpers of protein/DNA
complex formation (p48). Their principal target sequence is the ISRE
present in IFN-
-inducible genes (5). This cascade of
events results in the transactivation of a number of genes important in
the immune system, including MHC class I heavy chain,
2-microglobulin, and other genes, the products
of which are important for peptide loading and assembly of the MHC
class I complex (reviewed in Ref. 2). Classical MHC class I molecules serve to present antigenic peptides to CTL and are therefore crucial in the immune response (7). Concordantly, they are ubiquitously expressed in most adult tissue types (8, 9). In contrast, the expression of nonclassical MHC class I molecules is more restricted (9). Their exact role in the immune response is not fully understood, but their expression in embryonic tissues suggests a function in development (10).
Locus-specific differences in the level of constitutive and IFN-induced
expression of MHC class I genes (11, 12, 13) is thought to be
of importance during development and also for the immune defense
against a diversity of pathogens. Structural differences in the
regulatory elements of proximal promoters of the MHC class I genes
(reviewed in Refs. 14, 15, 16) and their resulting
differential binding affinities for transcription factors may be the
prime regulatory mechanism of locus-specific expression of MHC class I
molecules. Three conserved regulatory elements in the promoter region
of MHC class I, i.e., the enhancer A, the ISRE, and site
, have been
indicated to play an important role in the constitutive and
cytokine-induced transactivation of MHC class I genes (reviewed in Ref.
16). Enhancer A contains binding sites for NF-
B/Rel
transcription factors and mediates the TNF-
-induced transactivation
of MHC class I (13, 17, 18). The ISRE is a binding site
for factors of the IRF family and mediates the induction of MHC class I
transcription by the IFNs, of which IFN-
is the most potent
(9, 13, 19). Site
is bound by proteins of the
activating transcription factor/cAMP response element binding protein
(ATF/CREB) family and plays an important role in the constitutive,
IFN-
-induced and class II transactivator-mediated MHC class I
transactivation (20, 21, 22).
Despite the fact that these regulatory sequences are generally
conserved among the MHC class I molecules, nucleotide variation exists,
particularly in the ISRE and enhancer A of classical and nonclassical
HLA class I molecules (reviewed in Ref. 16). Recently, it
has been demonstrated that the locus-specific nucleotide variation in
the enhancer A determined the binding affinity for transcription
factors of the NF-
B family and Sp1 and the contribution of this
regulatory element to transactivation (17). Similarly,
variation in the nucleotide sequence of the ISRE could determine its
capacity to bind transcription factors and its contribution to
transactivation. This has been investigated for some but not all loci,
and the role of the ISRE of HLA-A in transactivation has been
controversial (cf Refs. 13, 19, 23). Therefore, we
conducted a systematic study to establish the role of the ISRE in the
transactivation of the classical and nonclassical HLA class I
genes.
| Materials and Methods |
|---|
|
|
|---|
The teratocarcinoma cell line Tera-2, the cervical carcinoma cell line HeLa, and the EBV-transformed B cell line MSH were grown in IMDM medium supplemented with 10% (v/v) heat-inactivated FCS (Life Technologies, Paisley, Scotland), penicillin (100 IU/ml), and streptomycin (100 µg/ml).
Plasmids
The reporter constructs pGL3-B190, pGL3-B180, and pGL3-B170 were
generated by cloning a 187-bp, a 182-bp, or a 161-bp
HLA-B*0702 promoter fragment upstream of the firefly
luciferase gene in pGL3-Basic (Promega, Madison, WI). The
ISRE-containing reporter constructs were generated by cloning a
PCR-generated fragment containing the ISRE sequence of the various HLA
class I loci (in capitals, see below) and the downstream 163-bp
promoter sequence of HLA-B*0702 (in bold, see below) in
front of the firefly luciferase gene in pGL3-Basic. Note that
pGL3-ISRE-B/C is identical in sequence to pGL3-B180. The proximal HLA
class I promoter sequences in these reporter constructs are of crucial
importance, because the lack of site
or the immediate 3' flanking
sequence of the ISRE abrogates IFN-
-induced transactivation
(20, 24). The ISRE region of most HLA-B loci contains a
putative E box (underlined, see below), and this ISRE sequence is
therefore termed ISRE-BE to distinguish it from
the ISRE region of other HLA-B alleles and HLA-C (termed ISRE-B/C; see
also Table I
). In HLA-G, no obvious
ISRE-like sequence can be found. The sequence that has been chosen to
test here is positioned around the site at which the ISRE would be
expected and includes the putative
B1 site of enhancer A
(17). Primers used for PCR amplification of
hybrid promoter fragments containing the ISRE of the various HLA class
I loci and the flanking HLA-B*0702 promoter region were as follows:
gatagatctctccgcAGTTTCTTTTCTcctcccaacttgtgtcggg (ISRE-A);
gatagatctactcccacgAGTTTCACTTCTtctcccaacttgtgtcgg
(ISRE-BE);
gatagatctactcccctgAGTTTCACTTCTtctcccaacttgtgtcgg
(ISRE-B/C);
gatagatcttctgcAGTTTCCCGTTCcctcccaacttgtgtcggg
(ISRE-E);
gatagatcttctccccagAGTTTCTCTTTCtctcccaacttgtgtcgg
(ISRE-F); gatagatctATTCTCTCCTccttctcctcccaacttgtgtcggg (ISRE-G);
and as reverse primer, gataagcttcggcgtctgaggagact
(B7R). All plasmids were verified by DNA sequence
analysis (T7-polymerase sequence kit; Amersham, Buckinghamshire,
England).
|
Adherent cells were transfected by the calcium phosphate
coprecipitation method (25). In each of four wells of a
six-well plate, 0.2 x 106 Tera-2 cells were
transfected with a DNA precipitate of 2 µg pGL3 reporter plasmid and
0.2 µg Renilla luciferase control plasmid (pRL-SV40;
Promega). The following day, the medium was replaced by fresh medium
with or without IFN-
(500 U/ml). The cells were harvested 3 days
after transfection. Tera-2 cells were chosen for these transient
transfection experiments because of the high IFN-
-induced promoter
activities. Nonadherent cells (10 x 106)
were transfected by electroporation (250 V, 960 µF, Genepulser;
Bio-Rad, Richmond, CA) with 20 µg pGL3 reporter construct and 4 µg
pRL-SV40 and harvested 2 days after transfection. Luciferase activity
was determined using a luminometer (Tropix, Bedford, MA) and corrected
for transfection efficiency with the Renilla luciferase
activity values.
Preparation of nuclear extracts
Nuclear extracts were prepared from 10 x 106 cells. The cells were harvested, washed with PBS, and taken up in 300 µl (three cell volumes) of hypotonic solution (20 mM HEPES (pH 8.0), 10 mM KCl, 0.15 mM EGTA, 0.15 mM EDTA, 1 mM DTT, 0.5 mM 4-(2-aminoethyl) benzenesulfonyl fluoride (AEBSF)) and were left on ice for 15 min. The cells were lysed with Nonidet P-40 (final concentration of 0.20.4%) for 35 min. A total of 80 µl (80% of the cell volume) of a sucrose solution (50 mM HEPES (pH 8.0), 10 mM KCl, 0.25 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 70% w/v sucrose) was added, and the nuclei were centrifuged at 5000 rpm for 5 min at 4°C. The supernatant was discarded, and the pellet was gently taken up in 300 µl (three cell volumes) of solution B (10 mM HEPES (pH 8.0), 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 25% v/v glycerol) and centrifuged at 5000 rpm for 5 min at 4°C. After discarding the supernatant, the cell pellet was taken up in 200 µl (2 cell volumes) of extraction solution (10 mM HEPES (pH 8.0), 400 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 25% glycerol) and left on ice for 30 min with intermittent vortexing. The extracted nuclei were centrifuged at 14,000 rpm for 5 min at 4°C, and the supernatant was aliquoted and stored at -80°C. The total amount of protein was determined using the BCA protein assay reagent kit (Pierce, Rockford, IL), according to the manufacturers instructions.
EMSA
Nuclear extracts (
5 µg protein) were incubated in
DNA/protein binding buffer (10 mM HEPES (pH 7.9), 60 mM KCl, 10% v/v
glycerol, 1 mM DTT, 1 mM EDTA, 3 mM MgCl2 and 10
mM NaPi), with 200 ng poly(dI · dC), 200 ng sonicated
single-stranded herring sperm DNA, and 1 ng
32P-radiolabeled probe for 30 min at 4°C. The
samples were run on a 6% nondenaturing polyacrylamide gel in 0.25x
Tris-borate-EDTA buffer at 200 V for 2 h. The gels were fixed with
a 10% methanol, 10% acetic acid solution, dried onto Whatmann 3 M
paper (Tewksbury, MA) and exposed to an x-ray film. The
ds-oligonucleotides containing the (putative) ISRE from the various HLA
class I genes (see Table I
) were used as probes. A probe containing the
GAS element of the IRF-1 gene promoter (5'-CCTGATTTCCCCGAAATGATG-3';
Ref. 26) was used as control for Stat1 binding.
For the supershift assays, 1 µg of each Ab specifically directed
against a member of the IRF family of transcription factors was added
30 min after the nuclear extract had been incubated with the probe, and
this mixture was incubated for an additional hour at 4°C. The Abs
used were directed against human IRF-1 (sc-497), IRF-2 (sc-498), p48
(sc-496), Stat1 p84/p91 (sc-346), Sp1 (sc-59), upstream stimulatory
factor (USF)-1 (sc-229), USF-2 (sc-861), Myc (sc-42), NF-
B p50
(sc-114), NF-
B p65 (sc-109), c-Rel (sc-71), and mouse IRF-1 (sc-640,
not cross-reactive with human IRF-1; all from Santa Cruz Biotechnology,
Santa Cruz, CA).
| Results |
|---|
|
|
|---|
MHC class I genes contain a single ISRE motif in their proximal
promoter region. The ISRE motif of HLA-F (AGTTTCTCTTTC) displays the
highest degree of homology of all HLA class I loci to the consensus
ISRE sequence (AGTTTCNNTTTC) (Table I
). The ISRE of HLA-B and HLA-C
(AGTTTCACTTCT) also has a high degree of homology to the consensus
sequence, and the ISRE of the HLA-A loci
(AGTTTCTTTTCT) differs from that of the HLA-B
and HLA-C loci by only two nucleotides. The ISREs of the other loci
(HLA-E and HLA-G) are more divergent from the consensus ISRE sequence
(Table I
). Despite the fact that the core sequence of the ISRE in the
HLA-B and HLA-C alleles is identical, there is a difference in the 6 bp
directly upstream of the ISRE (see Table I
). Most HLA-B loci, except,
e.g., HLA-B7, contain the sequence CACGAG, which is a putative E box
(27), whereas this element is not found in HLA-C alleles.
For this reason, we made an artificial division of the ISRE of the
HLA-B and HLA-C locus (see Table I
). The ISRE of the HLA-B alleles
containing the putative E box are referred to as
ISRE-BE, and the ISRE of HLA-B7 and other HLA-B
alleles that lack this E box are grouped with the ISRE of the HLA-C
alleles and collectively referred to as ISRE-B/C. CG-rich sequences are
present in the ISRE and flanking region of HLA-A, HLA-B, HLA-C, HLA-F,
and HLA-G.
IFN-
-induced HLA class I transactivation through the ISRE
The role of the ISRE of the various HLA class I loci to
IFN-
-induced transactivation was evaluated using HLA class I
promoter-driven reporter constructs in transient cotransfection
experiments. Previously, it was noted that both the 3' flanking
sequence of the ISRE and site
are crucial for the IFN-
-induced
transactivation through the ISRE (20, 24). Therefore, we
used the series of constructs containing a PCR-generated product
encompassing the ISRE of the various HLA class I loci linked to the
immediate adjacent promoter sequence of HLA-B7. Using this panel of
reporter constructs, the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F were
all shown to mediate IFN-
-induced transcriptional activity (Fig. 1
). However, the IFN-
-induced
transactivation through the ISRE of HLA-A was at least 2-fold weaker
than that of the other loci. The IFN-
-induced transactivation
through the ISRE of HLA-B and HLA-C was similar (cf
ISRE-BE and ISRE-B/C, Fig. 1
). Since the core
sequence of the ISRE of all HLA-B and HLA-C alleles is identical, this
implies that the putative E box flanking the ISRE of most HLA-B loci
(ISRE-BE) does not influence the IFN-
-induced
transactivation. The ISREs of HLA-E and HLA-G were not able to mediate
a significant IFN-
-induced transactivation (Fig. 1
). Similar results
were found in HeLa cells (data not shown).
|
The binding of IFN-
-inducible factors to the ISRE motifs of the
classical and nonclassical HLA class I genes was investigated using a
panel of probes representing the putative ISRE motifs of all HLA class
I loci and their flanking sequences (see Table I
). First, binding of
IFN-
-induced factors to the ISRE of HLA-B was investigated in a
time course experiment, using nuclear extracts from HeLa cells treated
with IFN-
for 30 min up to 24 h. One predominant
IFN-
-induced complex was found (Fig. 2
). This complex increased in intensity
between 1 and 16 h after IFN-
treatment, after which the amount
of this IFN-
-induced factor binding to the ISRE decreased (Fig. 2
).
|
treatment. The predominant IFN-
-induced
DNA/protein complex was shown to contain IRF-1 and not Stat1 nor p48 in
supershift analysis (Fig. 3
|
-induced HeLa cells (Fig. 4
|
Apart from the IFN-
-induced complexes, several other complexes
were found to bind constitutively to the ISRE of HLA class I loci. The
overall bandshift patterns of the ISRE probes of HLA-B and HLA-C were
identical, except for several closely migrating complexes (cf
ISRE-BE and ISRE-B/C; Fig. 3
A). Since
the core sequence of the ISRE is identical in these loci, this complex
is most probably binding to the flanking sequences. As mentioned
above, the ISRE of most HLA-B alleles is flanked by a putative
E box (Table I
). This element is a potential binding site for USFs
(27), which belong to the basic helix-loop-helix family of
proteins. In supershift analysis, both complexes were shown to contain
USF-1 and USF-2 (Fig. 5
), which
suggests that they bind as a heterodimer. Although an E box is also a
potential binding site for the oncogene products Myc/Max
(28), no binding of c-Myc was detected under these
conditions (Fig. 5
). As expected, no binding of USF-1 or USF-2 was
observed to the ISREs of the other loci (Fig. 5
and data not
shown).
|
Functional role of the USF and Sp1 binding sites flanking the ISRE
The constitutive binding of USF-1 and USF-2 to the E box flanking
the ISRE of most HLA-B alleles did not influence the IFN-
-induced
transactivation of these alleles (see also Fig. 1
). To further test
whether the E box contributed to the constitutive transcriptional
activity, transient transfection assays were performed in MHC class
I-expressing cell lines. The basal level of transcription was reduced
in the reporter construct containing the E box
(ISRE-BE) as compared with that of ISRE-B/C in
Tera-2, HeLa, as well as B cells (Fig. 6
). This implies that the constitutive
binding of USFs to the E box (flanking the ISRE in most HLA-B loci)
inhibits the basal level of transcription.
|
-induced transactivation of MHC class I, an additional HLA-B7
promoter construct containing the Sp1 site was tested (Fig. 7
-induced transcription of HLA class I (cf B190 and B180;
Fig. 7
|
| Discussion |
|---|
|
|
|---|
-induced transactivation; among the nonclassical HLA class I
molecules, only the ISRE of HLA-F mediates IFN-
induction. This is
congruent with the binding of IRF-1 to the ISRE of these loci upon
IFN-
stimulation. Upon IFN-
stimulation, IRF-1 replaces IRF-2 and
becomes the predominant factor occupying the ISRE (29).
Thus, IRF-1 is the principal factor mediating the IFN-
-induced
expression of MHC class I (13, 30, 31) (Fig. 8
2-fold weaker than that of the other loci (this study, and
Refs. 13, 19), which is consistent with the weaker binding
affinity for IRF-1 to the ISRE of the HLA-A locus (13). In
contrast, others have reported that the ISRE of the A locus (linked to
a heterologous promoter) was not responsive to IFN-
and that the
ISRE of HLA-B binds a factor other than IRF-1, p48, or Stat1
(23). The ISRE of HLA-E did not mediate IFN-
-induced
transactivation in our assays, correlating with the lack of significant
IRF-1 binding (this study; Fig. 8
(Ref.
32 , and S. Gobin et al., unpublished observations).
Gustafson et al. (32) have identified upstream sequences
in the HLA-E promoter that mediate this IFN-
-induced expression of
HLA-E. This region consists of two Stat1 binding sites of which the
downstream site overlaps with the ISRE region. However, it is
predominantly the 5' GAS element that binds Stat1 and mediates
IFN-
-induced transactivation of HLA-E (Ref. 32 , and
Fig. 8
-induced transactivation was observed through the
ISRE of HLA-G. Transient transfection assays using reporter constructs
containing the 1.5-kb promoter region of HLA-G confirmed the lack of
IFN-
-induced transactivation of this locus, despite the presence of
a potential IRF-1 binding site further upstream in the promoter
(33).
|
-induced
transactivation, indicating that IRF-1 binding is not hindered by
occupancy of the E box. However, the presence of the E box reduced the
basal level of MHC class I transactivation, suggesting that USF-1 and
USF-2 are inhibitors of constitutive MHC class I transcription.
Sp1, another constitutively expressed factor, was shown to bind to the
ISRE regions of HLA-B, HLA-C, and HLA-G, in which the CG-rich sequences
are most probably the target binding site for Sp1 (34, 37)
(Fig. 8
). Sp1 is known to play a role in the basal transcriptional
activity (38). However, the Sp1 site was not crucial for
constitutive or IFN-
-induced transactivation through the ISRE, since
lack of the Sp1 sequences did not reduce the constitutive or
IFN-
-induced transactivation (this study). Thus, no evidence was
found for an important role of this flanking Sp1 site in constitutive
or IFN-
-induced MHC class I transactivation.
In this study, it is shown that variation in the nucleotide sequence of
the ISRE and its immediately flanking sites of the different HLA class
I loci determines the binding of transactivators of the IRF family of
proteins and other transcription factors (Fig. 8
). Consequently, this
results in differences in IFN-
inducibility and basal levels of gene
transcription. Therefore, locus-specific variations in the nucleotide
sequences of the ISRE of HLA class I genes contribute to the
differential constitutive and IFN-
-mediated transactivation of HLA
class I loci. Locus-specific transcriptional control through the ISRE
could be an important mechanism that determines adequate Ag
presentation upon pathogenic challenge.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Sam J. P. Gobin, Department of Immunohematology and Blood Bank, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands. E-mail address: ![]()
3 Current address: Department of Nephrology, Leiden University Medical Center, Leiden, The Netherlands. ![]()
4 Abbreviations used in this paper: GAS, IFN-
activation site; IRF, IFN regulatory factor; ISRE, IFN-stimulated response element; USF, upstream stimulatory factor. ![]()
Received for publication February 26, 1999. Accepted for publication May 13, 1999.
| References |
|---|
|
|
|---|
. Curr. Opin. Immunol. 4:321.[Medline]
. Annu. Rev. Immunol. 15:749.[Medline]
receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15:563.[Medline]
B. J. Immunol. 161:2276.
B element,
B2, of the HLA-A class I regulatory complex is an essential part of the promoter. J. Immunol. 153:5082.[Abstract]
is crucial for two routes of IFN-
induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
2-microglobulin genes. Immunity 9:531.[Medline]
-interferon (IFN)-inducible factor distinct from STAT1
, p48, and IFN regulatory factor-1. J. Biol. Chem. 271:29813.
induction of the human leukocyte antigen-E gene is mediated through binding of a complex containing STAT1
to a distinct interferon-
-response element. J. Biol. Chem. 271:20035.This article has been cited by other articles:
![]() |
A. S. Kotekar, J. D. Weissman, A. Gegonne, H. Cohen, and D. S. Singer Histone Modifications, but Not Nucleosomal Positioning, Correlate with Major Histocompatibility Complex Class I Promoter Activity in Different Tissues In Vivo Mol. Cell. Biol., December 15, 2008; 28(24): 7323 - 7336. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, L. Ye, Y. Bai, H. Mojidi, N. E. Simister, and X. Zhu Activation of the JAK/STAT-1 Signaling Pathway by IFN-{gamma} Can Down-Regulate Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG J. Immunol., July 1, 2008; 181(1): 449 - 463. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. M. Doody, S. Stephenson, C. McManamy, and R. M. Tooze PRDM1/BLIMP-1 Modulates IFN-{gamma}-Dependent Control of the MHC Class I Antigen-Processing and Peptide-Loading Pathway J. Immunol., December 1, 2007; 179(11): 7614 - 7623. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Christova, T. Jones, P.-J. Wu, A. Bolzer, A. P. Costa-Pereira, D. Watling, I. M. Kerr, and D. Sheer P-STAT1 mediates higher-order chromatin remodelling of the human MHC in response to IFN{gamma} J. Cell Sci., September 15, 2007; 120(18): 3262 - 3270. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sekimoto, S. Ozaki, T. Ohshima, H. Shibata, T. Hashimoto, M. Abe, N. Kimura, K. Hattori, S. Kawai, Y. Kinoshita, et al. A Single-Chain Fv Diabody against Human Leukocyte Antigen-A Molecules Specifically Induces Myeloma Cell Death in the Bone Marrow Environment Cancer Res., February 1, 2007; 67(3): 1184 - 1192. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Browne, J. R. Roesser, S. Z. Zhu, and G. D. Ginder Differential IFN-{gamma} Stimulation of HLA-A Gene Expression through CRM-1-Dependent Nuclear RNA Export J. Immunol., December 15, 2006; 177(12): 8612 - 8619. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Moon, S. M. Veniamin, J. A. Parks-Dely, and K. E. Magor The MHC of the Duck (Anas platyrhynchos) Contains Five Differentially Expressed Class I Genes J. Immunol., November 15, 2005; 175(10): 6702 - 6712. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Rempel, L. A. Quina, P. K. Blakely-Gonzales, M. J. Buchmeier, and D. L. Gruol Viral Induction of Central Nervous System Innate Immune Responses J. Virol., April 1, 2005; 79(7): 4369 - 4381. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. K. Howcroft, J. D. Weissman, A. Gegonne, and D. S. Singer A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression J. Immunol., February 15, 2005; 174(4): 2106 - 2115. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Gobin, P. Biesta, and P. J. Van den Elsen Regulation of human beta 2-microglobulin transactivation in hematopoietic cells Blood, April 15, 2003; 101(8): 3058 - 3064. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Johnson Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression J. Immunol., February 15, 2003; 170(4): 1894 - 1902. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Moreau, G. Mouillot, P. Rousseau, C. Marcou, J. Dausset, and E. D. Carosella HLA-G gene repression is reversed by demethylation PNAS, February 4, 2003; 100(3): 1191 - 1196. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Gobin, P. Biesta, J. E. M. de Steenwinkel, G. Datema, and P. J. Van den Elsen HLA-G Transactivation by cAMP-response Element-binding Protein (CREB). AN ALTERNATIVE TRANSACTIVATION PATHWAY TO THE CONSERVED MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) CLASS I REGULATORY ROUTES J. Biol. Chem., October 11, 2002; 277(42): 39525 - 39531. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Xu, D. Ye, M. Fisher, and R. L. Juliano Selective Inhibition of P-glycoprotein Expression in Multidrug-Resistant Tumor Cells by a Designed Transcriptional Regulator J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 963 - 971. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Gobin, M. van Zutphen, S. D. Westerheide, J. M. Boss, and P. J. van den Elsen The MHC-Specific Enhanceosome and Its Role in MHC Class I and {beta}2-Microglobulin Gene Transactivation J. Immunol., November 1, 2001; 167(9): 5175 - 5184. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Luker, C. M. Pica, R. D. Schreiber, and D. Piwnica-Worms Overexpression of IRF9 Confers Resistance to Antimicrotubule Agents in Breast Cancer Cells Cancer Res., September 1, 2001; 61(17): 6540 - 6547. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Arons, V. Kunin, C. Schechter, and R. Ehrlich Organization and Functional Analysis of the Mouse Transporter Associated with Antigen Processing 2 Promoter J. Immunol., March 15, 2001; 166(6): 3942 - 3951. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. P. Gobin, P. J. van den Elsen, and J. Girdlestone Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element Blood, March 1, 2001; 97(5): 1518 - 1521. [Full Text] [PDF] |
||||
![]() |
S. Lefebvre, S. Berrih-Aknin, F. Adrian, P. Moreau, S. Poea, L. Gourand, J. Dausset, E. D. Carosella, and P. Paul A Specific Interferon (IFN)-stimulated Response Element of the Distal HLA-G Promoter Binds IFN-regulatory Factor 1 and Mediates Enhancement of This Nonclassical Class I Gene by IFN-beta J. Biol. Chem., February 23, 2001; 276(9): 6133 - 6139. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |