The JI Acurri Cytometers
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gobin, S. J. P.
Right arrow Articles by Elsen, P. J. v. d.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gobin, S. J. P.
Right arrow Articles by Elsen, P. J. v. d.
The Journal of Immunology, 1999, 163: 1428-1434.
Copyright © 1999 by The American Association of Immunologists

Transactivation of Classical and Nonclassical HLA Class I Genes Through the IFN-Stimulated Response Element1

Sam J. P. Gobin2, Marlijn van Zutphen, Andrea M. Woltman3 and Peter J. van den Elsen

Department of Immunohematology and Blood Bank, Leiden University Medical Center, Leiden, The Netherlands


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The IFN-stimulated response element (ISRE) is an important conserved cis-acting regulatory element in the promoter of MHC class I genes, but displays considerable locus-specific nucleotide variation. In this report, the putative ISREs of classical and nonclassical HLA class I genes were investigated for their contribution to MHC class I transactivation. It is shown that IFN-{gamma} induced MHC class I transactivation through the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F. This is congruent with the binding of IFN regulatory factor-1 to the ISREs of these loci upon IFN-{gamma} treatment. Sp1 was shown to bind to the CG-rich sequences in the ISRE regions of HLA-B, HLA-C, and HLA-G. The putative E box 5' of the ISRE in most HLA-B alleles was shown to bind the upstream stimulatory factors (USF) 1 and 2. The Sp1 and USF binding sites did not influence IFN-{gamma}-induced transactivation. However, the USF binding site played a suppressive role in the constitutive expression of HLA-B. The locus-specific transcriptional control through the ISRE could be an important mechanism in the differential regulation of classical and nonclassical MHC class I expression, which determines adequate Ag presentation upon pathogenic challenge.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Type I ({alpha}, {beta}) and type II ({gamma}) IFNs are potent regulators of antiviral activities and cell proliferation and differentiation. Therefore, they play a central role in the immune response (1, 2). IFN-{gamma} exerts its biological effects through the signal transduction pathway, which involves binding to its receptor, activation of Janus kinases (Jak) 1 and 2, and phosphorylation of latent Stat1 (reviewed in Refs. 3, 4). A homodimer of activated Stat1 can bind to the IFN-{gamma} activation site (GAS),4 or, in combination with p48 (also called ISGF3{gamma}), to the IFN-stimulated response element (ISRE), thereby transactivating genes bearing either of these sequences in their promoter (5, 6). p48 and other transcription factors of the IFN regulatory factor (IRF) family, such as IRF-1, IRF-2, and IFN consensus sequence binding protein (ICSBP), are induced by this route. They form a group of secondary transcription factors that regulate gene transcription in a positive (IRF-1) or negative (IRF-2 and ICSBP) manner or act as helpers of protein/DNA complex formation (p48). Their principal target sequence is the ISRE present in IFN-{gamma}-inducible genes (5). This cascade of events results in the transactivation of a number of genes important in the immune system, including MHC class I heavy chain, {beta}2-microglobulin, and other genes, the products of which are important for peptide loading and assembly of the MHC class I complex (reviewed in Ref. 2).

Classical MHC class I molecules serve to present antigenic peptides to CTL and are therefore crucial in the immune response (7). Concordantly, they are ubiquitously expressed in most adult tissue types (8, 9). In contrast, the expression of nonclassical MHC class I molecules is more restricted (9). Their exact role in the immune response is not fully understood, but their expression in embryonic tissues suggests a function in development (10).

Locus-specific differences in the level of constitutive and IFN-induced expression of MHC class I genes (11, 12, 13) is thought to be of importance during development and also for the immune defense against a diversity of pathogens. Structural differences in the regulatory elements of proximal promoters of the MHC class I genes (reviewed in Refs. 14, 15, 16) and their resulting differential binding affinities for transcription factors may be the prime regulatory mechanism of locus-specific expression of MHC class I molecules. Three conserved regulatory elements in the promoter region of MHC class I, i.e., the enhancer A, the ISRE, and site {alpha}, have been indicated to play an important role in the constitutive and cytokine-induced transactivation of MHC class I genes (reviewed in Ref. 16). Enhancer A contains binding sites for NF-{kappa}B/Rel transcription factors and mediates the TNF-{alpha}-induced transactivation of MHC class I (13, 17, 18). The ISRE is a binding site for factors of the IRF family and mediates the induction of MHC class I transcription by the IFNs, of which IFN-{gamma} is the most potent (9, 13, 19). Site {alpha} is bound by proteins of the activating transcription factor/cAMP response element binding protein (ATF/CREB) family and plays an important role in the constitutive, IFN-{gamma}-induced and class II transactivator-mediated MHC class I transactivation (20, 21, 22).

Despite the fact that these regulatory sequences are generally conserved among the MHC class I molecules, nucleotide variation exists, particularly in the ISRE and enhancer A of classical and nonclassical HLA class I molecules (reviewed in Ref. 16). Recently, it has been demonstrated that the locus-specific nucleotide variation in the enhancer A determined the binding affinity for transcription factors of the NF-{kappa}B family and Sp1 and the contribution of this regulatory element to transactivation (17). Similarly, variation in the nucleotide sequence of the ISRE could determine its capacity to bind transcription factors and its contribution to transactivation. This has been investigated for some but not all loci, and the role of the ISRE of HLA-A in transactivation has been controversial (cf Refs. 13, 19, 23). Therefore, we conducted a systematic study to establish the role of the ISRE in the transactivation of the classical and nonclassical HLA class I genes.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture

The teratocarcinoma cell line Tera-2, the cervical carcinoma cell line HeLa, and the EBV-transformed B cell line MSH were grown in IMDM medium supplemented with 10% (v/v) heat-inactivated FCS (Life Technologies, Paisley, Scotland), penicillin (100 IU/ml), and streptomycin (100 µg/ml).

Plasmids

The reporter constructs pGL3-B190, pGL3-B180, and pGL3-B170 were generated by cloning a 187-bp, a 182-bp, or a 161-bp HLA-B*0702 promoter fragment upstream of the firefly luciferase gene in pGL3-Basic (Promega, Madison, WI). The ISRE-containing reporter constructs were generated by cloning a PCR-generated fragment containing the ISRE sequence of the various HLA class I loci (in capitals, see below) and the downstream 163-bp promoter sequence of HLA-B*0702 (in bold, see below) in front of the firefly luciferase gene in pGL3-Basic. Note that pGL3-ISRE-B/C is identical in sequence to pGL3-B180. The proximal HLA class I promoter sequences in these reporter constructs are of crucial importance, because the lack of site {alpha} or the immediate 3' flanking sequence of the ISRE abrogates IFN-{gamma}-induced transactivation (20, 24). The ISRE region of most HLA-B loci contains a putative E box (underlined, see below), and this ISRE sequence is therefore termed ISRE-BE to distinguish it from the ISRE region of other HLA-B alleles and HLA-C (termed ISRE-B/C; see also Table IGo). In HLA-G, no obvious ISRE-like sequence can be found. The sequence that has been chosen to test here is positioned around the site at which the ISRE would be expected and includes the putative {kappa}B1 site of enhancer A (17). Primers used for PCR amplification of hybrid promoter fragments containing the ISRE of the various HLA class I loci and the flanking HLA-B*0702 promoter region were as follows: gatagatctctccgcAGTTTCTTTTCTcctcccaacttgtgtcggg (ISRE-A); gatagatctactcccacgAGTTTCACTTCTtctcccaacttgtgtcgg (ISRE-BE); gatagatctactcccctgAGTTTCACTTCTtctcccaacttgtgtcgg (ISRE-B/C); gatagatcttctgcAGTTTCCCGTTCcctcccaacttgtgtcggg (ISRE-E); gatagatcttctccccagAGTTTCTCTTTCtctcccaacttgtgtcgg (ISRE-F); gatagatctATTCTCTCCTccttctcctcccaacttgtgtcggg (ISRE-G); and as reverse primer, gataagcttcggcgtctgaggagact (B7R). All plasmids were verified by DNA sequence analysis (T7-polymerase sequence kit; Amersham, Buckinghamshire, England).


View this table:
[in this window]
[in a new window]
 
Table I. Oligonucleotides of the ISRE regions of the various HLA class I loci used for EMSAs1

 
Transient transfection

Adherent cells were transfected by the calcium phosphate coprecipitation method (25). In each of four wells of a six-well plate, 0.2 x 106 Tera-2 cells were transfected with a DNA precipitate of 2 µg pGL3 reporter plasmid and 0.2 µg Renilla luciferase control plasmid (pRL-SV40; Promega). The following day, the medium was replaced by fresh medium with or without IFN-{gamma} (500 U/ml). The cells were harvested 3 days after transfection. Tera-2 cells were chosen for these transient transfection experiments because of the high IFN-{gamma}-induced promoter activities. Nonadherent cells (10 x 106) were transfected by electroporation (250 V, 960 µF, Genepulser; Bio-Rad, Richmond, CA) with 20 µg pGL3 reporter construct and 4 µg pRL-SV40 and harvested 2 days after transfection. Luciferase activity was determined using a luminometer (Tropix, Bedford, MA) and corrected for transfection efficiency with the Renilla luciferase activity values.

Preparation of nuclear extracts

Nuclear extracts were prepared from 10 x 106 cells. The cells were harvested, washed with PBS, and taken up in 300 µl (three cell volumes) of hypotonic solution (20 mM HEPES (pH 8.0), 10 mM KCl, 0.15 mM EGTA, 0.15 mM EDTA, 1 mM DTT, 0.5 mM 4-(2-aminoethyl) benzenesulfonyl fluoride (AEBSF)) and were left on ice for 15 min. The cells were lysed with Nonidet P-40 (final concentration of 0.2–0.4%) for 3–5 min. A total of 80 µl (80% of the cell volume) of a sucrose solution (50 mM HEPES (pH 8.0), 10 mM KCl, 0.25 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 70% w/v sucrose) was added, and the nuclei were centrifuged at 5000 rpm for 5 min at 4°C. The supernatant was discarded, and the pellet was gently taken up in 300 µl (three cell volumes) of solution B (10 mM HEPES (pH 8.0), 100 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 25% v/v glycerol) and centrifuged at 5000 rpm for 5 min at 4°C. After discarding the supernatant, the cell pellet was taken up in 200 µl (2 cell volumes) of extraction solution (10 mM HEPES (pH 8.0), 400 mM NaCl, 0.1 mM EDTA, 1 mM DTT, 0.5 mM AEBSF, 25% glycerol) and left on ice for 30 min with intermittent vortexing. The extracted nuclei were centrifuged at 14,000 rpm for 5 min at 4°C, and the supernatant was aliquoted and stored at -80°C. The total amount of protein was determined using the BCA protein assay reagent kit (Pierce, Rockford, IL), according to the manufacturer’s instructions.

EMSA

Nuclear extracts (~5 µg protein) were incubated in DNA/protein binding buffer (10 mM HEPES (pH 7.9), 60 mM KCl, 10% v/v glycerol, 1 mM DTT, 1 mM EDTA, 3 mM MgCl2 and 10 mM NaPi), with 200 ng poly(dI · dC), 200 ng sonicated single-stranded herring sperm DNA, and 1 ng 32P-radiolabeled probe for 30 min at 4°C. The samples were run on a 6% nondenaturing polyacrylamide gel in 0.25x Tris-borate-EDTA buffer at 200 V for 2 h. The gels were fixed with a 10% methanol, 10% acetic acid solution, dried onto Whatmann 3 M paper (Tewksbury, MA) and exposed to an x-ray film. The ds-oligonucleotides containing the (putative) ISRE from the various HLA class I genes (see Table IGo) were used as probes. A probe containing the GAS element of the IRF-1 gene promoter (5'-CCTGATTTCCCCGAAATGATG-3'; Ref. 26) was used as control for Stat1 binding.

For the supershift assays, 1 µg of each Ab specifically directed against a member of the IRF family of transcription factors was added 30 min after the nuclear extract had been incubated with the probe, and this mixture was incubated for an additional hour at 4°C. The Abs used were directed against human IRF-1 (sc-497), IRF-2 (sc-498), p48 (sc-496), Stat1 p84/p91 (sc-346), Sp1 (sc-59), upstream stimulatory factor (USF)-1 (sc-229), USF-2 (sc-861), Myc (sc-42), NF-{kappa}B p50 (sc-114), NF-{kappa}B p65 (sc-109), c-Rel (sc-71), and mouse IRF-1 (sc-640, not cross-reactive with human IRF-1; all from Santa Cruz Biotechnology, Santa Cruz, CA).


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Locus-specific variation in the nucleotide sequence of the ISRE of the classical and nonclassical HLA class I genes

MHC class I genes contain a single ISRE motif in their proximal promoter region. The ISRE motif of HLA-F (AGTTTCTCTTTC) displays the highest degree of homology of all HLA class I loci to the consensus ISRE sequence (AGTTTCNNTTTC) (Table IGo). The ISRE of HLA-B and HLA-C (AGTTTCACTTCT) also has a high degree of homology to the consensus sequence, and the ISRE of the HLA-A loci (AGTTTCTTTTCT) differs from that of the HLA-B and HLA-C loci by only two nucleotides. The ISREs of the other loci (HLA-E and HLA-G) are more divergent from the consensus ISRE sequence (Table IGo). Despite the fact that the core sequence of the ISRE in the HLA-B and HLA-C alleles is identical, there is a difference in the 6 bp directly upstream of the ISRE (see Table IGo). Most HLA-B loci, except, e.g., HLA-B7, contain the sequence CACGAG, which is a putative E box (27), whereas this element is not found in HLA-C alleles. For this reason, we made an artificial division of the ISRE of the HLA-B and HLA-C locus (see Table IGo). The ISRE of the HLA-B alleles containing the putative E box are referred to as ISRE-BE, and the ISRE of HLA-B7 and other HLA-B alleles that lack this E box are grouped with the ISRE of the HLA-C alleles and collectively referred to as ISRE-B/C. CG-rich sequences are present in the ISRE and flanking region of HLA-A, HLA-B, HLA-C, HLA-F, and HLA-G.

IFN-{gamma}-induced HLA class I transactivation through the ISRE

The role of the ISRE of the various HLA class I loci to IFN-{gamma}-induced transactivation was evaluated using HLA class I promoter-driven reporter constructs in transient cotransfection experiments. Previously, it was noted that both the 3' flanking sequence of the ISRE and site {alpha} are crucial for the IFN-{gamma}-induced transactivation through the ISRE (20, 24). Therefore, we used the series of constructs containing a PCR-generated product encompassing the ISRE of the various HLA class I loci linked to the immediate adjacent promoter sequence of HLA-B7. Using this panel of reporter constructs, the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F were all shown to mediate IFN-{gamma}-induced transcriptional activity (Fig. 1Go). However, the IFN-{gamma}-induced transactivation through the ISRE of HLA-A was at least 2-fold weaker than that of the other loci. The IFN-{gamma}-induced transactivation through the ISRE of HLA-B and HLA-C was similar (cf ISRE-BE and ISRE-B/C, Fig. 1Go). Since the core sequence of the ISRE of all HLA-B and HLA-C alleles is identical, this implies that the putative E box flanking the ISRE of most HLA-B loci (ISRE-BE) does not influence the IFN-{gamma}-induced transactivation. The ISREs of HLA-E and HLA-G were not able to mediate a significant IFN-{gamma}-induced transactivation (Fig. 1Go). Similar results were found in HeLa cells (data not shown).



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. IFN-{gamma}-induced transactivation through the ISRE of classical and nonclassical HLA class I genes. Transient transfection assay of a series of reporter constructs containing the ISRE of the various HLA class I loci linked to a 163-bp HLA-B7 promoter fragment in Tera-2 cells either untreated or treated with IFN-{gamma} (500 U/ml) for 48 h. Luciferase values were normalized with the Renilla luciferase activity and are expressed as mean ± SD of n = 4. Fold induction (indicated on the right) is calculated as the luciferase values of IFN-{gamma}-treated over untreated cells.

 
Proteins binding to the ISRE motif of the classical and nonclassical HLA class I genes

The binding of IFN-{gamma}-inducible factors to the ISRE motifs of the classical and nonclassical HLA class I genes was investigated using a panel of probes representing the putative ISRE motifs of all HLA class I loci and their flanking sequences (see Table IGo). First, binding of IFN-{gamma}-induced factors to the ISRE of HLA-B was investigated in a time course experiment, using nuclear extracts from HeLa cells treated with IFN-{gamma} for 30 min up to 24 h. One predominant IFN-{gamma}-induced complex was found (Fig. 2Go). This complex increased in intensity between 1 and 16 h after IFN-{gamma} treatment, after which the amount of this IFN-{gamma}-induced factor binding to the ISRE decreased (Fig. 2Go).



View larger version (111K):
[in this window]
[in a new window]
 
FIGURE 2. Induction of an IFN-{gamma}-induced protein binding to the ISRE. EMSA analysis using nuclear extracts of HeLa cells either untreated or treated with IFN-{gamma} (500 U/ml) for different time periods. The binding of one predominant induced complex (indicated by an arrow) to the ISRE of HLA-B (ISRE-BE).

 
Next, a panel of locus-specific ISRE probes (see Table IGo) was employed to test binding of members of the IRF family to the ISRE of HLA class I genes upon IFN-{gamma} treatment. The predominant IFN-{gamma}-induced DNA/protein complex was shown to contain IRF-1 and not Stat1 nor p48 in supershift analysis (Fig. 3Go, A and B). The lack of Stat1 binding to this ISRE was not due to an absence of Stat1 in these nuclear extracts, since Stat1 binding was detected to a consensus GAS site of the IRF-1 promoter (using these nuclear extracts and this Stat1 Ab; data not shown). Binding of IRF-1 was detected to the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F, whereas the binding or IRF-1 to the ISRE of HLA-E was marginal (Fig. 3Go, A and B).



View larger version (85K):
[in this window]
[in a new window]
 
FIGURE 3. Protein binding to the ISRE of the different HLA class I loci in response to IFN-{gamma}. EMSA analysis of protein binding to the ISRE of classical (A) and nonclassical (B) HLA class I genes using nuclear extracts of untreated HeLa cells or HeLa cells treated with IFN-{gamma} (500 U/ml) for 2 h. Using specific Abs, the IFN-{gamma}-induced binding of IRF-1 was revealed by supershifting the complex. IRF-1 bound to the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F. Binding of IRF-1 to the ISRE of HLA-E was marginal. The Ab directed against mouse IRF-1 (mIRF-1) served as negative control. Supershifted complexes are indicated by an asterisk.

 
In nuclear extracts from noninduced HeLa cells, IRF-2 was identified in a complex that migrated at a similar height as the IRF-1 band (Fig. 4Go). IRF-2 was also detected in nuclear extracts of IFN-{gamma}-induced HeLa cells (Fig. 4Go), albeit that the predominant factor was now IRF-1, judging by the supershifted complex (Figs. 3Go and 4Go). Binding of IRF-2 was observed to the ISRE of HLA-A, HLA-B, HLA-C, and HLA-F using nuclear extracts from noninduced HeLa cells (Fig. 4Go and data not shown).



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 4. The binding of IRF-2 to the ISRE is reduced by IFN-{gamma} treatment. Supershift analysis of nuclear extracts of HeLa cells either untreated or treated with IFN-{gamma} (500 U/ml) revealed the binding of IRF-2 to ISRE-BE. The level of complex formation was stronger in noninduced cells. Binding of IRF-2 was also detected to the ISRE probes of HLA-A, HLA-B/C, and HLA-F in untreated Hela cells (data not shown). The Ab directed against mouse IRF-1 (mIRF-1) served as negative control. Supershifted complexes are indicated by an asterisk.

 
Other transcription factors binding to the ISRE region

Apart from the IFN-{gamma}-induced complexes, several other complexes were found to bind constitutively to the ISRE of HLA class I loci. The overall bandshift patterns of the ISRE probes of HLA-B and HLA-C were identical, except for several closely migrating complexes (cf ISRE-BE and ISRE-B/C; Fig. 3GoA). Since the core sequence of the ISRE is identical in these loci, this complex is most probably binding to the flanking sequences. As mentioned above, the ISRE of most HLA-B alleles is flanked by a putative E box (Table IGo). This element is a potential binding site for USFs (27), which belong to the basic helix-loop-helix family of proteins. In supershift analysis, both complexes were shown to contain USF-1 and USF-2 (Fig. 5Go), which suggests that they bind as a heterodimer. Although an E box is also a potential binding site for the oncogene products Myc/Max (28), no binding of c-Myc was detected under these conditions (Fig. 5Go). As expected, no binding of USF-1 or USF-2 was observed to the ISREs of the other loci (Fig. 5Go and data not shown).



View larger version (112K):
[in this window]
[in a new window]
 
FIGURE 5. USF-1, USF-2, and Sp1 binding to the ISRE region. Supershift analysis of HeLa nuclear extracts using specific Abs revealed the constitutive binding of USF-1 and USF-2 to ISRE-BE and binding of Sp1 to the ISRE of HLA-B, HLA-C, and HLA-G. The Ab directed against mouse IRF-1 (mIRF-1) served as negative control. Supershifted complexes are indicated by an asterisk.

 
A slow migrating complex was found to bind the ISRE probes of HLA-B, HLA-C, and HLA-G. The ISRE regions of these loci share CG-rich sequences that are potential Sp1 binding sites (see Table IGo). The slow migrating complex binding to the ISRE of HLA-B, HLA-C, and HLA-G was shown to contain Sp1 in supershift assays (Fig. 5Go). Although the ISRE probes of HLA-A and HLA-F also contain CG-rich sequences, no Sp1 binding was detected (Fig. 5Go and data not shown).

Functional role of the USF and Sp1 binding sites flanking the ISRE

The constitutive binding of USF-1 and USF-2 to the E box flanking the ISRE of most HLA-B alleles did not influence the IFN-{gamma}-induced transactivation of these alleles (see also Fig. 1Go). To further test whether the E box contributed to the constitutive transcriptional activity, transient transfection assays were performed in MHC class I-expressing cell lines. The basal level of transcription was reduced in the reporter construct containing the E box (ISRE-BE) as compared with that of ISRE-B/C in Tera-2, HeLa, as well as B cells (Fig. 6Go). This implies that the constitutive binding of USFs to the E box (flanking the ISRE in most HLA-B loci) inhibits the basal level of transcription.



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. USF binding to the E box reduces the basal level of transactivation of HLA-B. Transient transfection assay comparing the relative level of transactivation through the ISRE of HLA-B containing the E box (ISRE-BE) and that of HLA-B and HLA-C loci lacking the E box (ISRE-B/C) in Tera-2, HeLa, and B cells. The luciferase activity values were normalized with the Renilla luciferase activity and are expressed relative to the activity of pGL3-ISRE-B/C (100%) as mean ± SD of n = 4.

 
The reporter constructs used in Fig. 1Go do not contain the directly flanking Sp1 binding site. To evaluate the role of this site in the IFN-{gamma}-induced transactivation of MHC class I, an additional HLA-B7 promoter construct containing the Sp1 site was tested (Fig. 7Go). The results of this analysis showed that the Sp1 site does not play a significant role in the basal or IFN-{gamma}-induced transcription of HLA class I (cf B190 and B180; Fig. 7Go).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 7. Sp1 does not play an important role in the constitutive or IFN-{gamma}-induced transactivation of MHC class I. Transient transfection assay of HLA-B7 promoter driven reporter constructs containing or lacking the flanking Sp1 site in Tera-2 cells either untreated or IFN-{gamma}-treated (500 U/ml; 48 h). Note that pGL3-B180 (B180) is identical in sequence to pGL3-ISRE-B/C (ISRE-B/C; Figs. 1Go and 6Go). Luciferase values were normalized with the Renilla luciferase activity and are expressed as mean ± SD of n = 4.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The ISREs of all classical HLA class I genes mediate IFN-{gamma}-induced transactivation; among the nonclassical HLA class I molecules, only the ISRE of HLA-F mediates IFN-{gamma} induction. This is congruent with the binding of IRF-1 to the ISRE of these loci upon IFN-{gamma} stimulation. Upon IFN-{gamma} stimulation, IRF-1 replaces IRF-2 and becomes the predominant factor occupying the ISRE (29). Thus, IRF-1 is the principal factor mediating the IFN-{gamma}-induced expression of MHC class I (13, 30, 31) (Fig. 8Go). Transactivation through the ISRE of HLA-A was ~2-fold weaker than that of the other loci (this study, and Refs. 13, 19), which is consistent with the weaker binding affinity for IRF-1 to the ISRE of the HLA-A locus (13). In contrast, others have reported that the ISRE of the A locus (linked to a heterologous promoter) was not responsive to IFN-{gamma} and that the ISRE of HLA-B binds a factor other than IRF-1, p48, or Stat1 (23). The ISRE of HLA-E did not mediate IFN-{gamma}-induced transactivation in our assays, correlating with the lack of significant IRF-1 binding (this study; Fig. 8Go). However, using reporter constructs containing the entire HLA-E promoter in transient transfection assays, it was demonstrated that HLA-E is induced by IFN-{gamma} (Ref. 32 , and S. Gobin et al., unpublished observations). Gustafson et al. (32) have identified upstream sequences in the HLA-E promoter that mediate this IFN-{gamma}-induced expression of HLA-E. This region consists of two Stat1 binding sites of which the downstream site overlaps with the ISRE region. However, it is predominantly the 5' GAS element that binds Stat1 and mediates IFN-{gamma}-induced transactivation of HLA-E (Ref. 32 , and Fig. 8Go). No IFN-{gamma}-induced transactivation was observed through the ISRE of HLA-G. Transient transfection assays using reporter constructs containing the 1.5-kb promoter region of HLA-G confirmed the lack of IFN-{gamma}-induced transactivation of this locus, despite the presence of a potential IRF-1 binding site further upstream in the promoter (33).



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 8. Schematic representation of transcription factors binding to the ISRE region in classical and nonclassical HLA class I genes. The ISREs of HLA-A, HLA-B, HLA-C, and HLA-F bind IRF-1 upon IFN-{gamma} treatment and mediate the IFN-{gamma}-induced transactivation of these loci. The putative ISRE of HLA-E did not mediate IFN-{gamma}-induced transactivation. However, HLA-E is resposive to IFN-{gamma} through Stat1 activation and binding to an upstream GAS element (32 ). No significant binding of IRF-1 or Stat1 was found to the ISRE of HLA-E (this study, and Ref. 32 ). HLA-G lacks an ISRE and is not responsive to IFN-{gamma}. In addition, several constitutive transcription factors were shown to bind to the ISRE region. Sp1 binds to the CG-rich sequences in the ISRE regions of HLA-B, HLA-C, and HLA-G. The putative E box 5' of the ISRE in most HLA-B alleles (see Table IGo) is bound by USF-1 and USF-2. These constitutive factors did not influence IFN-{gamma}-induced transactivation. IFN-{gamma}-inducible transcription factors (IRF-1, Stat1) are in grey; constitutively expressed factors (Sp1, USFs) are in white.

 
Several other transcription factors were found to bind the ISRE region (Fig. 8Go). The E box flanking the ISRE of most HLA-B alleles (see Table IGo) was shown to bind USF-1 and USF-2 (this study, and Ref. 34). Since both proteins are present in the DNA/protein complexes, USF-1 and USF-2 could bind as a heterodimer to the E box in HLA-B (35, 36). The binding of other E box binding proteins, such as c-Myc (28), was not detected in our assays. USF binding in HLA-B did not influence the IFN-{gamma}-induced transactivation, indicating that IRF-1 binding is not hindered by occupancy of the E box. However, the presence of the E box reduced the basal level of MHC class I transactivation, suggesting that USF-1 and USF-2 are inhibitors of constitutive MHC class I transcription.

Sp1, another constitutively expressed factor, was shown to bind to the ISRE regions of HLA-B, HLA-C, and HLA-G, in which the CG-rich sequences are most probably the target binding site for Sp1 (34, 37) (Fig. 8Go). Sp1 is known to play a role in the basal transcriptional activity (38). However, the Sp1 site was not crucial for constitutive or IFN-{gamma}-induced transactivation through the ISRE, since lack of the Sp1 sequences did not reduce the constitutive or IFN-{gamma}-induced transactivation (this study). Thus, no evidence was found for an important role of this flanking Sp1 site in constitutive or IFN-{gamma}-induced MHC class I transactivation.

In this study, it is shown that variation in the nucleotide sequence of the ISRE and its immediately flanking sites of the different HLA class I loci determines the binding of transactivators of the IRF family of proteins and other transcription factors (Fig. 8Go). Consequently, this results in differences in IFN-{gamma} inducibility and basal levels of gene transcription. Therefore, locus-specific variations in the nucleotide sequences of the ISRE of HLA class I genes contribute to the differential constitutive and IFN-{gamma}-mediated transactivation of HLA class I loci. Locus-specific transcriptional control through the ISRE could be an important mechanism that determines adequate Ag presentation upon pathogenic challenge.


    Acknowledgments
 
We thank Drs. I. Doxiadis and B. Roep for critically reading the manuscript.


    Footnotes
 
1 This work was supported in part by the Netherlands Organization for Research (NWO Grant no. 901-09-200) and the Netherlands Foundation for the Support of Multiple Sclerosis Research (Grant no. 96-248 MS). Back

2 Address correspondence and reprint requests to Dr. Sam J. P. Gobin, Department of Immunohematology and Blood Bank, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands. E-mail address: Back

3 Current address: Department of Nephrology, Leiden University Medical Center, Leiden, The Netherlands. Back

4 Abbreviations used in this paper: GAS, IFN-{gamma} activation site; IRF, IFN regulatory factor; ISRE, IFN-stimulated response element; USF, upstream stimulatory factor. Back

Received for publication February 26, 1999. Accepted for publication May 13, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. De Maeyer, E., J. De Maeyer-Guignard. 1992. Interferon-{gamma}. Curr. Opin. Immunol. 4:321.[Medline]
  2. Boehm, U., T. Klamp, M. Groot, J. C. Howard. 1997. Cellular responses to interferon-{gamma}. Annu. Rev. Immunol. 15:749.[Medline]
  3. Schindler, C., J. E. Darnell. 1995. Transcriptional responses to polypeptide ligands: the JAK-STAT pathway. Annu. Rev. Biochem. 64:621.[Medline]
  4. Bach, E. A., M. Aguet, R. D. Schreiber. 1997. The IFN{gamma} receptor: a paradigm for cytokine receptor signaling. Annu. Rev. Immunol. 15:563.[Medline]
  5. Darnell, J. E., I. M. Kerr, G. R. Stark. 1994. Jak-STAT pathways and transcriptional activation in response to IFNs and other extracellular signaling proteins. Science 264:1415.[Abstract/Free Full Text]
  6. Bluyssen, H. A. R., R. Muzaffar, R. J. Vliestra, A. C. J. van der Made, S. Leung, G. R. Stark, I. M. Kerr, J. Trapman, D. E. Levy. 1995. Combinatorial association and abundance of components of interferon-stimulated gene factor 3 dictate the selectivity of interferon responses. Proc. Natl. Acad. Sci. USA 92:5645.[Abstract/Free Full Text]
  7. Germain, R. N.. 1994. MHC-dependent antigen processing and peptide presentation: providing ligands for T lymphocyte activation. Cell 76:287.[Medline]
  8. Singer, D. S., J. E. Maguire. 1990. Regulation of the expression of class I MHC genes. Crit. Rev. Immunol. 10:235.[Medline]
  9. Le Bouteiller, P.. 1994. HLA class I chromosomal region, genes, and products: facts and questions. Crit. Rev. Immunol. 14:89.[Medline]
  10. Le Bouteiller, P., F. Lenfant. 1996. Antigen-presenting function(s) of the non-classical HLA-E, -F, -G class I molecules: the beginning of a story. Res. Immunol. 147:301.[Medline]
  11. Schmidt, H., V. Gekeler, H. Haas, G. Engler-Blum, I. Steiert, H. Probst, C. A. Müller. 1990. Differential regulation of HLA class I genes by interferon. Immunogenetics 31:245.[Medline]
  12. Hakem, R., P. Le Bouteiller, A. Jezo-Bremond, K. Harper, D. Campese, F. A. Lemonnier. 1991. Differential regulation of HLA-A3 and HLA-B7 MHC class I genes by IFN is due to two nucleotide differences in their IFN response sequences. J. Immunol. 147:2384.[Abstract]
  13. Girdlestone, J., M. Isamat, D. Gewert, C. Milstein. 1993. Transcriptional regulation of HLA-A and -B: differential binding of members of the Rel and IRF families of transcription factors. Proc. Natl. Acad. Sci. USA 90:11568.[Abstract/Free Full Text]
  14. Salter-Cid, L., M. F. Flajnik. 1995. Evolution and developmental regulation of the major histocompatibility complex. Crit. Rev. Immunol. 15:31.[Medline]
  15. Vallejo, A. N., L. R. Pease. 1995. Evolution of class I promoter sequences: relationship to function and diversity. Immunol. Rev. 143:249.[Medline]
  16. Van den Elsen, P. J., S. J. P. Gobin, M. C. J. A. van Eggermond, A. Peijnenburg. 1998. Regulation of MHC class I and II gene transcription: differences and similarities. Immunogenetics 48:208.[Medline]
  17. Gobin, S. J. P., V. Keijsers, M. van Zutphen, P. J. van den Elsen. 1998. The role of enhancer A in the locus-specific transactivation of classical and nonclassical HLA class I genes by nuclear factor {kappa}B. J. Immunol. 161:2276.[Abstract/Free Full Text]
  18. Mansky, P., W. M. Brown, J.-H. Park, J. W. Choi, S. Y. Yang. 1994. The second {kappa}B element, {kappa}B2, of the HLA-A class I regulatory complex is an essential part of the promoter. J. Immunol. 153:5082.[Abstract]
  19. Johnson, D. R., J. S. Pober. 1994. HLA class I heavy-chain gene promoter elements mediating synergy between tumor necrosis factor and interferons. Mol. Cell. Biol. 14:1322.[Abstract/Free Full Text]
  20. Gobin, S. J. P., A. Peijnenburg, V. Keijsers, P. J. van den Elsen. 1997. Site {alpha} is crucial for two routes of IFN-{gamma} induced MHC class I transactivation: the ISRE-mediated route and a novel pathway involving CIITA. Immunity 6:601.[Medline]
  21. Martin, B. K., K.-C. Chin, J. C. Olsen, C. A. Skinner, A. Dey, K. Ozato, J. P.-Y. Ting. 1997. Induction of MHC class I expression by the MHC class II transactivator CIITA. Immunity 6:591.[Medline]
  22. Gobin, S. J. P., A. Peijnenburg, M. van Eggermond, M. van Zutphen, R. van den Berg, P. J. van den Elsen. 1998. The RFX complex is crucial for the constitutive and CIITA-mediated transactivation of MHC class I and {beta}2-microglobulin genes. Immunity 9:531.[Medline]
  23. Vallejo, A. N., L. R. Pease. 1996. The locus-specific enhancer activity of the class I major histocompatibility complex interferon-responsive element is associated with a {gamma}-interferon (IFN)-inducible factor distinct from STAT1{alpha}, p48, and IFN regulatory factor-1. J. Biol. Chem. 271:29813.[Abstract/Free Full Text]
  24. Gobin, S. J. P., V. Keijsers, A. M. Woltman, A. Peijnenburg, L. Wilson, P. J. van den Elsen. 1997. Locus-specific regulation of HLA class I gene expression. eds. In Genetic Diversity of HLA: Functional and Medical Implications Vol. 2:295. EDK, Paris.
  25. Chen, C., H. Okayama. 1987. High-efficiency transformation of mammalian cells by plasmid DNA. Mol. Cell. Biol. 7:2745.[Abstract/Free Full Text]
  26. Harada, H., E.-I. Takahashi, S. Itoh, K. Harada, T.-A. Hori, T. Taniguchi. 1994. Structure and regulation of the human interferon regulatory factor 1 (IRF-1) and IRF-2 genes: implications for a gene network in the interferon system. Mol. Cell. Biol. 14:1500.[Abstract/Free Full Text]
  27. Sawadogo, M., R. G. Roeder. 1985. Interaction of a gene-specific transcription factor with the adenovirus major late promoter upstream of the TATA box region. Cell 43:165.[Medline]
  28. Amati, B., H. Land. 1994. Myc-Max-Mad: a transcription factor network controlling cell cycle progression, differentiation and death. Curr. Opin. Genet. Dev. 4:102.[Medline]
  29. Harada, H., T. Fujita, M. Miyamoto, Y. Kimura, M. Maruyama, A. Furia, T. Miyata, T. Taniguchi. 1989. Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58:729.[Medline]
  30. Chang, C. H., J. Hammer, J. E. Loh, W. L. Fodor, R. A. Flavel. 1992. The activation of major histocompatibility complex class I genes by interferon regulatory factor-1 (IRF-1). Immunogenetics 35:378.[Medline]
  31. Hobart, M., V. Ramassar, N. Goes, J. Urmson, P. F. Halloran. 1997. IFN regulatory factor-1 plays a central role in the regulation of class I and II MHC genes in vivo. J. Immunol. 158:4260.[Abstract]
  32. Gustafson, K. S., G. D. Ginder. 1996. Interferon-{gamma} induction of the human leukocyte antigen-E gene is mediated through binding of a complex containing STAT1{alpha} to a distinct interferon-{gamma}-response element. J. Biol. Chem. 271:20035.[Abstract/Free Full Text]
  33. Gobin, S. J. P., P. J. van den Elsen. 1999. The regulation of HLA class I expression: is HLA-G the odd one out?. Semin. Cancer Biol. 9:55.[Medline]
  34. Girdlestone, J.. 1993. An HLA-B regulatory element binds a factor immunologically related to the upstream stimulating factor. Immunogenetics 38:430.[Medline]
  35. Sirito, M., Q. Lin, T. Maity, M. Sawadogo. 1994. Ubiquitous expression of the 43- and 44-kDa forms of transcription factor USF in mammalian cells. Nucleic Acids Res. 22:427.[Abstract/Free Full Text]
  36. Sirito, M., S. Walker, Q. Lin, M. T. Kozlow, W. H. Klein, M. Sawadogo. 1992. Members of the USF family of helix-loop-helix proteins bind DNA as homo- as well as heterodimers. Gene Expression 2:231.[Medline]
  37. Berg, J. M.. 1992. Sp1 and the subfamily of zinc finger proteins with guanidine-rich binding sites. Proc. Natl. Acad. Sci. USA 89:11109.[Free Full Text]
  38. Lania, L., B. Majello, P. De Luca. 1997. Transcriptional regulation by the Sp family of proteins. Int. J. Biochem. Cell Biol. 29:1313.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
X. Liu, L. Ye, Y. Bai, H. Mojidi, N. E. Simister, and X. Zhu
Activation of the JAK/STAT-1 Signaling Pathway by IFN-{gamma} Can Down-Regulate Functional Expression of the MHC Class I-Related Neonatal Fc Receptor for IgG
J. Immunol., July 1, 2008; 181(1): 449 - 463.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. M. Doody, S. Stephenson, C. McManamy, and R. M. Tooze
PRDM1/BLIMP-1 Modulates IFN-{gamma}-Dependent Control of the MHC Class I Antigen-Processing and Peptide-Loading Pathway
J. Immunol., December 1, 2007; 179(11): 7614 - 7623.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. Christova, T. Jones, P.-J. Wu, A. Bolzer, A. P. Costa-Pereira, D. Watling, I. M. Kerr, and D. Sheer
P-STAT1 mediates higher-order chromatin remodelling of the human MHC in response to IFN{gamma}
J. Cell Sci., September 15, 2007; 120(18): 3262 - 3270.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
E. Sekimoto, S. Ozaki, T. Ohshima, H. Shibata, T. Hashimoto, M. Abe, N. Kimura, K. Hattori, S. Kawai, Y. Kinoshita, et al.
A Single-Chain Fv Diabody against Human Leukocyte Antigen-A Molecules Specifically Induces Myeloma Cell Death in the Bone Marrow Environment
Cancer Res., February 1, 2007; 67(3): 1184 - 1192.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. K. Browne, J. R. Roesser, S. Z. Zhu, and G. D. Ginder
Differential IFN-{gamma} Stimulation of HLA-A Gene Expression through CRM-1-Dependent Nuclear RNA Export
J. Immunol., December 15, 2006; 177(12): 8612 - 8619.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. A. Moon, S. M. Veniamin, J. A. Parks-Dely, and K. E. Magor
The MHC of the Duck (Anas platyrhynchos) Contains Five Differentially Expressed Class I Genes
J. Immunol., November 15, 2005; 175(10): 6702 - 6712.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. D. Rempel, L. A. Quina, P. K. Blakely-Gonzales, M. J. Buchmeier, and D. L. Gruol
Viral Induction of Central Nervous System Innate Immune Responses
J. Virol., April 1, 2005; 79(7): 4369 - 4381.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. K. Howcroft, J. D. Weissman, A. Gegonne, and D. S. Singer
A T Lymphocyte-Specific Transcription Complex Containing RUNX1 Activates MHC Class I Expression
J. Immunol., February 15, 2005; 174(4): 2106 - 2115.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. J. P. Gobin, P. Biesta, and P. J. Van den Elsen
Regulation of human beta 2-microglobulin transactivation in hematopoietic cells
Blood, April 15, 2003; 101(8): 3058 - 3064.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. R. Johnson
Locus-Specific Constitutive and Cytokine-Induced HLA Class I Gene Expression
J. Immunol., February 15, 2003; 170(4): 1894 - 1902.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
P. Moreau, G. Mouillot, P. Rousseau, C. Marcou, J. Dausset, and E. D. Carosella
HLA-G gene repression is reversed by demethylation
PNAS, February 4, 2003; 100(3): 1191 - 1196.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. P. Gobin, P. Biesta, J. E. M. de Steenwinkel, G. Datema, and P. J. Van den Elsen
HLA-G Transactivation by cAMP-response Element-binding Protein (CREB). AN ALTERNATIVE TRANSACTIVATION PATHWAY TO THE CONSERVED MAJOR HISTOCOMPATIBILITY COMPLEX (MHC) CLASS I REGULATORY ROUTES
J. Biol. Chem., October 11, 2002; 277(42): 39525 - 39531.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
D. Xu, D. Ye, M. Fisher, and R. L. Juliano
Selective Inhibition of P-glycoprotein Expression in Multidrug-Resistant Tumor Cells by a Designed Transcriptional Regulator
J. Pharmacol. Exp. Ther., September 1, 2002; 302(3): 963 - 971.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. J. P. Gobin, M. van Zutphen, S. D. Westerheide, J. M. Boss, and P. J. van den Elsen
The MHC-Specific Enhanceosome and Its Role in MHC Class I and {beta}2-Microglobulin Gene Transactivation
J. Immunol., November 1, 2001; 167(9): 5175 - 5184.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
K. E. Luker, C. M. Pica, R. D. Schreiber, and D. Piwnica-Worms
Overexpression of IRF9 Confers Resistance to Antimicrotubule Agents in Breast Cancer Cells
Cancer Res., September 1, 2001; 61(17): 6540 - 6547.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Arons, V. Kunin, C. Schechter, and R. Ehrlich
Organization and Functional Analysis of the Mouse Transporter Associated with Antigen Processing 2 Promoter
J. Immunol., March 15, 2001; 166(6): 3942 - 3951.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. J. P. Gobin, P. J. van den Elsen, and J. Girdlestone
Locus-specific regulation of HLA-A and HLA-B expression is not determined by nucleotide variation in the X2 box promoter element
Blood, March 1, 2001; 97(5): 1518 - 1521.
[Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Lefebvre, S. Berrih-Aknin, F. Adrian, P. Moreau, S. Poea, L. Gourand, J. Dausset, E. D. Carosella, and P. Paul
A Specific Interferon (IFN)-stimulated Response Element of the Distal HLA-G Promoter Binds IFN-regulatory Factor 1 and Mediates Enhancement of This Nonclassical Class I Gene by IFN-beta
J. Biol. Chem., February 23, 2001; 276(9): 6133 - 6139.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available