| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
DNAX Research Institute, Palo Alto, CA 94304; and
Institut National de la Santé et de la Recherche Médicale Unit 343 Hôpital de l’Archet, Nice, France
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T
cells as the absolute number of thymic dendritic, TCR-
and NK1.1
T cells were equivalent to control littermates. Crossing IL-10
transgenic mice with TCR transgenic mice or treatment with
staphylococcal enterotoxin B showed that the defect was not related to
the impairment of positive or negative selection. However, repopulating
of IL-10 transgenic mouse-fetal thymic organ culture with different
stages of triple negative T cells isolated from control mice showed
that the blockage occurred specifically at the pre-T cell stage and was
reverted by treatment with blocking anti-IL-10 mAbs. These results
demonstrate that IL-10 regulates T cell maturation and that
dysregulation of IL-10 expression can lead to severe T cell
immunodeficiency. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
knockout (2, 3) mice show
abnormally low thymic cellularity, making IL-7 the first cytokine shown
to be necessary for normal intrathymic T cell development. However, the
effect of overexpression of immunoregulatory cytokines has never been
evaluated.
IL-10, originally described as a molecule that inhibits murine Th1 cell
cytokine synthesis (4), has also been shown to inhibit
Ag-specific activation and proliferation of T cell clones (5, 6). These inhibitory effects were indirect and mediated through
inhibition of the function of APCs (6, 7). IL-10 also
regulates constitutive and IFN-- or IL-4-induced class II MHC
expression on monocytes, dendritic cells, and Langerhans cells
(6, 44) and inhibits MHC class I expression by modulating
the expression of TAP (8). IL-10 also directly affects the
growth, differentiation, and function of T cells and thymocytes;
however, its effects are somehow diverse. IL-10, in the absence of
professional APCs, inhibits CD4+ T cell proliferation by
suppressing IL-2 and TNF- secretion (9). On the other
hand, IL-10 enhances the proliferative responses of murine thymocytes
(10) and IL-2- and IL-4-driven proliferation of murine
(11) and human (12) CD8+ T cells
in vitro.
SCID is a rare, fatal syndrome characterized by profound deficiencies
of T and B cell functions (13). The genetic origins of
this condition are quite diverse. Recent progress in identifying the
molecular bases of some forms of SCID has led to the discovery of
SCID-causing mutations in genes encoding adenosine deaminase
(14), the common chain of the IL-2, -4, -7, -9, and
-15 receptor (c) (15), and Janus kinase 3
(16, 17), the primary intracellular signal transducer from
c. However, 22–41% of these patients are still
classified as autosomal recessive SCID with unknown primary biological
errors. Despite the different causes, there are features common
to all types of SCID. All have few or no T cells, but a majority have a
relative increase of B cells. However, SCID patients with
c or Jak3 mutations also have abnormally low NK cells,
whereas patients with other autosomal recessive mutations have normal
NK function suggesting that some molecular lesions affect T and NK
cells (c and Jak3), whereas others affect primarily T
cells (18).
Recently, it has been shown in the mouse model that the induction of tolerance in vivo of both CD4+ and CD8+ T cells resulted in the differentiation of cells with high IL-10 secretion and low proliferative response (19). We already described similar T cells in SCID patients successfully transplanted with fetal hemopoietic stem cells derived from HLA-mismatched donors (20). These T cells displayed a low proliferative capacity and produced low levels of IL-2 but high levels of IL-10 after stimulation with host Ag. In addition to the donor-derived T cells, freshly isolated monocytes of host origin constitutively produced high concentrations of IL-10 in vivo (20). Moreover, we recently demonstrated that IL-10 induces Ag-specific long term anergy in CD4+ T cells but also induces the differentiation of a new subset of regulatory T cells (Tr1) which secreted high concentrations of IL-10 (21). Although it was still too early to draw firm conclusions, it was tempting to speculate that the high concentrations of endogenous IL-10 production observed in successfully transplanted SCID patients would contribute to the tolerance achieved. To address this question, we generated IL-10 transgenic mice (IL-10-Tg mice)6 in which the human IL-10 cDNA was expressed under the control of the Ea HLA class II promoter, thus driving the expression of the transgene in HLA class II+ cells. Surprisingly, in these IL-10-Tg mice, in contrast to other constructs, where the IL-10 transgene was expressed in T cells (22), we observed a dramatic and specific blockage in T cell maturation that closely resembles the phenotype of some autosomal recessive SCID patients.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The generation and screening of IL-10-Tg mice on a BALB/c
background have been described previously (23). Mice
expressing the transgenic TCR- reactive with male-specific Ag HY
(H-2b) (27), provided by J. DiSanto (Institut
National de la Santé et de la Recherche Médicale Unit 429,
Paris, France), and mice transgenic for the D011-10 TCR-
(OVA-specific TCR) (28), provided by A. O’Garra (DNAX),
were used to generate hybrid F1 (IL-10-Tg x HY-Tg)
mice and (IL-10-Tg x OVA-Tg) mice, respectively. Animals were
housed in DNAX animal facility and analyzed at 4–6 wk of age unless
otherwise specified.
Antibodies
All Abs were purchased from PharMingen (San Diego, CA) unless otherwise specified. For isolation of thymic precursor T cells, the following Abs were used: anti-CD3-biotin (clone 144-2C11), anti-CD4-biotin (clone RM4-5), anti-CD8-biotin (clone 53-6.7), anti-B220-biotin (clone RA3-6B2), anti-Mac-1-biotin (clone M1/70), anti-Gr-1-biotin (clone RB6-8C5), TER-119-biotin (clone TER-119), anti-CD25-FITC (clone 7D4), anti-CD44-PE (clone IM7), and streptavidin-TriColor (Caltag Laboratories, South San Francisco, CA).
For the phenotypic analysis, the following Abs were used:
anti-TCR--FITC (clone H57-597), anti-TCR--FITC (clone GL3),
anti-V8.1, 8.2 TCR-FITC (clone MR5-2), anti-CD4-TriColor (clone YTS
191.1, Caltag), anti-CD8-PE (clone 53-6.7), anti-CD24-PE (heat stable
Ag; clone M1/69), Ly-49C-FITC (clone 5E6), and KJ1-26-FITC (specific
for the OVA-Tg clonotype TCR (37) provided by A.
O’Garra). All phenotypic analysis were performed on a FACScan
cytometer using CellQuest software (Becton Dickinson, San Jose,
CA).
In fetal thymic organ culture (FTOC), 9D7, an anti-human IL-10 mAb (generated at DNAX), was used as blocking Ab.
Sorting and multiparameter analysis
The identification and isolation of pro-T (CD44+CD25+Lin-), pre-T (CD44-CD25+Lin-) and post-pre-T (CD44-CD25-Lin-) cells has been previously described (38, 39). Briefly, thymocytes from BALB/c mice were depleted of CD4+ and CD8+ cells by incubation with anti-CD8 (clone AD4, Cedarlane Laboratories, Hornby, Canada) and anti-CD4 (clone GL172, used as culture supernatant, generated at DNAX) Abs, followed by treatment with low toxicity M rabbit complement (Cedarlane) and 20 µg/ml DNase I (Sigma, St. Louis, MO). Viable cells were isolated with Histopaque 1083 (Sigma) and then stained as follows. A panel of lineage Abs was directed against CD3, CD4, CD8, B220, Mac-1, Gr-1, TER-119 (all biotinylated), anti-CD25-FITC, and anti-CD44-PE, followed by streptavidin TriColor (Caltag). Pro-T, pre-T, and post-pre-T cells were sorted through Lin-CD25+CD44+, Lin-CD25+CD44-, and Lin-CD25-CD44- combination gates, respectively, using a FACStarPlus or FACS Vantage flow cytometer (Becton Dickinson). Sort purities were routinely >98%.
Fetal thymic organ cultures
Fetal thymic organ cultures were performed, as previously described (40, 41), utilizing timed pregnant IL-10-Tg and wild-type littermates. The presence of a vaginal plug was termed day 0. On gestational day 15, the pregnant mothers were killed, and fetuses were removed. IL-10-Tg and wild-type fetal thymic lobes were harvested using standard techniques and depleted of endogenous T cell progenitors by culturing in FTOC medium containing 1.35 mM deoxyguanosine for 5 days as described (42). Depleted lobes were then individually plated with 1 x 103 pro-T cells or 1 x 104 pre- or post-pre-T cells, from nontransgenic BALB/c mice, in a 30-µl volume in Terasaki plates (Nunc, Kamstrup, Denmark). Plates were then inverted to allow lobes and cells to combine at the bottom of a hanging drop (40). After 24–48 h, recolonized lobes were transferred back into FTOC for 10–28 days, being refed with FTOC medium every 6 days. In some experiments, the anti-human IL-10 9D7 Ab was added at the beginning of the culture at a blocking concentration of 5 µg/ml. At the indicated time points, lobes were gently pressed under a glass coverslip in 100 µl PBS containing 2% FCS to release thymocytes. Thymocytes were then phenotyped as described above.
Staphylococcal enterotoxin B (SEB) injection experiments
IL-10-Tg and wild-type newborn mice were injected i.p. every 2
days with SEB (Toxin Technology, Sarasota, FL) at a concentration
ranging from 2 µg/mouse on day 0 to 35 µg/mouse on day 18. Thymi
were removed on day 20, and thymocytes were phenotypically analyzed for
the expression of the V8.1, 8.2 chains of the TCR on CD4/CD8
double-positive (DP), and CD4 and CD8 single-positive cells.
In situ RT-PCR
In situ PCR was performed as previously described (43). In brief, tissue sections (5 µm) were fixed with 10% buffered formalin for 2 min, washed, and treated with proteinase K (2 µg/ml) for 5 min at 20°C. Protease digestion was stopped by eating at 95°C for 2 min, and the slides were dehydrated in graded ethanol. After air drying, sections were treated with DNase for 10 h at 37°C, rinsed, dried, and incubated with 50 µl RT-PCR mix (1x EZ buffer: 5 mM Mn(OAc)2, 200 µM each dNTP, 5 mM digoxigenin-11-dUTP, 1.2 U/µl RNAsin, 400 µg/ml BSA, 1 µM each primer, and 250 U/ml rTth DNA polymerase) in the GeneAmp program in situ PCR system 1000 (PE Applied Biosystems, Foster City, CA). Digoxigenin was detected by specific Abs and revealed by an alkaline phosphatase substrate (Fast Red TR salt, Sigma). Slides were counterstained with Mayer’s hematoxylin solution. Target-specific primers for human IL-10 were: sense, ATGCACAGCTCAGCACTGCTCTGTT; anti-sense, TCAGTTTCGTATCTTCATTGTCATGTA. Control primers: sense, GGAAACAGAAAGTACAGAAAGTAG; anti-sense, AGACTAGGTCCCTAGAATCGATTGCC.
Histology and tissue immunostaining
Thymic tissues freshly removed from IL-10-tg and wild-type mice were embedded in Tissue-Tek OCT compound (Miles, Elkhart, IN) and frozen. For histological analysis, 6-µm cryostat sections of specimens were fixed in 10% buffered formaldehyde and stained with hematoxylin and eosin.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Although the number of thymocytes in newborn IL-10-Tg mice was
roughly equivalent to the one of normal control littermate mice,
IL-10-Tg mice presented a dramatic reduction in single-positive T cells
at birth followed by a dramatic decrease in the total thymocyte numbers
at 4 wk of age and a nearly complete aplasia after 7–8 wk (Fig. 1
a). Thymuses from these
animals were undersized and presented a dysplastic pattern with rare
cortical zone, no clear corticomedullary demarcation, and scattered
medullary thymocytes (Fig. 1b). This defect was not due to
stress induced by chronic infections in that all mice tested were
healthy and of normal size and weight compared to wild-type BALB/c
mice.
|
). Consistent with the observed changes
in the fractional representation of CD4+CD8+
and CD4-CD8- cells, there was a relative
decrease in the percentage of cells expressing intermediate levels of
TCR and an increase in cells expressing low TCR concentrations (not
shown). However, significant numbers of mature peripheral T cells (75%
of normal T cell number in mice 6–8 wk of age) were observed
(23), suggesting that the small numbers of
CD4+CD8- and CD4-CD8+
T cells produced in the thymus accumulate over time in peripheral
tissues.
|
or NK T
cell differentiation in IL-10-Tg mice
We confirmed by in situ RT-PCR that the human IL-10 transgene
directed by the Ea (I-E) promoter (24) was strictly
expressed by thymic stroma cells and not by thymocytes (Fig. 3). To analyze the earliest branch point
in the T cell differentiation pathway, we examined wild-type and
IL-10-Tg thymocytes for the presence of thymic dendritic APCs that
express class II and CD11c. No abnormality were observed since, after
lineage depletion, thymics APCs (CD11c/class IIint:high)
were highly enriched (50%) in both wild-type and IL-10-Tg mice (Table I).
|
|
T cells and NK cells in wild-type and IL-10-Tg
mice was evaluated using an Ab to the T cell receptor and the
Ly-49 Ag, respectively. Equivalent absolute numbers of T cells
or NK cells expressing Ly-49, which also arose from early branch points
in thymocyte maturation, were observed in IL-10-Tg mice compared with
wild-type littermates (Table I
).
The NK1.1 Ag defines a subset of T cells that produce high titers of
cytokines and express a restricted repertoire of T cell receptors
(25). Controversy surrounds the origin of NK1.1 T cells,
and it is thought that they can be of both thymic and extrathymic
origin. BALB/c mice lack the NK1.1 marker; thus, we estimated the
number of NK1.1 T cells in the thymus based on their restricted V8
TCR expression and their memory T cell-like phenotype with low
concentrations of CD24. Analysis of the absolute number of
V8+/CD24- cell thymocytes between IL-10-Tg
and control littermates reveals no differences, confirming that NK1.1 T
cells originate from a different pathway than conventional
TCR-+ T cells (Table I). Overall, these data
suggest that only the pathway leading to conventional TCR- T
cells is impaired in IL-10-Tg mice.
No defect in CD8+ T cell selection in IL-10-Tg mice
The normal development of T cells on the thymus requires both positive and negative selection. During positive selection, thymocytes mature only if their TCR reacts with some specificity to host MHC and host peptides. During negative selection, thymocytes die if their TCRs react with too high an affinity to the presenting cells to which they are exposed. Since IL-10 directly down-regulates MHC class II (26) and the cell surface expression of MHC class I expression by specifically inhibiting TAP expression (8), we analyzed the positive and negative selection processes in IL-10-Tg mice.
To determine whether IL-10 could influence CD8+ T cell
selection, we crossed IL-10-Tg mice with transgenic mice bearing a
TCR- specific for HY Ag (27). In male HY mice on the
selecting H-2b background, most thymocytes undergo strong
negative selection by virtue of interactions between the transgenic TCR
and the cognate male-specific peptide. As a result, thymi are small and
are comprised mostly of immature cells that fail to progress past the
CD4+CD8+ DP stage (Fig. 4a). Male IL-10-Tg/HY mice
demonstrate markedly reduced thymic cellularity in comparison with HY
males with an even more reduced level of
CD4+CD8+ DP cells (Fig. 4a). Thus,
IL-10 does not inhibit intrathymic CD8+ T cell negative
selection, although it clearly blocks the passage to the
CD4+CD8+ DP stage.
|
TT thymocytes occurs in the absence
of male Ag (27). Similar positive selection was observed
in IL-10-Tg/HY mice with yet a higher percentage of
CD4-CD8- double-negative (DN) thymocytes,
showing that IL-10 has no effect on CD8+ T cell positive
selection (Fig. 4b) and that the blockage at the
CD4-CD8- DN stage does not seems to be due to
the down-regulation of MHC class I expression. Normal CD4+ T cell selection in IL-10-Tg mice
To determine the effect of IL-10 in negative selection of
CD4+ T cells, SEB was injected i.p. into IL-10-Tg or
control littermates neonatal mice, and V TCR usage by mature
CD4+ T cells was analyzed. SEB treatment of neonatal
I-Ad-positive mice results in thymic depletion of
V8+CD4+ T cells through clonal deletion.
Thus, 14–16% of the CD4+ thymic T cells in both IL-10-Tg
and wild-type control treated with PBS use a V8-reactive TCR (Fig. 5a), and SEB injection into
both wild type and IL-10 Tg resulted in a reduction of V8-reactive
cells to 2–4% of mature CD4+ thymic T cells (Fig. 5a), suggesting that IL-10 expression by thymic dendritic
cells has no effect on negative selection.
|
b), suggesting that
IL-10 has no influence on positive selection of thymocytes. However,
thymus from IL-10/DO11-10 double-transgenic mice were smaller than
those of control littermates. Moreover, a block at the
CD4-CD8- DN stage is clearly evident in
IL-10/DO11-10 double transgenic mice (Fig. 5b),
suggesting that IL-10 expression by thymic dendritic cells provokes a
specific blockage at an early stage of thymic maturation. IL-10 expressed by thymic stroma cells induces a specific block at the pre-T cell stage
We next examined the effect of IL-10 overexpression by thymic
stroma cells in fetal thymic organ culture supporting a full program of
T cell development in vitro (Fig. 6). To
investigate this maturational inhibition, we repopulated IL-10-Tg fetal
lobes with sorted pro-T, pre-T, or post-pre-T precursor cells from
control BALB/c mice. In these cultures, expression of IL-10 by thymic
stroma cells blocked both pro-T and pre-T cell differentiation, whereas
the more mature post-pre-T cells differentiated normally (Fig. 6).
These results confirm that IL-10 signaling during thymocyte
differentiation causes stage-specific inhibition of precursor cell
maturation. In addition, repopulating studies of transgenic fetal lobes
with sorted wild-type thymocyte precursors in the presence of
anti-IL-10 mAb indicated that this effect was completely dependent
on IL-10 secretion and not due to a modification of stroma cells, given
that under these conditions a complete repopulating of thymic lobes was
observed with all three thymic precursor populations (Fig. 6).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
T cells was decreased, the maturation of
T cells, NK1.1+ T cells, and NK cells was normal
(18). This common phenotype suggests a common defect
focused on the mechanisms that lead to the differentiation of
TCR- T cells.
One of the main effects of IL-10 in regulating T cell responses is to
modulate the expression of HLA class I and class II molecules on APCs
(26). In the thymus, negative selection results in cell
death via apoptosis, a process initiated by interaction of the TCR with
a tolerogenic peptide-MHC complex. In male IL-10-Tg/HY mice
(27), negative selection of
TCR-TT thymocytes was not inhibited (Fig. 4). Moreover, V8+ T cells were equally deleted in the
thymus of IL-10-Tg or control newborn mice after injection of SEB (Fig. 5). These results argued against an inhibition of negative selection to
explain the defect of maturation observed in this model. The absence of
down-regulation of HLA class I and class II molecule expression on
thymic stroma cell was confirmed by a specific staining on frozen
tissue sections (not shown).
The role of IL-10 during intrathymic positive selection was analyzed in
female HY TCR mice for CD8+ T cells (27) and
in DO11-10 TCR mice for CD4+ T cells (28)
crossed with IL-10-Tg mice. Again no defect in positive selection was
observed (Figs. 4 and 5), suggesting that the defect observed in T cell
maturation was not due to an impairment of thymic stroma cells to
process and express HLA molecules on their cell surface but to an
earlier event leading to a block during the triple-negative stage,
because in all cases IL-10-Tg mice show a higher percentage of
triple-negative cells than the different control mice (Figs. 2, 4, and 5). However, the fact that only a minor decrease in the number of
single-positive thymocytes was observed at birth whereas thymic aplasia
occurs rapidly after birth could be explained by the slow kinetics of
MHC class II expression in the thymus; the thymic MHC level is not
detectable before gestation days 14–15 and slowly reaches adult level
1–2 wk after birth.
One of the earliest branch points in thymic development leads to the
development of NK cells and thymic dendritic cells or T cells. A
blockage in this differentiation pathway is exemplified in
IKAROS-/- mice, which lack both CD11c+
dendritic cells and NK cells (29). In contrast, the
absolute number of CD11c+ cells is comparable between
IL-10-Tg mice and littermate controls (Table I), suggesting that the
blockage resides at a later time point. A second branch point in the
development of fetal T cells leads to the differentiation of T
cells. Indeed, the expansion of lymphoid precursors in the normal fetal
thymus occurs in waves (30, 31). The first waves give rise
to TCR- T cells and to fetal thymocytes. These early
differentiations of thymic precursors are blocked in
IKAROS-/- mice (29) and in
c-/- (32) and
Jak3-/- mice (16, 33, 34). Therefore, the
thymus of these mutant mice is devoid of lymphocytes throughout fetal
life and for the first few days after birth. Moreover, these mutant
mice are devoid of TCR- T cells. In contrast, in IL-10-Tg mice,
as well as in some SCID patients, the size of the thymus is not
dramatically reduced at birth and NK cells as well as T cells
are observed in the peripheral blood (18), suggesting that
the blockage observed takes place at a more distal point in T cell
differentiation.
Fetal thymic organ cultures allowed us to determine precisely that the
blockage observed in IL-10-Tg mice was in between pre-T cells
(CD44+CD25-) and post-pre-T cells
(CD44-CD25-) stage. Indeed, the development
of thymic precursors in fetal lobes previously depleted from endogenous
T cells and repopulated with different sorted precursor populations was
blocked in the IL-10-Tg lobes only when these organs were repopulated
with pro- or pre-T cells (Fig. 6). Normal development of T cells occurs
in fetal organs collected from control BALB/c mice or in thymic lobes
from IL-10 transgenic seeded with post-pre-T cells (Fig. 6). Moreover,
these experiments showed that the blockage observed in IL-10-Tg mice
was not due to a change in the differentiation of thymic stroma cells
under the influence of IL-10 in vivo but to an immediate effect on T
cells, because the blockage was completely reverted by the addition of
anti-IL-10 Abs (Fig. 6). The defect observed in IL-10-Tg mice was
not due to a defect in stem cells, because pro-T cells isolated from
IL-10-Tg mice were able to normally repopulate fetal lobes isolated
from control wild-type BALB/c mice.
The effect of IL-10 could be directed either on T cells or on stroma
cells by inhibiting their secretion of growth factors. IL-7, a cytokine
secreted by stroma cells, has been shown to be a potent stimulus for
immature T cells (35). However, we ruled out the
possibility that IL-10 could act by inhibiting IL-7 secretion because
similar amounts of IL-7 mRNA were detected by RT-PCR in both thymic
stroma cells isolated from control BALB/c and IL-10-Tg fetal
thymuses (not shown), and also because the blockage observed in
IL-7-/- mice was shown to be at the pro-T cell stage that
results in the absence of T cells (36). IL-10 could
also act by increasing apoptosis induction, but no evidence of
increased cell death was observed in FOTC in pre-T cells treated in
vitro with IL-10 (not shown). Overall, these results suggest that IL-10
has a direct effect on pre-T cells by inhibiting their proliferative
capacities.
In two recent papers using IL-10-Tg mice, the authors did not find any significant peripheral T cell deficits in mice with constitutive or inducible expression of mouse IL-10, although they did not examine the thymus. It is possible that the differences observed are due to the heterologous expression of human IL-10, but it is more likely that the differences are due to the level of IL-10 expression or the pattern of IL-10 expression given that in both cases the mouse IL-10 was expressed in T cells.
Although the similarities between the phenotypes of IL-10-Tg mice and a subgroup of SCID patients with an unknown autosomal recessive defect are striking, it is difficult to deduce the mutated gene. One possible explanation of the common phenotype would be that in both cases it results from a blockage in the maturation of pre-T cells into post-pre-T cells. However, because of the high expression of IL-10 associated with this phenotype in the SCID patients (20), it is tempting to speculate that the observed defect in these patients might be due to an unregulated overexpression of IL-10. In this case, one had to speculate that the recessive defect affects an unknown protein aimed at regulating IL-10 secretion.
The lymphoid defect manifested in IL-10-Tg mice provides us with a unique insight into the complex regulation network that differentially controls lymphocyte differentiation in the fetal and adult hemopoietic system. The data shown here indicate that IL-10 has a specific inhibitory effect on the development of pre-T cells and that the phenotype associated with this blockage is similar to the one observed in a subgroup of human SCID patients with an unknown autosomal recessive defect.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Current address: Centre National de la Recherche scientifique UPR420, 7 rue Guy Moquet, 94801 Villejuif, France.
3 Current address: Novartis Forschunginstitut GmbH, Vienna A-1235, Austria.
4 Current address: Cellular Therapy Laboratory, Telethon Institute for Gene Therapy, Milan, 20132, Italy.
5 Address correspondence and reprint requests to Dr. Hervé Groux Institut National de la Santé et de la Recherche Médicale Unit 343, Hôpital de l’Archet, Route de St. Antoine de Ginestiere, 06000 Nice, France. E-mail address:
6 Abbreviations used in this paper: IL-10-Tg mice, IL-10 transgenic mice; DP, double-positive; DN, double-negative; FTOC, fetal thymic organ culture; SEB, staphylococcal enterotoxin B.
Received for publication December 11, 1998. Accepted for publication May 25, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
-chain mutation results in X-linked severe combined immunodeficiency in humans. Cell 73:147.[Medline]
transgenic mice. J. Exp. Med. 185:2101. peptide complexes at the plasma membrane of monocytes by affecting arrival and recycling. Immunity 7:861.[Medline]
/ T-cell development. Curr. Opin. Immunol. 5:241.[Medline]
/ cells. Annu. Rev. Immunol. 11:637.[Medline]
chain controls survival of / T cells. J. Exp. Med. 186:1277. T cell development and early thymocyte maturation in IL-7-/- mice. J. Immunol. 157:2366.[Abstract]
or by interleukin-10. Eur. J. Immunol. 25:394.[Medline]This article has been cited by other articles:
|
|
 |
|
  D. P. Calado, T. Paixao, D. Holmberg, and M. Haury Stochastic Monoallelic Expression of IL-10 in T Cells J. Immunol., October 15, 2006; 177(8): 5358 - 5364. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Resendes, N. Majo, J. Segales, E. Mateu, M. Calsamiglia, and M. Domingo Apoptosis in lymphoid organs of pigs naturally infected by porcine circovirus type 2 J. Gen. Virol., October 1, 2004; 85(10): 2837 - 2844. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Z. Guo, E. Kavanagh, Y. Zang, S. M. Dolan, S. J. Kriynovich, J. A. Mannick, and J. A. Lederer Burn Injury Promotes Antigen-Driven Th2-Type Responses In Vivo J. Immunol., October 15, 2003; 171(8): 3983 - 3990. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Darwich, S. Pie, A. Rovira, J. Segales, M. Domingo, I. P. Oswald, and E. Mateu Cytokine mRNA expression profiles in lymphoid tissues of pigs naturally affected by postweaning multisystemic wasting syndrome J. Gen. Virol., August 1, 2003; 84(8): 2117 - 2125. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Nakamori, M. Iwahashi, M. Nakamura, K. Ueda, X. Zhang, and H. Yamaue Intensification of Antitumor Effect by T Helper 1-dominant Adoptive Immunogene Therapy for Advanced Orthotopic Colon Cancer Clin. Cancer Res., June 1, 2003; 9(6): 2357 - 2365. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Mashino, N. Sadanaga, F. Tanaka, M. Ohta, H. Yamaguchi, and M. Mori Effective Strategy of Dendritic Cell-based Immunotherapy for Advanced Tumor-bearing Hosts: the Critical Role of Th1-dominant Immunity Mol. Cancer Ther., August 1, 2002; 1(10): 785 - 794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Cho, J. W. Youn, and Y. C. Sung Cross-Priming as a Predominant Mechanism for Inducing CD8+ T Cell Responses in Gene Gun DNA Immunization J. Immunol., November 15, 2001; 167(10): 5549 - 5557. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
) or SP (•) cells from IL-10-Tg or thymocytes (
) or
SP (
) cells from wild-type mice. Results are mean value for each
group of five animals. b, Thymic section from IL-10-Tg
(A–C) and wild-type littermates (WT) (B–D)
prepared at 4 wk of age were stained with hematoxylin and eosin.
A, B, Low power magnification (x65) of IL-10-Tg and
wild-type control littermate thymi, respectively. Note the absence of a
definable cortex and medulla in the transgenic thymus. C, D,
Higher magnifications (x340) of A and B,
respectively. The wild-type thymus clearly displays the cortical and
medullary regions. The transgenic thymus shows a uniform appearance
with scattered lymphocytes.
