|
|
||||||||

*
Gladstone Institute of Virology and Immunology, and
Departments of Medicine and Microbiology and Immunology, University of California, San Francisco, CA 94141
| Abstract |
|---|
|
|
|---|
,
suggesting that these cells have a signaling defect before activation
of the earliest caspases. These data demonstrate a durable and specific
resistance of human thymocytes to apoptosis induced through Fas
receptor engagement, and reveal significant species-specific
differences in the biology of thymocyte-programmed cell
death. | Introduction |
|---|
|
|
|---|
A role for Fas in early lymphocyte development is less well
characterized, though it is clear that Fas signaling in the periphery
frequently differs from that found in the central hematolymphoid
organs. Bone marrow hematopoietic progenitor cells are largely negative
for Fas surface expression (23, 24), but Fas may be
transiently expressed during the development of hematopoietic
precursors (25, 26). Exposure of
CD34+ hematopoetic progenitor cells to TNF-
or
IFN-
induces Fas expression followed by sensitivity to Fas-induced
apoptosis (23, 25, 27). The Fas-dependent apoptotic death
of progenitor cells has been cited as a possible pathogenetic mechanism
for aplastic anemia (27). In contrast to bone marrow
cells, thymocytes are reported to constitutively express abundant Fas
both in mouse (24, 28, 29) and human tissues (30, 31). Conflicting data have been reported, however, regarding the
pattern of Fas expression on different thymocyte subpopulations.
Fas-positive thymocytes in the mouse appear to be heterogenous in their
response to Fas ligation: all subpopulations of mouse thymocytes beyond
the double positive
(CD4+CD8+) stage express
equivalent amounts of Fas on the cell surface, but single positive
(CD4+CD8- and
CD4-CD8+) cells appear to
be relatively resistant to apoptosis induced by mAbs to Fas, while
double positive
CD4+CD8+ cells are readily
induced to apoptosis (29, 32).
It has been postulated that Fas may participate in the normal apoptotic death of thymocytes, but a clear role for Fas in negative selection is not well established. lpr mice with a loss-of-function mutation in Fas appear to have normal negative selection (33), as do mice in which the Fas gene has been knocked out (13), suggesting that Fas is not required for the apoptotic elimination of self-reactive thymocytes. Mouse transgenic models of negative selection also support the notion that Fas is responsible for peripheral deletion of at least some classes of T cells but does not participate in thymic deletion (34). Mice made genetically deficient in Fas-associated death domain protein (FADD)3 (35), an essential signal protein in the Fas pathway, are defective in thymocyte development, suggesting that Fas or related receptors that signal through FADD participate in thymocyte development. When a dominant negative FADD is expressed in mouse thymocytes, a somewhat different phenotype is seen, with enhanced apoptosis and negative selection of thymocytes (36).
In this study, we have evaluated the expression and function of Fas on
different subpopulations of human thymocytes. In contrast to the
situation described for the murine thymus, we found high levels of Fas
expressed on immature classes of human thymocytes. However, human
thymocytes displayed marked resistance to Fas-signaled apoptosis,
whether triggered by mAb to Fas receptor, soluble Fas ligand, or
membrane-bound Fas ligand. Human thymocytes are nonetheless sensitive
to apoptosis induced by TNF-
, suggesting that resistance to
apoptosis induction is Fas-specific and operates at an early step in
Fas signaling.
| Materials and Methods |
|---|
|
|
|---|
SCID-hu Thy/Liv, C57BL/6, and BALB/c mice were housed in specific pathogen-free conditions. SCID-hu Thy/Liv mice were constructed as described (37, 38) from fetal human thymus and liver tissue implanted under the kidney capsule, and used within 8 mo after transplantation. Protocols for the care and use of animals were approved by the University of California, San Francisco (UCSF) Committee on Animal Research.
Human tissue
Human fetal thymic tissue was obtained from tissues obtained at second trimester elective abortions after informed consent. Surgical specimens from children aged 1 wk to 9 years of age undergoing cardiac repair procedures were the source of pediatric thymocytes. Protocols governing the collection and use of human fetal and pediatric tissues were approved by the UCSF Committee on Human Research.
Cell culture
Jurkat E6 clone 1 cells were obtained from Arthur Weiss (UCSF) and 293-T cells were obtained from David Baltimore (Massachusetts Institute of Technology, Cambridge, MA). Jurkat cells were maintained in RPMI medium with 10% FCS, and 293-T cells in DMEM with 10% FCS. Ficoll-separated PBMC were stimulated with PHA (5 µg/ml; Sigma, St. Louis, MO) and IL-2 (10 U/ml) (Boehringer Mannheim, Indianapolis, IN) for 2 days before addition to apoptosis assays.
Fetal thymic organ culture
The method for human fetal thymic organ culture has been
described in detail (39). In brief, human fetal thymus was
minced into fragments of
1 mm3 and cultured on
prewetted rafts constructed of Gelfoam (Upjohn, Kalamazoo, WI) overlaid
with 0.8-µm Nucleopore filters (Corning, Acton, MA). Culture medium
was RPMI with 10% FCS supplemented with insulin, selenium, and
transferrin (Sigma) and with MEM vitamin supplements (Life
Technologies, Grand Island, NY). Culture additives for apoptosis assays
were added to medium after cultures were established.
Fetal thymic reaggregate culture in hanging drops
The method is a modification of published techniques (39, 40). Thymic stromal cells were obtained from 6-day-old thymic organ cultures, which were supplemented with 1.35 mM 2-deoxy guanosine (Sigma) to deplete thymocytes. Tissue fragments were digested with collagenase B (Boehringer Mannheim) and DNase (Calbiochem, La Jolla, CA) and washed in PBS before depletion of CD3+ cells with biotinylated anti-human CD3 (Becton Dickinson, San Jose, CA) and streptavidin-coated magnetic beads (Dynal, Lake Success, NY). Purified thymic stromal cells were added in a ratio of 1:6 to 1 x 106 freshly disaggregated fetal human thymocytes from another donor and suspended in 40 µl RPMI with 10% FCS and supplements. Replicate suspension cultures were pipetted into wells of a sterile support (GENunc modules; Nunc, Naperville, IL). The support was inverted in a humidified dish and incubated at 37°C in 5% CO2. Medium was supplemented daily to replenish evaporative losses.
Flow cytometric analysis of Fas expression on cells
Jurkat cells, mouse thymocytes, cells from human fetal thymus,
pediatric thymus, or SCID-hu Thy/Liv grafts were stained and analyzed
within 6 h of harvest. Longer storage of tissue or cells was found
to result in altered Fas expression levels. Magnetic bead depletion of
CD8-positive human fetal thymocytes was accomplished using biotinylated
anti-human CD8 Ab (Becton Dickinson) and streptavidin-coated
magnetic beads. Surface staining for Fas employed one of three methods:
1) using affinity-purified N-18 rabbit anti-human Fas Ab or an
affinity purified Ab control (rabbit anti-mouse I
B
) (Santa
Cruz Biotechnology, Santa Cruz, CA) as a primary stain, PE-conjugated
polyclonal goat anti-rabbit Ab (Caltag, Burlingame, CA) or
FITC-conjugated goat anti-rabbit Ab (BioSource, Camarillo, CA) as a
secondary stain; 2) using mouse monoclonal IgM anti-Fas (CH-11;
Immunotech, Westbrook, ME) or mouse IgM as a primary stain, and
FITC-conjugated anti-mouse IgM (Caltag) as a secondary stain; 3)
using recombinant soluble Fas ligand-Flag (see below) as primary stain
(at 25 µg/ml), followed by biotinylated anti-Flag Ab (M2; Sigma)
and then by FITC-conjugated avidin (Becton Dickinson) or Tri-color
(TC)-conjugated streptavidin (Caltag). For three-color analysis, either
FITC- or PE-conjugated anti-human CD4 (Becton Dickinson) and
TC-conjugated anti-human CD8 (Caltag) were included with the
secondary Ab. For four-color analysis, the staining regimens included
FITC-conjugated anti-human CD4, PE-Cy7-conjugated (Coulter, Palo
Alto, CA) or TC-conjugated (Caltag) anti-human CD8, and
APC-conjugated anti-human CD3 (Caltag) with the secondary stain.
Three-color analysis was performed on a FACScan (Becton Dickinson) and
four-color analysis on a FACSVantage (Becton Dickinson). Cytometric
analysis utilized CellQuest software (Becton Dickinson). Forward and
side gates defining live thymocytes were used for analysis, and isotype
controls were used to set thresholds defining 99th percentile for
negative stains. Four-color analysis with the combination of APC and TC
excluded cells positive in the FL-3 channel to eliminate fluorescence
channel spillover.
Apoptosis assays
In vitro apoptosis assays used suspensions of dissociated human fetal thymus, mouse thymus, or Jurkat cells (Jurkat E6 clone 1) cultured in round-bottom 96-well trays at a density of 12 x 106 cells/ml for thymocytes or 25 x 105 cells/ml for Jurkat cells in RPMI medium with 10% FCS and incubated 1820 h at 37°C in 5% CO2. Culture additives, including monoclonal mouse IgM anti-human Fas Ab (CH-11), hydrocortisone (5 µM), and dexamethasone (1 µM; Sigma) were added just before incubation. In other experiments, cycloheximide (Sigma) was added (to 30 µM final concentration) 30 min before addition of other agents. Secondary cross-linking agents, e.g., goat anti-human IgM (Caltag) or biotinylated anti-Flag Ab (M2; Sigma), were added 10 min after other culture additives.
Apoptotic cells were quantitated by flow cytometric analysis after staining with green fluorescent protein (GFP)-annexin V (generous gift of Joel Ernst (UCSF)) (41). Primary cells (i.e., those from SCID-hu Thy/Liv grafts, fetal thymic organ cultures, mouse liver, or mouse thymus) were prepared for staining by dicing tissue in PBS with 2% FCS and 1.5 mM calcium chloride (staining and wash solution), followed by pipette trituration and filtering through a 70-µm nylon mesh. Cells from reaggregate cultures were dispersed by pipette trituration and filtering. Cell suspensions (1 x 107 cells/ml staining solution) were incubated with 1.5 µg/ml GFP-annexin V for 20 min at 4°C and washed once before analysis. For analysis of apoptosis in thymocyte subpopulations, cells were costained with PE-conjugated anti-human CD4 and TC-conjugated anti-human CD8 or PE-conjugated anti-mouse CD4 and TC-conjugated anti-mouse CD8a (Caltag). In many experiments, propidium iodide (Molecular Probes, Eugene, OR) at 5 µg/ml was added to an aliquot of cells before flow cytometric analysis to confirm specificity of GFP-annexin V staining of apoptotic cells. Forward and side scatter gates were set to exclude debris, and percent GFP-annexin V-positive cells was enumerated for each sample in duplicate or triplicate wells. Specific apoptosis induced was calculated as follows: % apoptosis = [(% GFP-annexin V positive cells (experimental)) - (% GFP-annexin V positive cells (control))]/[100 - (% GFP-annexin V positive cells (control))]. SDs for replicate samples were consistently within 10% of mean values.
Cloning and expression of Fas ligand and Flag-tagged recombinant soluble Fas-ligand
The full-length transcript for human Fas ligand was amplified from reverse transcribed RNA isolated from IL-2-activated PBMC using primers incorporating restriction sites EcoRI and XbaI (sense, CCGGAATTCATGCAG CAGCCCTTCAATTAC; antisense, CCGTCTAGATTAGAGCTTATATAAGCC). The PCR product was digested to create overhangs and cloned into the mammalian expression vector pCDNA3 (Invitrogen, San Diego CA). Calcium phosphate-mediated transfection of this vector into 293-T cells resulted in transient expression of high levels of Fas ligand on the surface of the monolayer. Two days after transfection, freshly isolated human fetal thymocytes, mouse thymocytes, or Jurkat cells were added to the monolayer cultures expressing Fas ligand or control monolayers transfected with the parent vector.
The strategy for preparing a recombinant soluble Fas ligand protein tagged with the Flag epitope (rs Fas ligand-Flag) was based on the method of Schneider et al. (42, 43). Primers incorporating XhoI and KpnI sites were used to amplify the extracellular domain of human Fas ligand (nt 503931 according to the numbering of Alderson (7), GenBank accession no. U08137 (sense, GGCTCGAGAAAAAGGAGCTGAGG; antisense, TGGGTACCTTAGAGCTTATATAAG). The restriction enzyme-cleaved product was ligated in frame to a HindIII/KpnI fragment encoding the first 90 nucleotides of the prolactin signal sequence, followed by a modified Flag epitope (44) and ligated into pcDNA3. Expression of rs Fas ligand-Flag in 293T cells was accomplished through calcium phosphate transfection, and cells expressing recombinant protein were selected with G418. Supernatants collected from selected cell cultures were clarified by centrifugation and passed through a 0.2-µm filter. Supernatants were either used unpurified for tissue culture experiments or purified on an anti-Flag affinity column (M2; Sigma) according to the manufacturers instructions, and the neutralized eluate further concentrated with Microcon10 centrifugal concentrators (Amicon, Beverly, MA).
In vivo treatment with rs Fas ligand-Flag. Two regimens for in vivo administration were used. SCID-hu Thy/Liv mice were injected i.v. with 12.5 µg affinity-purified rs Fas ligand-Flag protein in 0.1 ml volume, followed immediately by i.v. injection of 50 µg of anti-Flag Ab in the same volume. Control animals received saline in place of rs Fas ligand-Flag. Alternatively, mice received 5 µg control Flag-tagged protein or rs Fas ligand-Flag by i.p. injection in 0.5 ml PBS followed 24 h later by i.p. injection of 60 µg biotinylated M2 Ab in 0.2 ml PBS. Twenty-four hours later, or given signs of obvious illness, animals were euthanized, and cells from mouse liver, spleen, and human cells from the Thy/Liv grafts were prepared for annexin staining.
| Results |
|---|
|
|
|---|
Expression of Fas on various populations of differentiating human
thymocytes was assessed with three- and four-color multiparameter flow
cytometry. Human thymocytes were obtained from second trimester fetal
tissue, thymus specimens of infants and children obtained at cardiac
surgery, and from human fetal thymus grafted together with human fetal
liver cells under the kidney capsule of SCID mice (SCID-hu Thy/Liv).
Fas was highly expressed on
CD4-CD8- (double
negative, DN) cells and to moderate degree on
CD4+CD8+ (double positive,
DP) thymocytes (Fig. 1
A).
CD4-CD8+ (single positive
CD8, SP8) thymocytes were low or negative for Fas expression, while
CD4+CD8- (single positive
CD4, SP4) thymocytes were heterogeneous in Fas staining intensity; a
minority of SP4 cells expressed Fas at equal or higher levels than
CD4+CD8+ thymocytes, while
the majority of CD4+CD8-
cells were low or negative for Fas expression (Fig. 1
A). As
described previously (45, 46),
CD4+CD8- human thymocytes
were found to comprise two subpopulations differing in CD3 surface
expression:
CD3+CD4+CD8-
thymocytes (mature, medullary thymocytes) and
CD3-CD4+CD8-
cells (also termed intrathymic T progenitor cells (ITTP cells)). The
latter subpopulation of immature thymocytes represented
1025% of
CD4+CD8- human thymocytes
(or 14% of total human thymocytes). Consistent with earlier reports
(45),
CD3-CD4+CD8-
thymocytes were found to have higher forward light scatter and a higher
fraction of cells in cycle than double positive or single positive
thymocytes (data not shown). In addition to these characteristics of a
dividing cell population, many
CD3-CD4+CD8-
fetal thymocytes were found to express CD34 and to have the capacity to
mature into CD4+CD8+
thymocytes on adoptive transfer into thymic reaggregate cultures (data
not shown). This population thus contains true progenitor cells and is
not merely comprised of more mature
CD4+CD8- cells that have
down-regulated CD3 expression.
|
To determine whether Fas expression in the human fetus is different
from that in the postnatal organ, thymic tissue was obtained from two
children undergoing cardiac repair procedures and from SCID-hu Thy/Liv
grafts 46 mo after transplantation, a time frame when these cells may
be expected to have matured developmentally from the fetal thymus
source. As shown in Fig. 1
D, these tissues displayed a
pattern of Fas expression similar to that of human fetal thymocytes,
with the highest Fas expression on immature thymocyte subpopulations,
intermediate levels of expression on
CD4+CD8+ thymocytes, and
lowest expression on mature single positive cells.
Cross-linking of Fas with agonist mAbs does not induce apoptosis in human thymocytes
Since cross-linking of Fas receptor by Abs is sufficient to
generate a death signal in susceptible cells (47, 48, 49), we
tested whether Fas expressed on human thymocytes could transmit a death
signal. Cells were incubated with various death-inducing stimuli,
including a mouse IgM mAb to human Fas (CH-11), which has
well-characterized apoptosis-induction properties, and apoptosis was
quantitated using GFP-annexin V binding. Jurkat T cells, and to a
lesser degree PBMC blasts, were induced to apoptosis after 18 h of
incubation with CH-11 Ab (Fig. 2
A). In contrast, human fetal
and pediatric thymocytes did not undergo apoptosis after cross-linking
of surface Fas receptors with CH-11 Ab, even though they were sensitive
to apoptosis induced by hydrocortisone treatment. Doses of CH-11 Ab
from 50 ng/ml through 1 µg/ml, well above the 50% effective dose for
Jurkat cells, were all ineffective in inducing thymocyte apoptosis
(Fig. 2
B). Indirect immunofluorescent staining of thymocytes
with the CH-11 anti-Fas monoclonal confirmed that the Ab bound to
human thymocytes, although to a lesser degree than the polyclonal N-18
rabbit anti-Fas antiserum (see below). CH-11 Ab also failed to
induce apoptosis of human thymocytes after it was cross-linked with
anti-IgM Ab or after it was immobilized on tissue culture plates
(data not shown). Kinetic analysis revealed that Jurkat cells underwent
significant levels of apoptosis within 6 h of incubation with
CH-11 Ab, whereas the apoptosis of human thymocytes was not increased
above background, even after 24 h of treatment (Fig. 2
C).
|
|
Recombinant soluble Fas ligand fails to induce apoptosis in human thymocytes either in vitro or in vivo
mAbs to mouse Fas may not always induce the signals generated by
the native ligand (52), whereas the controlled
cross-linking of native human Fas ligand may allow for more efficient
triggering of signal through the Fas receptor (43). We
therefore created a soluble recombinant form of human Fas ligand fused
to a Flag epitope (rs Fas ligand-Flag; Fig. 4
A) and investigated whether
this reagent, alone or after cross-linking by anti-Flag Abs, could
induce apoptosis through interaction with Fas expressed on the surface
of human thymocytes. Crude culture supernatants from 293-T cells
transfected with a rs Fas ligand-Flag expression vector, as well as
purified protein, potently induced the apoptotic death of Jurkat cells
when cross-linked using anti-Flag Ab, but were minimally effective
when added alone (Fig. 4
B, and data not shown). In contrast,
human fetal thymocytes were resistant to apoptosis induction by
cross-linked rs Fas ligand-Flag, even at doses many times higher than
those effective for Jurkat cells (Fig. 4
C). Pediatric
thymocytes were also resistant to induction of apoptosis by soluble Fas
ligand in vitro, either with or without cross-linking anti-Flag Ab
(data not shown). Cross-linked recombinant Fas ligand was also used to
assess apoptosis in fetal thymocytes, which were induced to an
activated state. Treatment of thymocytes for 24 h with
anti-CD3 mAb and IL-2 resulted in morphologic changes consistent
with thymocyte activation and blast formation, but did not induce
sensitivity to apoptosis induction with Fas ligand (data not
shown).
|
Membrane-bound Fas ligand fails to induce apoptosis in human fetal thymocytes
Experiments in mice indicate that the soluble form of Fas ligand
may not be as efficient as membrane-bound forms in the induction of
apoptosis (52, 55, 56). To examine whether human
thymocytes are resistant to apoptosis induced by membrane-bound Fas
ligand, cell monolayers expressing high levels of Fas ligand (Fig. 5
, A and B) were
cocultured with Jurkat cells, thymocytes from BALB/c or C57BL/6 mice,
or fetal human thymocytes. As with soluble Fas ligand, the
membrane-bound human form efficiently induced apoptosis in Jurkat and
mouse thymocytes, while fetal human thymocytes showed only marginal
induction of apoptosis above control cultures (Fig. 5
C).
Analysis of mouse thymocyte subsets showed that
CD4+CD8+ cells were more
susceptible than CD4+CD8-
cells to human Fas ligand-induced apoptosis (Fig. 5
D), in
agreement with earlier studies employing mAb to mouse Fas
(29). Analysis of thymocytes from BALB/c mice and from
C57BL/6 mice gave equivalent results. In contrast, no subpopulation of
human thymocytes appeared to be sensitive to apoptosis induction by
membrane-bound Fas ligand.
|
|
By analogy to other TNF/nerve growth factor receptor systems,
inhibition of apoptotic signaling pathways through Fas expressed on
human thymocytes may occur at a prereceptor level (e.g., ligand binding
by soluble receptor), at the receptor level, or at a postreceptor level
(3). Apoptotic signaling pathways for TNF-
and Fas
converge at FADD, and because dominant negative FADD can inhibit
apoptosis induced through Fas as well as TNF-
(58, 59)
it is possible to assess the integrity of the distal Fas signaling
pathway in human thymocytes by testing the sensitivity to
TNF-
-induced apoptosis. We therefore compared the sensitivity of
Jurkat cells and freshly isolated human thymocytes to apoptosis induced
by TNF-
or by anti-Fas mAb. As expected, the degree of apoptosis
induced after 18 h exposure to TNF-
was low in Jurkat cells,
likely due to concomitant activation of NF-
B (60).
Nevertheless, TNF-
induced low but highly reproducible levels of
apoptosis that were equivalent in Jurkat cells and human fetal
thymocytes (Fig. 7
A).
Murine thymocytes were also sensitive to TNF-induced apoptosis to a
similar degree in 18-h assays (data not shown). While anti-Fas Ab
was ineffective against human thymocytes at any dose (Fig. 7
B), Jurkat cells and thymocytes were both sensitive, in a
dose-dependent manner, to TNF-induced apoptosis (Fig. 7
C).
Taken together, these data show that the resistance of human thymocytes
to apoptosis is Fas-specific and that the signal step(s) likely to be
involved are those before FADD activation of caspase 8 (FLICE).
|
| Discussion |
|---|
|
|
|---|
We found, first, that the expression of Fas on developing thymocytes
differed importantly from that of the mouse. As reported previously
(30, 31), mature human CD4 and CD8 thymocytes were found
to express low levels of Fas, while double positive
CD4+CD8+ cells were
intermediate in Fas expression. In contrast with these reports, and
similar to the findings of others (22), we consistently
found heterogeneity of Fas expression among single positive CD4
thymocytes. CD4+ cells with the highest
expression of Fas were confirmed to have the phenotype
CD3-CD4+CD8-,
which identifies intracellular T progenitor cells (45). In
addition, Fas was highly expressed on human
CD4-CD8- cells. These two
classes of thymocytes are the most immature thymocytes and account for
5% of total thymocytes. Fas expression in the human thymus thus
appears to vary across a developmental spectrum: highest on the
earliest intrathymic progenitor cells, dropping to intermediate levels
among CD4+CD8+ cells, and
falling to low or negative levels on single positive CD4 and CD8 cells.
This pattern of high Fas expression differs markedly from that
described for the mouse thymus, in which Fas is first expressed on
double positive CD4+CD8+
cells and is retained at equal levels on single positive thymocytes
(24, 29).
Secondly, and also in contrast with mouse thymocytes, we observed that human thymocytes were resistant to Fas-induced apoptosis. This was the case whether the thymocytes were from fetal tissue (1523 wk gestational age), from pediatric thymus (through 9 years of age), or from SCID-hu Thy/Liv grafts (harvested from 4 to 6 mo following transplantation). Given the consistency of this finding across these age groups, it is unlikely that resistance of human thymocytes to Fas-induced apoptosis is characteristic of a single stage of development (64). Few experimental data have been reported concerning the sensitivity of human thymocytes to Fas-induced apoptosis. Yonehara et al. (31) reported that an IgM anti-Fas Ab (AX6) lacked the ability to induce apoptosis of human thymocytes, though limited DNA fragmentation was reported. Here, we also show that human thymocytes resisted the induction of apoptosis by several other agonists, including mAbs to Fas, cross-linked rs Fas ligand, and membrane-bound Fas ligand. This last test was important because of the observation that soluble ligands of Fas may have diminished apoptotic activity (43) or may actually antagonize Fas signaling in mouse (56) and human cells (55). It has been argued that "agonist" mAbs to Fas may, under certain conditions of receptor density, mimic this antagonistic function (52).
Our data demonstrate that human thymocytes, regardless of source and of method of receptor ligation, resist apoptosis induction through Fas both in vitro and in vivo. The durable resistance of human thymocytes to Fas-signaled apoptosis adds to the list of important differences in Fas biology reported between mice and humans. These observations include: 1) Soluble Fas ligand released from human cells is cytotoxic to Fas-positive cells (15, 65), while soluble Fas ligand from mouse cells generally is not (55); 2) Agents capable of triggering apotosis in mouse cells may not effectively trigger apoptosis in human cells (42); 3) Superantigen-mediated deletion of human thymocytes cells requires Fas (31), while Fas appears to be dispensable for this purpose in the mouse (13, 51); 4) Ligation of Fas may synergize with anti-CD3 in stimulating proliferation of human T lymphocytes (66), while the same combination synergizes to kill mouse thymocytes (51). These observations point to a fundamental difference between these species in the regulation and utilization of Fas signaling in maintenance of lymphocyte homeostasis.
These data provide some insight into the biology of apoptotic signaling
in the human thymus. First, although mouse models have suggested that
some thymocytes may depend upon Fas for negative selection, our data
suggest that Fas is unlikely to participate in negative selection in
the human thymus. Second, unlike mouse thymocytes, in which the
apoptotic response to Fas engagement is enhanced by protein synthesis
inhibition (29, 51), apoptosis of human thymocytes is not
augmented by exposure to cycloheximide. In fact, we found that
cycloheximide reduced levels of spontaneous apoptosis in cultures of
dissociated human thymocytes by a small but significant degree. These
data suggest that the balance of proapoptotic and antiapoptotic forces
in human thymocytes is fundamentally different from that of PBMC or
murine thymocytes. The signaling and effector proteins responsible for
apoptosis of cells through Fas are already synthesized in the cell
(67, 68), which accounts for the speed with which an
apoptotic signal may result in cell death. Negative regulators of
apoptosis that act at early steps of the Fas signal cascade, such as
Toso (69), FLIP (70), and cIAP
(71), may underlie the observed enhancement of Fas-induced
apoptosis by cycloheximide in mouse cells, but are unlikely to account
for resistance of human thymocytes. In addition, these proteins all
operate at proximal signaling steps and would be expected to impact
apoptosis signaled through TNF-
as well as through Fas, and so are
unlikely to account for the Fas-specific effect we have described.
Data presented in this report do not point conclusively to the mechanism(s) of thymocyte resistance to Fas-induced apoptosis, but do permit some inferences. Our data do not seem to be consistent with the hypothesis that soluble Fas receptors, such as those encoded by alternatively-spliced transcripts found in both SLE patients and normal subjects (72), could account for such resistance. Elaboration of soluble receptors would be unlikely to block the binding of Fas ligand to freshly isolated and washed cells. In addition, alternatively-spliced Fas transcripts encoding soluble receptors have been found in activated PBMC (48) and in mouse thymocytes (73), although these cells do not display marked resistance to Fas-induced apoptosis. Moreover, we found that the binding of other anti-Fas Abs to human thymocytes was not blocked, suggesting that the mechanism was not a soluble decoy receptor.
Our data suggest a more complex picture regarding the likely mechanism of resistance of human thymocytes to Fas-induced apotosis. The failure to induce thymocyte apoptosis with cross-linking IgM mAb to Fas implies that a step distal to receptor binding may be responsible for human thymocyte Fas resistance. Impaired multimerization of Fas receptor, or the inability of the Fas signal complex to recruit and activate FADD, are candidate mechanisms for this mode of resistance, as the pathways distal to these steps appear to be intact.
The apparent inability of Fas expressed on human thymocytes to signal
apoptosis begs the question of what purpose is served by its expression
in these cells at all. Hematopoietic progenitor cells in the liver have
been reported to express Fas, which is likewise incapable of directing
an apoptotic signal (74), leading to the suggestion that
Fas may subserve different nonapoptotic functions in developing cells.
Fas may participate in nonapoptotic signals important to development of
thymocytes, either by promoting entry into the cell cycle (35, 36, 75) or by activation of Jun kinase though Daxx
(76). Fas would thus join the list of receptors (including
nerve growth factor receptor p75 (77), c-kit
(78), and the receptors for TGF-
(79), and
platelet-derived growth factor (80)), which are capable of
delivering a death signal at one stage of development and a
proliferative or developmental signal at another. Whether such
nonapoptotic signaling pathways from Fas are triggered by specialized
conditions for ligand binding, or by a unique ligand, remains to be
investigated.
Regulation of Fas-mediated apoptosis may be therapeutically exploited for treatment of autoimmune diseases, tissue rejection, cancer, and immunosuppression resulting from HIV-1 infection. Control of apoptotic pathways in a tissue-specific manner represents a major challenge confronting such therapies. More detailed understanding of the regulation of Fas signaling in the thymus may provide additional insight into this problem.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. J. M. McCune, Gladstone Institute of Virology and Immunology, P.O. Box 419100, San Francisco, CA 94141-9100. E-mail address: ![]()
3 Abbreviations used in this paper: FADD, Fas-associated death domain protein; TC, Tri-Color; GFP, green fluorescent protein; rs, recombinant soluble; DN, double negative; DP, double positive; SP8, single positive CD8; SP4, single positive CD4; ITTP, intrathymic T progenitor cells. ![]()
Received for publication March 25, 1999. Accepted for publication May 14, 1999.
| References |
|---|
|
|
|---|
, tumour necrosis factor, and Fas on human bone marrow CD34+ cells. Br. J. Haematol. 97:356.[Medline]
B activation. Cell 81:495.[Medline]
1 abrogates Fas-induced growth suppression and apoptosis of murine bone marrow progenitor cells. Blood 90:3395.This article has been cited by other articles:
![]() |
M. S. Lee, K. Hanspers, C. S. Barker, A. P. Korn, and J. M. McCune Gene expression profiles during human CD4+ T cell differentiation Int. Immunol., August 1, 2004; 16(8): 1109 - 1124. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Pullar, S. J. Thomson, M. J. King, C. I. Turnbull, R. G. Midwinter, and M. B. Hampton The chemopreventive agent phenethyl isothiocyanate sensitizes cells to Fas-mediated apoptosis Carcinogenesis, May 1, 2004; 25(5): 765 - 772. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Guo, M. Zhang, H. An, W. Chen, S. Liu, J. Guo, Y. Yu, and X. Cao Fas ligation induces IL-1{beta}-dependent maturation and IL-1{beta}-independent survival of dendritic cells: different roles of ERK and NF-{kappa}B signaling pathways Blood, December 15, 2003; 102(13): 4441 - 4447. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Pullar and M. B. Hampton Diphenyleneiodonium Triggers the Efflux of Glutathione from Cultured Cells J. Biol. Chem., May 24, 2002; 277(22): 19402 - 19407. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Weisberg, E. Ashkenazi, Z. Israel, M. Attia, Y. Shoshan, F. Umansky, and C. Brodie Anaplastic and Atypical Meningiomas Express High Levels of Fas and Undergo Apoptosis in Response to Fas Ligation Am. J. Pathol., October 1, 2001; 159(4): 1193 - 1197. [Abstract] [Full Text] |
||||
![]() |
M. T. Tian, C.-H. G. Chou, and A. L. DeFranco Apoptosis induced by the antigen receptor and Fas in a variant of the immature B cell line WEHI-231 and in splenic immature B cells Int. Immunol., April 1, 2001; 13(4): 581 - 592. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Eichhorst, S. Müerköster, M. A. Weigand, and P. H. Krammer The Chemotherapeutic Drug 5-Fluorouracil Induces Apoptosis in Mouse Thymocytes in Vivo via Activation of the CD95(APO-1/Fas) System Cancer Res., January 1, 2001; 61(1): 243 - 248. [Abstract] [Full Text] |
||||
![]() |
M. Jenkins, M. Keir, and J. M. McCune A Membrane-bound Fas Decoy Receptor Expressed by Human Thymocytes J. Biol. Chem., March 10, 2000; 275(11): 7988 - 7993. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |