|
|
||||||||


*
Department of Pathology, and
Division of Infectious Diseases, Case Western Reserve University, Cleveland, OH 44106; and
Department of Internal Medicine, University of Iowa, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
and increases transcription of various genes,
but its effects on macrophage Ag processing remain uncertain. The
effects of CpG ODN on class II MHC (MHC-II) Ag processing and
presentation were examined using peritoneal macrophages that were
cultured for 18 h with CpG ODN and then pulsed with protein Ags. T
cell hybridomas were used to detect presentation of specific
peptide:MHC-II complexes. Both CpG ODN and LPS inhibited processing of
bovine RNase and hen egg lysozyme. Presentation of exogenous peptides
was inhibited to a lesser degree. Treatment of macrophages for 18
h with CpG ODN decreased surface MHC-II expression, as measured by flow
cytometry. Furthermore, Northern blot analysis revealed that treatment
with CpG ODN decreased I-Ak mRNA. Endocytosis by
macrophages, as measured by uptake of fluorescent dextran, was not
altered by treatment with CpG ODN. The inhibitory effect of CpG ODN on
Ag processing was seen after prolonged (18 h) treatment of macrophages,
but not after short treatment (e.g., 2 h) with CpG ODN and protein
Ag. Enhancement of macrophage Ag processing was not seen at any time
point of CpG ODN exposure, in contrast to data from other studies with
dendritic cells. In summary, exposure of macrophages to CpG ODN results
in a decrease in macrophage Ag processing and presentation, which is
largely mediated by a decrease in synthesis of MHC-II
molecules. | Introduction |
|---|
|
|
|---|
For the purposes of this analysis, we define Ag processing as the set of mechanisms that convert native protein Ags to peptide:MHC-II complexes that are expressed on the cell surface. Synthesis of MHC-II molecules is required for processing of most antigenic epitopes, although some epitopes are presented by recycling MHC-II molecules in the absence of newly synthesized MHC-II molecules (3, 4, 5, 6, 7, 8, 9). Thus, for most epitopes, the level of MHC-II synthesis and expression is a major determinant of Ag processing.
Expression of MHC-II molecules (and therefore Ag presentation) by
macrophages is closely regulated and varies depending upon the
activation state, with resting macrophages having low levels of surface
MHC-II, compared with activated macrophages (e.g., those activated with
IFN-
). In addition to Ag processing and presentation, other
functions of macrophages, such as secretion of cytokines, microbicidal
activity, and tumoricidal activity, are also regulated by activation
state (10). Moreover, macrophages can be activated in
different ways, resulting in different activation states with
expression of different functions. Thus, a stimulus that activates one
macrophage function can inhibit another function, and it is important
to carefully define what is meant by macrophage activation in the
context of different functions. Macrophages can be activated by
cytokines and other substances, including microbial products, such as
bacterial DNA.
Bacterial DNA differs from vertebrate DNA in that it contains an increased number of unmethylated CpG dinucleotides. The unmethylated CpG is able to directly stimulate macrophages (11, 12), NK cells (13, 14), dendritic cells (15, 16), and B cells (17, 18), especially when present in a specific 6-bp motif where the central CpG is flanked preferentially by two 5' purines and two 3' pyrimidines (17). Short oligodeoxynucleotides (ODN) that contain CpG motifs (CpG ODN) have similar activity to, and are more potent than, genomic bacterial DNA. Because of their immune stimulatory properties, CpG ODN have been successfully used as adjuvants in several experimental systems (19, 20, 21, 22, 23).
CpG DNA affects a variety of macrophage functions. Macrophages exposed
to CpG DNA rapidly secrete the inflammatory cytokines TNF-
and IL-12
(11, 12, 24, 25). The IL-12 acts synergistically with
CpG DNA to induce IFN-
production by NK cells, causing further
activation of macrophages (24, 25). The induction of IL-12
and IFN-
by CpG DNA is a possible mechanism for its Th1 adjuvant
activity (19, 20, 21, 22, 23). In addition, CpG DNA may up-regulate
antimicrobial activity of macrophages, as it induces the transcription
of inducible NO synthase after pretreatment of macrophages with IFN-
(11).
CpG DNA could affect Ag processing and presentation by both indirect
mechanisms (e.g., the induction of IFN-
secretion by other cells)
and direct effects on macrophages. The direct effects of CpG DNA on Ag
processing and presentation functions of macrophages have not been
previously examined. The studies presented here examine the direct
effects of CpG ODN on isolated macrophages in vitro. Theoretically, an
increase in Ag presentation could partially explain the adjuvant
effects of CpG DNA. In contrast, in this study, we demonstrate that CpG
ODN do not directly enhance macrophage Ag processing. In fact, our
results show that treatment of macrophages with CpG ODN for 18 h
inhibits Ag processing, and the primary mechanism for this inhibition
appears to be a CpG ODN-induced decrease in synthesis of MHC-II
molecules. These results show that the macrophage response to CpG ODN
differs significantly from that of dendritic cells, which are
stimulated by CpG ODN to express higher levels of MHC-II and
costimulator molecules (15, 16, 26) and to manifest a
transient increase in Ag processing activity (26).
| Materials and Methods |
|---|
|
|
|---|
Synthetic ODN were purchased from Operon Technologies (Alameda, CA) or Oligos Etc. (Wilsonville, OR). ODN were phosphorothioate-modified to increase their resistance to nuclease degradation. ODN with the following sequences were used (CpG motifs or altered non-CpG motifs are underlined): CpG ODN 1826, TCCATGACGTTCCTGACGTT; non-CpG ODN 1982, TCCAGGACTTCTCTCAGGTT; CpG ODN 1760, ATAATCGACGTTCAAGCAAG; non-CpG ODN 1908, ATAATAGAGCTTCAAGCAAG. ODN were dissolved in TE (10 mM Tris, 1 mM EDTA). LPS contamination of ODN preparations was undetectable by Limulus amebocyte assay (QCL-1000; BioWhittaker, Walkersville, MD), indicating <1 ng LPS/mg DNA and resulting in final concentrations of contaminating LPS of <1 pg/ml in cell cultures. Some experiments involved the addition of purified LPS (Escherichia coli 0127:B8; Difco, Detroit, MI). Hen egg lysozyme (HEL) and bovine RNase were obtained from Sigma (St. Louis, MO).
Cells and media
Female retired breeder CBA/J (H-2k) mice were obtained from The Jackson Laboratory (Bar Harbor, ME) and housed in microisolator cages under specific pathogen-free conditions. For all figures presented here, peritoneal exudate cells were harvested 4 to 5 days after i.p. injection of mice with 100 µg Con A (Sigma) dissolved in PBS. The second figure also includes data derived from resident peritoneal macrophages obtained from naive CBA/J mice. In other comparative studies (data not shown), macrophages were harvested 45 days after injection of thioglycollate or 1014 days after i.p. inoculation of mice with Listeria monocytogenes. Peptide:MHC-II complexes were detected with the following T hybridomas obtained from Drs. Paul Allen and Emil Unanue (Washington University, St. Louis, MO): TS12, specific for RNase (4256):I-Ak; WA.23, specific for RNase (90105):I-Ek; A6.A2, specific for HEL (3445):I-Ak; 3A9, specific for HEL (4861):I-Ak. All cells were cultured in DMEM supplemented with 10% FCS, glutamine, 2-ME, and antibiotics.
Processing and presentation assays
Peritoneal cells were added to 96-well plates (2 x 105/well), incubated at 37°C for 24 h, and washed to remove nonadherent cells. ODN or LPS was added to the adherent cells in a total volume of 200 µl and incubated overnight (1824 h) at 37°C. In Ag processing assays, cells were washed and pulsed with HEL or RNase. For detection of HEL (3445):I-Ak, HEL (4861):I-Ak, or RNase (4256):I-Ak, cells were pulsed with Ag for 1 h. For detection of RNase (90105):I-Ek, cells were pulsed with Ag for 2 h. After the Ag pulse, cells were washed and fixed in 0.5% paraformaldehyde. The fixed cells were washed extensively before the addition of T hybridoma cells (105/well). In assays using exogenous peptides, macrophages were incubated in medium alone for the duration of the Ag pulse, fixed, and incubated with synthetic peptides (Princeton Biomolecules, Columbus, OH) and T hybridoma cells. In other assays, ODN and protein Ag were added simultaneously to macrophages for 2 h, the macrophages were washed and fixed, and T hybridoma cells were added. Supernatants were collected after a 20- to 24-h incubation of macrophages with T hybridoma cells, and IL-2 content was assessed by a CTLL-2 bioassay. Proliferation of CTLL-2 cells was measured by a colorimetric assay (27, 28) using Alamar Blue (Alamar Biosciences, Sacramento, CA) and a Bio-Rad 550 microplate reader (Bio-Rad Laboratories, Hercules, CA). All T cell assays were performed in triplicate.
Detection of surface I-Ak by flow cytometry
Macrophages were plated in 100-mm tissue culture dishes with or without ODN or LPS for 1824 h, and cells were removed by incubation with Versene (0.53 mM EDTA in PBS; Life Technologies, Gaithersburg, MD) and washed in PBS. Cells were plated in 96-well round-bottom plates (2.5 x 105/well) and subsequent steps were performed at 4°C in a volume of 50 µl. Cells were blocked in Fc Block (rat anti-mouse CD16/CD32; PharMingen, San Diego, CA) plus 20% normal mouse serum (NMS; Jackson ImmunoResearch Laboratories, West Grove, PA) and then stained with biotinylated anti-I-Ak Ab (10-3.6.2) or a biotinylated IgG2a isotype control (AF6-88.5.3; anti-H-2Kb) at 10 µg/ml in PBS/10% NMS. The cells were washed, incubated with streptavidin-conjugated PE (1:100; PharMingen) in PBS with 10% NMS, washed again, and resuspended in 1% paraformaldyhyde. The cells were analyzed with a FACScan flow cytometer (Becton Dickinson Immunocytometry Systems, San Jose, CA).
Northern blot for detection of I-Ak mRNA
Macrophages were treated with ODN or LPS for 1824 h, and total
cellular RNA was isolated using an RNeasy kit (Qiagen, Valencia, CA)
according to the manufacturers directions. A total of 6 µg of total
RNA was run on a formaldehyde-agarose gel, blotted, and probed with an
internal 32P-labeled probe derived from a 1-kb
A
k insert of plasmid pcExv-3
(29). Blots were then stripped and reprobed with a
32P-labeled probe generated by BamHI
digest of the human cardiac actin gene, which cross-hybridizes with
mouse
-actin mRNA (30). Densitometry was performed on
digital images of the probed blots, using the Kodak Digital Science 1D
program to calculate net intensity (N.I.) values for each band.
Relative expression was determined by the following equation:
[(I-Ak
N.I.sample)/(
-actin
N.I.sample)]/[(I-Ak
N.I.control)/(
-actin
N.I.control)], with control being untreated
cells.
Endocytosis assay
Adherent macrophages in 24-well plates were treated with ODN or LPS overnight (1824 h), washed, and incubated with FITC-conjugated dextran (m.w. of 20,000; Sigma) for 2 h at 4°C (as a control for background binding of FITC-dextran to cells) or 37°C. The cells were removed from the wells using 3 mM EDTA in PBS, and uptake of FITC-dextran was assessed by flow cytometry.
| Results |
|---|
|
|
|---|
To examine the effects of CpG ODN on Ag processing and
presentation functions of macrophages, activated macrophages were
isolated by adherence from Con A-elicited peritoneal exudate cells. The
macrophages were incubated overnight (1824 h) with CpG ODN 1826 (1
µg/ml), non-CpG ODN 1982 (1 µg/ml), LPS (100 ng/ml), or control
medium. After washing to remove ODN or LPS, the cells were pulsed with
protein Ag, bovine RNase, or HEL for 1 or 2 h (see Materials
and Methods). After the Ag pulse, the cells were washed and fixed
to prevent further processing of Ag. T hybridoma cells were then added
for the detection of specific peptide:MHC-II complexes. Four different
peptide:MHC-II complexes were examined, which include epitopes that are
processed via distinct mechanisms and differ in the compartment of
complex formation (Table I
). These
epitopes also vary in their dependence upon DM/H-2M for peptide binding
to MHC-II (Table I
).
|
|
|
The down-regulation of Ag processing seen in Fig. 1
could be a result
of CpG ODN-mediated changes in internal components of the Ag processing
pathway or changes in the synthesis, expression, or availability of
MHC-II molecules. To begin to address this, we examined the effects of
CpG ODN on the ability of macrophages to present exogenous peptides,
using the same protocol as was used for examination of protein Ag
processing. Macrophages were treated with ODN or LPS, as above, and
then incubated in medium alone for the length of the corresponding
protein Ag pulse (1 or 2 h). The cells were then fixed, and
synthetic peptides were added together with T hybridoma cells. In this
approach, the number of specific peptide:MHC-II complexes formed should
reflect the level of peptide-receptive MHC-II molecules on the cell
surface.
Fig. 3
shows that treatment with CpG ODN
1826 caused a slight but consistent reduction in presentation of
exogenous peptides by Con A-elicited macrophages. Inhibition of
exogenous peptide presentation was seen using doses of CpG ODN as low
as 0.1 µg/ml (data not shown). A similar inhibition of peptide
presentation was produced by LPS but not by non-CpG ODN 1982 (Fig. 3
).
These results indicate that CpG ODN may negatively regulate Ag
processing and presentation by decreasing the expression of
peptide-receptive MHC-II molecules. However, CpG ODN only slightly
inhibited the presentation of exogenous peptide, in contrast to the
strong inhibition of protein Ag processing. This suggests that CpG ODN
inhibit intracellular mechanisms of Ag processing and/or intracellular
supplies of MHC-II molecules.
|
To further examine the effect of CpG ODN on expression of MHC-II
molecules, levels of surface I-Ak were measured
by flow cytometry after overnight treatment of Con A-elicted
macrophages with CpG ODN 1826, non-CpG ODN 1982, or LPS (Fig. 4
). Within 18 h, both CpG ODN 1826
and LPS down-regulated surface expression of I-Ak
molecules to less than half of the level on control untreated cells
(Fig. 4
). Non-CpG ODN 1982, however, had no effect on surface
expression of I-Ak (Fig. 4
C).
|
-actin
mRNA signal; Fig. 5
|
In addition to changes in MHC-II expression, another possible
mechanism for the CpG ODN-mediated inhibition of Ag processing is a
decrease in Ag uptake by endocytosis. We investigated endocytosis by
macrophages by measuring uptake of fluoresceinated dextran using a flow
cytometry assay (see Materials and Methods). Macrophages
treated overnight with CpG ODN 1826, non-CpG 1982, or LPS all showed
slight decreases in endocytosis of fluoresceinated dextran relative to
untreated control cells, but there was no CpG-specific component of
this effect (e.g., the decrease seen with non-CpG ODN 1982 was greater
than that seen with CpG ODN 1826 in the experiment shown in Fig. 6
). These results indicate that treatment
with CpG ODN did not specifically reduce the endocytic function of
macrophages.
|
| Discussion |
|---|
|
|
|---|
-dominated
Th1 responses (19, 20, 23). The mechanism for the various
adjuvant effects of CpG DNA have not been elucidated but are likely to
involve the direct activation of B cells and cells of the innate immune
system, such as macrophages, NK cells, and dendritic cells. These cells
are stimulated to secrete a variety of inflammatory cytokines
(12, 15, 16, 31) and, as has been shown with B cells and
dendritic cells, to up-regulate costimulatory molecules (15, 16, 22). Thus, activation of innate immune cells by CpG DNA has the
capacity to profoundly affect development of Ag-specific responses by
influencing activation and differentiation of
CD4+ T cells. The direct effect of CpG DNA on macrophage Ag processing and presentation has not previously been examined, and modulation of Ag presentation is another potential mechanism to explain the adjuvant activity of CpG DNA. An increase in Ag processing and presentation in response to bacterial DNA would seem appropriate in the context of bacterial infection, since this would allow more bacterial epitopes to be presented to T cells. CpG DNA is capable of directly activating macrophages, causing up-regulation of certain functions, such as cytokine secretion, and possibly microbicidal activity. However, in this study we demonstrate that CpG ODN actually down-regulate Ag processing and presentation functions of macrophages. In addition, another potent inflammatory bacterial product, LPS, has inhibitory effects on Ag processing and presentation that are similar to the effects of CpG ODN. The CpG ODN themselves contained undetectable amounts of LPS, as measured by Limulus amebocyte assay (<1 ng LPS/mg of ODN, resulting in <1 pg/ml LPS in the cultures). Moreover, multiple preparations of CpG ODN caused inhibition, while similarly prepared non-CpG ODN did not produce inhibition, demonstrating that the inhibitory effect was specifically associated with CpG DNA sequences.
The effects of CpG ODN on Ag processing were examined in four different macrophage preparations with widely varying states of activation, from less-activated resident peritoneal macrophages (from naive mice) and thioglycollate-elicited macrophages to more activated macrophages elicited by Con A or Listeria monocytogenes. CpG ODN inhibited Ag processing from the baseline control level with all macrophages tested. The consistency of the results with multiple different macrophage populations supports the significance and physiological relevance of the observations to varying macrophage populations involved in Ag presentation.
The negative effect of CpG ODN on Ag processing is due largely to a
decrease in synthesis of MHC-II molecules. Interestingly, previous
studies have shown that LPS mediates a decrease in MHC-II synthesis and
expression when macrophages are simultaneously treated with IFN-
(32, 33). Although we did not treat cells with IFN-
in
our studies, our results also demonstrated an inhibitory effect of LPS,
similar to CpG ODN, on MHC-II expression (Fig. 4
). The effects of LPS
on MHC-II synthesis have been proposed to be a result of increased
levels of prostaglandin (32) or NO secretion
(34), and this may be the case for CpG ODN as
well.
A decrease in synthesis of MHC-II molecules may not be the only
mechanism by which CpG ODN (and LPS) inhibit Ag processing, as not all
the complexes examined are dependent upon newly synthesized MHC-II
molecules. For example, formation of RNase
(4256):I-Ak is resistant to treatment of cells
with brefeldin A and does not involve newly synthesized MHC-II
molecules (3, 9), as summarized in Table I
. This
particular complex is formed in an early endosomal compartment and is
likely to utilize MHC-II molecules recycled from the cell surface
(3, 9). In fact, several different groups have
demonstrated that certain complexes are formed using recycling MHC-II
molecules (3, 4, 5, 6, 7, 8, 9). While overnight treatment with CpG ODN
decreased surface levels of MHC-II by about one half (as measured by
fluorescent staining; Fig. 4
), it is not clear whether this decrease
alone would affect levels of recycled MHC-II in early endosomes enough
to explain the dramatic inhibition in the formation RNase
(4256):I-Ak (a two-log shift in the Ag
dose-response curve) that was produced by CpG ODN (Fig. 1A).
Thus, in addition to affecting synthesis and expression of MHC-II
molecules, CpG ODN may also inhibit recycling of surface MHC-II or
other aspects of the Ag processing pathway (e.g., Ag uptake, Ag
degradation, Ag targeting inside the cell, traffic and function of
compartments involved in formation of peptide:MHC-II complexes, and
expression and/or function of DM/H-2M). In our studies, however, the
uptake function of macrophages did not appear to be affected
specifically by CpG ODN (Fig. 6). In summary, decreased synthesis of
MHC-II molecules appears to be a fundamental mechanism for inhibition
of Ag processing by CpG ODN, but the observation that CpG ODN also
inhibit formation of complexes implicated by other studies to derive
from recycling MHC-II molecules suggests the possibility that other Ag
processing functions may also be decreased by exposure to CpG
ODN.
It is unclear how the down-regulation of MHC-II expression and Ag
processing produced by CpG ODN in vitro relates to either actual in
vivo effects of bacterial DNA in a physiological context of infection
or the in vivo effects of CpG ODN in the context of vaccine function.
The inhibitory effect of CpG ODN on Ag processing was seen after
prolonged (18 h) treatment of macrophages but not after short-term (2
h) treatment with CpG ODN and protein Ag (data not shown). This
indicates the existence of a short period of time after exposure to CpG
DNA where macrophages are still able to process Ag. This window of time
may be sufficient to allow macrophages to process and present bacterial
Ags to T cells in vivo. In addition, our in vitro system examines the
direct effects of CpG ODN on processing and presentation functions of
isolated macrophages. In vivo, CpG DNA may also have indirect effects
on macrophages via stimulation of other cell types, e.g., the
stimulation of NK cells to produce IFN-
. For example, the
up-regulation of inducible NO synthase transcription by treatment of
macrophages with CpG DNA is detected only after pretreatment of
macrophages with IFN-
(11). However, when peritoneal
exudate cells were treated with CpG ODN overnight before nonadherent
cells were removed by washing, the macrophages still exhibited a
down-regulation in HEL processing (data not shown). These results
indicate that, within an 18-h time frame, exposure of other types of
peritoneal exudate cells to CpG ODN does not result in indirect
stimulation of macrophages to up-regulate Ag processing.
One explanation for these results is a model wherein CpG DNA does not up-regulate in vivo Ag presentation by macrophages, but Ag processing and presentation by other APCs may be enhanced in some manner. For instance, dendritic cells are APCs that are stimulated by CpG ODN and LPS to increase expression of MHC-II molecules (15, 16, 26) and therefore may be responsible for an up-regulation in Ag presentation following exposure to bacterial DNA. In fact, recent results have indicated that treatment with CpG ODN produces a transient up-regulation of Ag processing by dendritic cells (26). Together, these data show that there are important differences in the ways that macrophages and dendritic cells respond to CpG ODN, such that CpG ODN produce transient activation of Ag processing and presentation by dendritic cells but produce only inhibitory effects on macrophage Ag processing.
Even though CpG DNA may not increase the Ag processing activity of macrophages, it may activate them for other important functions involved in host resistance to infection. For example, macrophage recognition of CpG DNA from bacteria may increase microbicidal activity as well as cytokine secretion. Thus, down-regulation of macrophage Ag processing by CpG DNA may reflect induction of a macrophage activation state predominated by other beneficial antimicrobial effects, such as cytokine secretion and microbicidal activity.
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Clifford V. Harding, Institute of Pathology, Case Western Reserve University, 2085 Adelbert Road, Cleveland, OH 44106-2622. E-mail address: ![]()
3 Abbreviations used in this paper: MHC-II, class II MHC; ODN, oligodeoxynucleotides; RNase, bovine ribonuclease; HEL, hen egg lysozyme; MIIC, MHC class II compartment; N.I., net intensity. ![]()
Received for publication January 20, 1999. Accepted for publication May 13, 1999.
| References |
|---|
|
|
|---|
-mediated shock. Eur. J. Immunol. 27:1671.[Medline]
production by stimulation of interleukin-12 and tumor necrosis factor-
. Cell. Immunol. 167:72.[Medline]
production is dependent on macrophage secretion of IL-12. Clin. Immunol. Immunopathol. 84:185.[Medline]
differentially regulates antigen processing functions in distinct endocytic compartments of macrophages with constitutive expression of class II MHC molecules. Immunology 87:68.
. Proc. Natl. Acad. Sci. USA 93:2879.This article has been cited by other articles:
![]() |
P. Barrionuevo, J. Cassataro, M. V. Delpino, A. Zwerdling, K. A. Pasquevich, C. G. Samartino, J. C. Wallach, C. A. Fossati, and G. H. Giambartolomei Brucella abortus Inhibits Major Histocompatibility Complex Class II Expression and Antigen Processing through Interleukin-6 Secretion via Toll-Like Receptor 2 Infect. Immun., January 1, 2008; 76(1): 250 - 262. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Wang, G. Roderiquez, T. Jones, P. McPhie, and M. A. Norcross Control of In Vitro Immune Responses by Regulatory Oligodeoxynucleotides through Inhibition of pIII Promoter Directed Expression of MHC Class II Transactivator in Human Primary Monocytes J. Immunol., July 1, 2007; 179(1): 45 - 52. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, E. R. Rayburn, W. Wang, E. R. Kandimalla, S. Agrawal, and R. Zhang Immunomodulatory oligonucleotides as novel therapy for breast cancer: pharmacokinetics, in vitro and in vivo anticancer activity, and potentiation of antibody therapy. Mol. Cancer Ther., August 1, 2006; 5(8): 2106 - 2114. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Pennini, R. K. Pai, D. C. Schultz, W. H. Boom, and C. V. Harding Mycobacterium tuberculosis 19-kDa Lipoprotein Inhibits IFN-{gamma}-Induced Chromatin Remodeling of MHC2TA by TLR2 and MAPK Signaling J. Immunol., April 1, 2006; 176(7): 4323 - 4330. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pai, M. E. Pennini, A. A. R. Tobian, D. H. Canaday, W. H. Boom, and C. V. Harding Prolonged Toll-Like Receptor Signaling by Mycobacterium tuberculosis and Its 19-Kilodalton Lipoprotein Inhibits Gamma Interferon-Induced Regulation of Selected Genes in Macrophages Infect. Immun., November 1, 2004; 72(11): 6603 - 6614. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Switaj, A. Jalili, A. B. Jakubowska, N. Drela, M. Stoksik, D. Nowis, G. Basak, J. Golab, P. J. Wysocki, A. Mackiewicz, et al. CpG Immunostimulatory Oligodeoxynucleotide 1826 Enhances Antitumor Effect of Interleukin 12 Gene-Modified Tumor Vaccine in a Melanoma Model in Mice Clin. Cancer Res., June 15, 2004; 10(12): 4165 - 4175. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Davis, C. V. Maxwell, G. F. Erf, D. C. Brown, and T. J. Wistuba Dietary supplementation with phosphorylated mannans improves growth response and modulates immune function of weanling pigs J Anim Sci, June 1, 2004; 82(6): 1882 - 1891. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Marshall, E. M. Hessel, J. Gregorio, C. Abbate, P. Yee, M. Chu, G. V. Nest, R. L. Coffman, and K. L. Fearon Novel chimeric immunomodulatory compounds containing short CpG oligodeoxyribonucleotides have differential activities in human cells Nucleic Acids Res., September 1, 2003; 31(17): 5122 - 5133. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kuchtey, M. Pennini, R. K. Pai, and C. V. Harding CpG DNA Induces a Class II Transactivator-Independent Increase in Class II MHC by Stabilizing Class II MHC mRNA in B Lymphocytes J. Immunol., September 1, 2003; 171(5): 2320 - 2325. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. R. Tobian, N. S. Potter, L. Ramachandra, R. K. Pai, M. Convery, W. H. Boom, and C. V. Harding Alternate Class I MHC Antigen Processing Is Inhibited by Toll-Like Receptor Signaling Pathogen-Associated Molecular Patterns: Mycobacterium tuberculosis 19-kDa Lipoprotein, CpG DNA, and Lipopolysaccharide J. Immunol., August 1, 2003; 171(3): 1413 - 1422. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Pai, M. Convery, T. A. Hamilton, W. H. Boom, and C. V. Harding Inhibition of IFN-{gamma}-Induced Class II Transactivator Expression by a 19-kDa Lipoprotein from Mycobacterium tuberculosis: A Potential Mechanism for Immune Evasion J. Immunol., July 1, 2003; 171(1): 175 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
U. Kumaraguru, C. D. Pack, and B. T. Rouse Toll-like receptor ligand links innate and adaptive immune responses by the production of heat-shock proteins J. Leukoc. Biol., May 1, 2003; 73(5): 574 - 583. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Jiang, H. J. Baker, and B. F. Smith Mucosal Immunization with Helicobacter, CpG DNA, and Cholera Toxin Is Protective Infect. Immun., January 1, 2003; 71(1): 40 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. He, R. Vemulapalli, and G. G. Schurig Recombinant Ochrobactrum anthropi Expressing Brucella abortus Cu,Zn Superoxide Dismutase Protects Mice against B. abortus Infection Only after Switching of Immune Responses to Th1 Type Infect. Immun., May 1, 2002; 70(5): 2535 - 2543. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Boldrick, A. A. Alizadeh, M. Diehn, S. Dudoit, C. L. Liu, C. E. Belcher, D. Botstein, L. M. Staudt, P. O. Brown, and D. A. Relman Stereotyped and specific gene expression programs in human innate immune responses to bacteria PNAS, January 22, 2002; 99(2): 972 - 977. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. H. Noss, R. K. Pai, T. J. Sellati, J. D. Radolf, J. Belisle, D. T. Golenbock, W. H. Boom, and C. V. Harding Toll-Like Receptor 2-Dependent Inhibition of Macrophage Class II MHC Expression and Antigen Processing by 19-kDa Lipoprotein of Mycobacterium tuberculosis J. Immunol., July 15, 2001; 167(2): 910 - 918. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. H. Dalpke, S. Opper, S. Zimmermann, and K. Heeg Suppressors of Cytokine Signaling (SOCS)-1 and SOCS-3 Are Induced by CpG-DNA and Modulate Cytokine Responses in APCs J. Immunol., June 15, 2001; 166(12): 7082 - 7089. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Askew, R. S. Chu, A. M. Krieg, and C. V. Harding CpG DNA Induces Maturation of Dendritic Cells with Distinct Effects on Nascent and Recycling MHC-II Antigen-Processing Mechanisms J. Immunol., December 15, 2000; 165(12): 6889 - 6895. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Olszewska, C. D. Partidos, and M. W. Steward Antipeptide Antibody Responses following Intranasal Immunization: Effectiveness of Mucosal Adjuvants Infect. Immun., September 1, 2000; 68(9): 4923 - 4929. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |