The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Poudrier, J.
Right arrow Articles by Kosco-Vilbois, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Poudrier, J.
Right arrow Articles by Kosco-Vilbois, M. H.
The Journal of Immunology, 1999, 163: 1153-1161.
Copyright © 1999 by The American Association of Immunologists

A Soluble Form of IL-13 Receptor {alpha}1 Promotes IgG2a and IgG2b Production by Murine Germinal Center B Cells1

Johanne Poudrier*, Pierre Graber*, Suzanne Herren*, Denise Gretener*, Greg Elson*,{dagger}, Claude Berney*, Jean-François Gauchat*,{dagger} and Marie H. Kosco-Vilbois2,*

* Department of Immunology, Serono Pharmaceutical Research Institute, Geneva, Switzerland; and {dagger} Centre d’Immunologie Pierre Fabre, St. Julien-en-Genevois, France


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
A functional IL-13R involves at least two cell surface proteins, the IL-13R{alpha}1 and IL-4R{alpha}. Using a soluble form of the murine IL-13R{alpha}1 (sIL-13R), we reveal several novel features of this system. The sIL-13R promotes proliferation and augmentation of Ag-specific IgM, IgG2a, and IgG2b production by murine germinal center (GC) B cells in vitro. These effects were enhanced by CD40 signaling and were not inhibited by an anti-IL4R{alpha} mAb, a result suggesting other ligands. In GC cell cultures, sIL-13R also promoted IL-6 production, and interestingly, sIL-13R-induced IgG2a and IgG2b augmentation was absent in GC cells isolated from IL-6-deficient mice. Furthermore, the effects of the sIL-13R molecule were inhibited in the presence of an anti-IL-13 mAb, and preincubation of GC cells with IL-13 enhanced the sIL-13R-mediated effects. When sIL-13R was injected into mice, it served as an adjuvant-promoting production to varying degrees of IgM and IgG isotypes. We thus propose that IL-13R{alpha}1 is a molecule involved in B cell differentiation, using a mechanism that may involve regulation of IL-6-responsive elements. Taken together, our data reveal previously unknown activities as well as suggest that the ligand for the sIL-13R might be a component of the IL-13R complex or a counterstructure yet to be defined.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Interleukin-13 is a Th2-type cytokine that shows many overlapping biological effects with those of IL-4 (1, 2, 3, 4). Indeed, like IL-4, IL-13 in both human and mouse systems was found to influence myelopoiesis and regulation of monocyte/macrophage proinflammatory functions (1, 5, 6, 7, 8, 9). Human B cells respond to IL-13 in a fashion similar to IL-4 by up-regulating surface molecules such as MHC II and CD23 and by producing IgG4 and IgE (10, 11, 12, 13, 14). However, in contrast to IL-4, IL-13 does not appear to promote the production of IgG1 and IgE by mouse B cells (3, 4). It has been previously demonstrated that IL-13 does not stimulate the same protein tyrosine kinase activity in LPS-activated murine vs human B cells (15, 16). However, one cannot rule out that these differences may be due to the comparison of different B cell populations.

Until now, two highly conserved IL-13 binding proteins have been cloned, IL-13R{alpha}1 and -{alpha}2, and when coexpressed with IL-4R{alpha}, both can form receptors for IL-4 and IL-13 (17, 18, 19, 20, 21, 22, 23). The extracellular portion of IL-13R{alpha}1 possesses the WSXWS motif (17, 19, 20, 21), which is characteristic of the type I cytokine receptor superfamily (24). IL-13R{alpha}1 has an intracytoplasmic domain in which box 1 and box 3 motifs can be identified (17, 19, 20, 21). Although box 1 has been found to be necessary for binding and activation of Janus protein kinase family members (25), box 3 was shown to be necessary for binding and activation of STAT (26). These properties make it likely that IL-13R{alpha}1 can mediate signaling events. Although IL-13R{alpha}2 is unlikely to have direct signaling capabilities given its very short intracytoplasmic tail, it binds to IL-13 with greater affinity than IL-13R{alpha}1 (18, 22, 23).

Germinal centers (GC)3 are sites essential and necessary for the generation, maturation, and selection of high affinity Ab-bearing memory B cells (27). The B cell differentiation events that take place in GCs require the presence of Ag trapped within immune complexes on the surface of FDCs as well as help delivered from Ag-specific CD4+ Th cells (28, 29, 30). This involves essential signaling events, among which is the CD40-CD40 ligand (CD40L) pathway required for the establishment and maintenance of a GC (30). Indeed, mice rendered deficient for these molecules cannot generate GCs, nor can the B cells be induced to class switch from IgM to other Ig isotypes (31, 32, 33). Numerous molecular interactions are of crucial importance for the GC reaction, and the cross-talk between receptors and their ligands leads to regulation of cellular activation via cytokine release and cytokine receptor expression (34).

When studying IL-13R{alpha}1 surface expression in mouse lymphoid organs from primary and secondary immunizations, we have found that it is confined to B cell areas and to GCs (J. Poudrier, P. Graber, S. Herren, C. Berney, D. Gretener, M. Kosco-Vilbois, and J.-F. Gauchat, manuscript in preparation). Consistently, we also have observed that both human and mouse B cells express IL-13R{alpha}1 (35) (J. Poudrier, P. Graber, S. Herren, C. Berney, D. Gretener, M. Kosco-Vilbois, and J.-F. Gauchat, manuscript in preparation). FDCs, which are known to interact with GC B cells and to be involved in selection and maintenance of the B cell memory repertoire, also express IL-13R{alpha}1 on their surface (J. Poudrier et al., manuscript in preparation). In contrast, no surface expression of IL-13R{alpha}1 could be detected on either resting or activated T cells from both human and mouse systems (35) (J. Poudrier et al., manuscript in preparation). This is consistent with the fact that, in contrast to IL-4, no IL-13 activity has been found for either human or murine T cells (3, 36). Interestingly, we have recently found that a soluble form of IL-13R{alpha}1 is immunoprecipitated from activated human T cell supernatants (35). Soluble forms of IL-13R{alpha}2 have also been identified in mouse urine and serum (22). These observations suggest that their might be other ligands or functions for the IL-13R. Indeed, the data reported here using a soluble form of the murine IL-13R{alpha}1 (sIL-13R) suggest a novel role for this protein in B cell activation and differentiation.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Mice, Ags, and immunizations

Animals were kept under specific pathogen-free conditions. Female BALB/c mice (Janvier, France) were used between 8–12 wk of age. Mice were immunized with alum-precipitated DNP-OVA (37) (100 µg administered s.c.). To obtain a secondary response, mice were given the same immunization at least 14 days postprimary injection (300 µg administered s.c.). For the isolation of GC cells, mice were sacrificed 5 days following a secondary immunization.

Female wild-type (wt) controls (C57BL/6; (Janvier, Le Genest St-Isle, France) and IL-6 deficient (IL-6KO; C57BL/6) mice gifts from Dr. Manfred Kopf (Basel Institute for Immunology, Basel, Switzerland) (38), were used between 8–12 wk of age. Mice received either a single dose of DNP-OVA (300 µg) s.c. and were sacrificed on day 7, or were primed and boosted as stated above and sacrificed on day 5.

Abs and reagents

The Abs and visualizing reagents included GK1.5 (rat anti-mouse CD4), 53.6.78 (rat anti-mouse CD8), T24 (rat anti-mouse Thy 1), and M5-114 (rat anti-mouse MHC II) from the American Type Culture Collection (Manassas, VA). 209 mAb (FDC-M2, rat anti-mouse FDC) (29), goat anti-mouse IgM Texas Red, Cy5-streptavidin, and FITC-streptavidin (Southern Biotechnology Associates, Birmingham, AL); mouse anti-rat IgG F(ab')2-FITC (Jackson ImmunoResearch Laboratories, West Grove, PA); and rat IgG2b anti-mouse IL-13 (R&D Systems, Abingdon, U.K.). The rat IgG2b anti-mouse IL-6 mAb as well as a biotinylated anti-IL-6 Ab used for detection of IL-6 by ELISA were purchased from PharMingen (San Diego, CA). The rat IgG2b anti-mouse IL-6R{alpha} and rat IgG2b anti-mouse neutralizing IL-4R{alpha} mAbs were obtained from Genzyme (Cambridge, MA). The neutralizing activity of the anti-IL-4R{alpha} mAb was verified on the IL-4-dependent cell line CT4S (data not shown). FGK-45 (rat anti-mouse CD40) was a gift from Dr. T. Rolink (Basel Institute for Immunology). The murine rIL-2 protein was generated in-house. Mouse rIL-4 was purchased from ImmunoKontact (Frankfurt am Main, Germany), while rIL-6 and rIL-13 were obtained from PharMingen and R&D Systems, respectively. The generation of the soluble human CD40 ligand (sCD40L) has been reported previously (39). Rat IgG1, rat IgG2a, and rat IgG2b (Serotec, Oxford, U.K.) were used for isotype controls (data not shown).

mRNA for IL-6

Semiquantitative RT-PCR was performed as described previously (40, 41).

Production of rsIL-13R

-Source of cells and culture conditions. The cell lines HEK-293, COS7, and Sf9 were obtained from the American Type Culture Collection and cultured according to their specifications. The EBNA-1-expressing HEK-293 derivative was maintained according to the instructions of the supplier (Invitrogen, Leek, The Netherlands).

Production of sIL-13R. To produce a cDNA derivative encoding a tagged form of the cytoplasmic region of the mouse IL-13R{alpha}1, murine spleen cDNA (17) was subjected to RT-PCR using a mix of the primers AGGGCCTGCAGGCGCGGCCAGCGCTGCTG and AAATCTTCACAGGGTCACATTGAAGGCAAG. The amplified mouse IL-13R{alpha}1 cDNA was cloned into the vector pCR2.1 (Invitrogen) and fully sequenced. To generate a cDNA derivative encoding a soluble derivative of mIL-13R{alpha}1, the cDNA fragment in pCR2.1 was digested with the restriction enzymes AccI and BamHI and ligated to a synthetic DNA fragment:

1 CTACACAGTC AGAGTAAGAG TCAAAACAAA CAAGTTATGC TTTGATGACA ACAAACTGTG

TGTGTCAG TCTCATTCTC AGTTTTGTTT GTTCAATACG AAACTACTGT TGTTTGACAC

61 GAGTGATTGG AGTGAAGCAC AGAGTATAGG TAAGGAGCAA AACTCCACCC ATCACCATCA

CTCACTAACC TCACTTCGTG TCTCATATCC ATTCCTCGTT TTGAGGTGGG TAGTGGTAGT

121 CCATCACTGC CTCGAACCCT ACACCGCCTG CGACTGAG

GGTAGTGACG GAGCTTGGGA TGTGGCGGAC GCTGACTCCTAG

which had been produced by annealing and ligation of 5' phosphorylated oligonucleotides. The insert was checked by DNA sequencing. The modified cDNA encodes for the extracellular domain of the murine IL-13R{alpha}1 followed by six histidines and the tag CLEPYTACD, an epitope recognized by a specific mAb (mAb 179, Affymax, Palo Alto, CA). The soluble murine IL-13R{alpha}1 cDNA insert was recloned in pFastBac1 (Life Technologies, Basel, Switzerland) using the restriction enzymes KpnI and NotI.

Recombinant baculovirus was generated with a BAC-TO-BAC kit (Life Technologies) and used to infect SF-9 cells expanded in SF900II medium (Life Technologies). The SF-9 culture medium was concentrated, filtered, and applied to a column packed with 50 ml of Ni-NTA-resin (Qiagen, Basel, Switzerland) pre-equilibrated in 50 mM Tris-HCl (pH 7.5), 300 mM NaCl, and 10% glycerol; buffer I). The resin was first washed with 500 ml of buffer I supplemented with 0.1% (w/v) Tween-20, followed by a second 500-ml wash with buffer I. The bound proteins were eluted with buffer I containing 500 mM imidazol. The eluate was then dialyzed against 0.1 M Tris-HCl (pH 7.5). The recovered fraction contained ~80% of monomeric sIL-13R{alpha}1 as verified by SDS-PAGE. The LPS content measured as described previously (42) was 1.6 EU/mg. To use the molecule in bioassays, the sIL-13R was generated to be LPS free, as reported previously (35). N-terminal sequencing was conducted on all batches of sIL-13R used for experiments and was found to be identical (m.w., 40 435.46). Purity was further determined by mass spectrometry, HPLC, and an IL-6-specific ELISA. In all these tests, the sIL-13R aliquots were free of all other proteins. The production of the soluble human IL-13R{alpha}1 has been recently reported (35). This soluble form comprises the extracellular domain of the receptor fused to the tag HHHHHHCLEPYTACD.

Isolation of GC cells and low density B cells

GC cells were isolated from draining lymph nodes (LNs) of mice that had been primed or primed and boosted with OVA or DNP-OVA, according to the procedures described previously (43). Briefly, following enzymatic digestion with collagenase 4188 (Worthington Biomedical, Freehold, NJ) plus DNase I (Sigma, St. Louis, MO), the low density (1.060–1.065 g/ml) cells were isolated on Percoll (Pharmacia, Uppsala, Sweden) gradients, and adherent cells were removed following a 1-h incubation at 37°C. The resulting population has been previously shown to contain >75% B cells, 10% T cells, 10% FDC, and <5% tingible body macrophages (43).

For isolation of low density (LD) B cells, spleens or LNs from immunized mice were mechanically disrupted to prevent isolation of FDCs. The B cells were isolated on Percoll gradients followed by a 1-h incubation at 37°C. Further purification involved the depletion of T cells using magnetic beads (Dynabeads, Dynal, Oslo, Norway) coupled to anti-mouse CD4 (GK1.5), CD8 (53.6.78), and Thy1 (T24) mAbs. This resulted >99% MHC II+ B cells.

Assessment of proliferation and Ag-specific Ab production

GC cells or LD B cells were cultured in round-bottom 96-well plates at a density of 2 x 105 cells/well, in Iscove’s modified Dulbecco’s medium (Life Technologies, Paisley, Scotland) supplemented with 5% FCS (CanSera, Rexdale, Ontario), L-glutamine (Life Technologies), 2-ME, and antibiotics. Proliferation was assessed by the incorporation of [3H]thymidine (Amersham, Aylesbury, U.K.) for the final 18 h of a 42-h culture period.

Ab titers in day 7 cell culture supernatants were assayed by using standard ELISA procedures. Briefly, DNP- or OVA-specific Abs were detected using either DNP-BSA or OVA (1 µg/ml)-coated flat-bottom 96-well plates (Nalge Nunc International, Naperville, IL), respectively. HRP-coupled goat anti-mouse IgM, IgG1, IgG2a, and IgG2b Abs (Southern Biotechnology Associates) were used to reveal individual Ig isotypes. O-phenylenediamine (Sigma) was used as the substrate. Data are represented as OD read out at 490/570 nm. For all experiments, an inactivated form of sIL-13R was added to the cultures and was shown to have no effect (data not shown).

Assessing sIL-13R activity in vivo

The sIL-13R was injected into wt and IL-6KO mice, according to the following protocol. On day 0, mice received 200 µg of OVA s.c. together with 100 µg of either sIL-13R or an inactivated form of sIL-13R (boiled at 100°C for 10 min). On days 2 and 4, 100 µg of either sIL-13R or inactivated sIL-13R was injected s.c. Mice were then sacrificed on day 7 after the primary immunization.

Detection of sIL-13R binding by FACS

GC cells were incubated with the tagged sIL-13R (40 µg/ml) for 1 h on ice. Binding was subsequently revealed using the biotinylated anti-Tag mAb 179 and FITC-streptavidin. Immunolabeling was performed on ice in FACS buffer (1x PBS, 1% BSA, and 0.01% sodium azide), and the fluorescence intensity was analyzed using a FACSCalibur (Becton and Dickinson, San Jose, CA).

Statistics

Statistical analyses were performed according to Student’s t tests.


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
The sIL-13R promotes IgG2a and IgG2b isotype production by murine GC cells

To explore the possible role of IL-13R in B cell activation, the effect of sIL-13R was investigated using murine GC cells. As shown in Fig. 1Go, the addition of sIL-13R enhanced the ability of GC cells to produce Ag-specific IgM, IgG2a, and IgG2b. Furthermore, CD40 stimulation slightly enhanced this effect. In contrast, IgG1 production was not influenced by sIL-13R, with or without CD40 costimulation (for p values, see Fig. 1Go).



View larger version (19K):
[in this window]
[in a new window]
  		FIGURE 1. sIL-13R promotes IgG2a and IgG2b production by mouse GC cells in vitro. A–E, GC cells were isolated from the draining LNs of mice immunized with DNP-OVA. The GC cells were cultured with either medium alone or sIL-13R (10 µg/ml) in the presence or the absence of either an anti-CD40 (10 µg/ml; A–D) or a neutralizing anti-IL-4R{alpha} mAb (10 µg/ml; E). Levels of DNP-specific Abs in the supernatant after 7 days of culture were determined by ELISA. The results are representative of nine replicate experiments. Statistical analysis revealed that the effects of adding sIL-13R were significant (t test values: *, p = 0.004 for IgM, p = 0.002 for IgG2a, p = 0.04 for IgG2b, and p = 0.08 for IgG1). All others were not significant except in C, where anti-CD40 together with sIL-13R was slightly higher (**, p = 0.03). F–G, The IL-4-dependent CT4S (F) and the IL-2-dependent CTLL (G) cell lines were cultured with titrating amounts of rIL-4 (F) or with 6 ng/ml rIL-2 (G), respectively, in the presence or the absence of sIL-13R (10 µg/ml) for 24 h, after which time [3H]thymidine ([3H]TdR) was added at 1 µCi/ml for 18 h. Cells were then harvested, and proliferation was assessed. Results are represented as incorporation of [3H]TdR (counts per minute) and are representative of three different experiments.

 
Because IL-13R{alpha}1 has been reported to associate with the IL-4R{alpha}1 chain (44), the effect of blocking with a neutralizing anti-IL-4R{alpha} mAb was tested. However, this had no effect on the sIL-13R activity (Fig. 1GoE). This result is in agreement with the observation that sIL-13R does not bind to IL-4R{alpha}-transfected cells (data not shown).4 Furthermore, sIL-13R did not increase the proliferative response by the IL-4-dependent cell line, CT4S (Fig. 1GoF). Finally, sIL-13R had no effect on the IL-2-dependent parent cell line, CTLL (Fig. 1GoG). These results show that sIL-13R does not compete or synergize with IL-4 for signaling in an IL-4R{alpha}-dependent manner.

The sIL-13R activity is linked to IL-6

It has been reported that both IgG2a and IgG2b secretion are selectively impaired in IL-6KO mice (45). These results prompted us to investigate whether sIL-13R was working through a pathway involving IL-6. The results presented in Fig. 2Go show that blocking IL-6 responses using either anti-IL-6R- or anti-IL-6-neutralizing mAbs impaired in vitro production of IgG2a and IgG2b by GC cells without similarly affecting IgG1 production. IgM production was also decreased by both mAbs (data not shown). The sIL-13R activity was decreased in the presence of these mAbs, suggesting that the sIL-13R might use an IL-6-dependent pathway. Isotype control mAbs did not generate this effect (data not shown).



View larger version (14K):
[in this window]
[in a new window]
  		FIGURE 2. The sIL-13R promotes IgG2a and IgG2b production in an IL-6-dependent manner. GC cells were cultured with either medium alone or with sIL-13R (10 µg/ml) in the presence or the absence of either anti-IL-6R or anti-IL-6 neutralizing mAbs (10 µg/ml). The presence of DNP-specific isotypes in 7-day culture supernatants was detected by ELISA. The results are representative of four experiments. (*, p <0.005).

 
The sIL-13R binds to GC cells and promotes IL-6 secretion

By flow cytometry, it was determined that the large GC cell population could bind sIL-13R after culture for 24 and 48 h (data not shown and Fig. 3GoA). In addition, IL-6 production was increased by a mean of 30% when GC cells were cultured with sIL-13R (Fig. 3GoB). The level of IL-6 ranged from 1–25 ng/ml. These results concur with our recent findings that the recombinant human sIL-13R molecule binds to human monocytes and promotes IL-6 production (see Footnote 4). Finally, CD40 stimulation also promoted IL-6 secretion and together with sIL-13R triggered a greater production than either stimulus alone (Fig. 3GoB). The data were confirmed by PCR analysis at the RNA level (data not shown).



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 3. The sIL-13R binds to GC cells and promotes IL-6 production. A, GC cells cultured for 2 days were incubated with sIL-13R followed by the biotinylated mAb 179 (anti-Tag) and FITC-streptavidin. Gating on the large blast cell population using FACS revealed sIL-13R binding (open area) vs the control (filled area; mAb 179 and FITC-streptavidin alone). B, The sIL-13R promotes IL-6 secretion in GC cultures. GC cells were cultured with and without sIL-13R (10 µg/ml), in the presence or the absence of CD40 stimulation (anti-CD40, 10 µg/ml). The level of IL-6 in 7-day culture supernatants was measured by ELISA and compared with that in a standard rIL-6 control culture. The data are representative of four experiments. *, p <0.005 between medium alone/sIL-13R; **, p <0.015 between sIL-13R/sIL-13R and anti-CD40).

 
GC cells from IL-6ko mice are unresponsive to sIL-13R

Considering our observations that sIL-13R promoted the production of both IgG2a and IgG2b, and that this effect could be neutralized with anti-IL-6 reagents, GC cells isolated from IL-6-deficient mice were studied. As shown in Fig. 4GoA, the sIL-13R-mediated effect was only observed in the presence of rIL-6. Similar results were obtained for IgG2a responses (data not shown). In addition, in cultures of purified B cells that do not secrete IL-6 (data not shown, (45), sIL-13R was effective only in the presence of exogenous IL-6 (Fig. 4GoB).



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 4. IL-6 is necessary for the sIL-13R effect on IgG2a and IgG2b production in vitro. A, GC cells isolated from IL-6KO mice were incubated with or without sIL-13R (10 µg/ml) and rIL-6 (10 ng/ml). DNP-specific Ab levels in day 7 GC cell culture supernatants were assayed by ELISA. *, p <0.005 compared with medium alone (MA)). B, Purified LD B cells were incubated with or without sIL-13R (10 µg/ml) and rIL-6 (10 ng/ml). DNP-specific Ab levels in day 7 culture supernatants were assayed by ELISA. *, p = 0.002 for IgG2a, between rIL-6/rIL-6 + sIL-13R; **, p = 0.003 for IgG2b, between rIL-6/rIL-6 and sIL-13R). A and B are representative of four experiments.

 
Effect of injecting sIL-13R in vivo

To further study the effect of sIL-13R, mice were immunized with OVA in the presence of sIL-13R or the denatured protein as a control. As shown in Fig. 5Go, up-regulation of IgM, IgG2a, and IgG2b production was observed in GC cells isolated from wt and IL-6KO mice injected with both sIL-13R and Ag compared with that in cells from mice given the inactivated form. Surprisingly, the sIL-13R had opposite effects on IgG1 levels, with an enhancement in the IL-6KO cells vs a decrease in cells in wt mice. Taken together, these experiments suggest that sIL-13R might act as an adjuvant for Ab production. The mechanism may be associated with regulating members of the IL-6R/gp130 family or, alternatively, an unknown counterstructure that also uses IL-6 signaling pathways.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 5. Effect of injecting sIL-13R in vivo. The wt and IL-6KO mice were immunized with OVA (100 µg/mouse; day 0) and coinjected with either sIL-13R or an inactivated form of sIL-13R (100 µg/injection; days 0, 2, and 4). Mice were sacrificed on day 7, and GC cells were isolated from draining LNs. Cells were cultured for 7 days, and the OVA-specific Ab levels within these supernatants were assayed by ELISA. The results are representative of the mean for three mice per group. ***, p = 0.005; **, p = 0.003; *, p = 0.002 (compared with the control group).

 
Proliferative responses induced by sIL-13R are not IL-6 dependent

Next, the effect of sIL-13R on GC cell proliferation was assessed. In contrast to the in vitro effects of sIL-13R on Ab production, sIL-13R augmented the proliferation of GC cells isolated from either wt or IL-6KO mice (Fig. 6GoA). The sIL-13R-induced proliferation was also not inhibited by blocking of the IL-4R{alpha} (Fig. 6GoB). Similarly, purified LD B cells were also induced to proliferate with sIL-13R in the absence of IL-6 (data not shown).



View larger version (15K):
[in this window]
[in a new window]
  		FIGURE 6. The sIL-13R-induced proliferative responses occur independently of IL-6. GC cells isolated from wt (A and B) and IL-6KO mice (A) were cultured with either medium alone or with mouse sIL-13R (10 µg/ml; A and B) in the presence or the absence of neutralizing anti-IL-4R{alpha} mAb used at 10 µg/ml (B). [3H]thymidine ([3H]TdR) incorporation (counts per minute) was measured after 2 days. *, p < 0.005 compared with medium alone.

 
IL-13 is involved in the sIL-13R-mediated increase of IgG2a and IgG2b

The possible involvement of IL-13 in generating the sIL-13R effects was assessed. As shown in Fig. 7GoA, the sIL-13R-mediated increase in both IgG2a and IgG2b secretion by GC cells was inhibited in the presence of a neutralizing anti-IL-13 mAb. IgG1 production was not affected. This suggested that the ligand to which sIL-13R binds may involve IL-13. To test this hypothesis GC cells were preincubated with IL-13 for 1 h, and then the sIL-13R was added. As shown in Fig. 7GoB, this protocol greatly enhanced the effect of sIL-13R alone. IgG1 levels were not affected. This increase in IgG2a and IgG2b production by cells preincubated with IL-13 may be the consequence of receptor-ligand interactions that involve IL-13 on either B cells or other cell types within the GC cultures.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 7. The effects of sIL-13R are related to the presence of IL-13. GC cells isolated from wt mice were incubated with or without sIL-13R (10 µg/ml; A and B) in the presence or the absence of a neutralizing anti-IL-13 mAb (10 µg/ml; A) or rIL-13 (10 ng/ml) that had been preincubated with the GC cells for 1 h on ice before culture (IL-13; B). The presence of DNP-specific Ab levels in day 7 supernatants was assayed by ELISA. *, p < 0.005 compared with sIL13R alone.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In an attempt to understand the biological significance of the IL-13R in B cell activation, a soluble form of the IL-13R{alpha}1 chain was generated. Using this, we observed that LD B and GC cell proliferation is induced and IgM, IgG2a, and IgG2b production is promoted, without modifying IgG1 secretion. The results from the in vitro experiments at first suggested that sIL-13R signaling was dependent on IL-6. However, as IgG2a and IgG2b responses were reconstituted in IL-6KO mice that had been injected with sIL-13R, and also that sIL-13R induced proliferation of IL-6KO GC cells and purified LD B cells, the latter incapable of producing IL-6, the data, rather, support a role for sIL-13R in regulating the expression of IL-6R/gp130 family components. Indeed, the increased Ab production obtained following in vivo administration of sIL-13R in an IL-6-deficient environment may reflect the activity of other molecules that use IL-6R/gp130, such as IL-11, leukocyte inhibitory factor (LIF), oncostatin M (OSM), cardiotrophin-1 (CT-1), and ciliary neurotrophic factor (CNTF) receptors (46). Thus, we do not favor the idea that sIL-13R directly regulates IL-6 production. Instead, sIL-13R probably affects the IL-6R/gp130 complex, affecting IL-6 in an autocrine fashion.

The nature of the ligand for the soluble form of IL-13R has yet to be defined. However, our results suggest that it may involve IL-13 already complexed to the cell surface of GC cells. This may be via the membrane form of IL-13R{alpha}1, especially given its specific distribution to GC B cells and FDCs (J. Poudrier et al., manuscript in preparation). Our results are consistent with an IL-4R{alpha}-independent IL-13R-mediated signaling, because the neutralizing anti-IL-4R{alpha} mAb did not block the effects generated by sIL-13R. The plausibility of an IL-4R{alpha}-independent mechanism is consistent with the intracytoplasmic characteristics of IL-13R{alpha}1. It possesses box 1-like and box 3-like motifs (17, 19, 20, 21), necessary for binding to Janus protein kinase (25) and activation of STAT3 (47), respectively. Interestingly, STAT3 is involved in gp130 signaling for regulation of IL-6 responsiveness (46, 48). This alternative receptor complex for IL-13 is possibly activated upon homodimerization and/or heterodimerization with other chains yet to be characterized. In the model presented here, sIL-13R may segregate membrane IL-13R{alpha}1 from its usual partner, IL-4R{alpha} (44), and provide alternative signals to GC cells than that of IL-4 (4).

A possible contribution of IL-13R{alpha}2 in the type I IL-13R is presently under investigation. Interestingly, there is increasing evidence that IL-13R{alpha}2 is present in human tonsilar GC B cells (21, 49). Although IL-13R{alpha}2 does not appear to possess signaling capabilities, it could be important for strengthening binding to IL-13, as has recently been demonstrated for mouse IL-13R{alpha}2 (23). Our views are shared by those of Donaldson et al. (23), whereby IL-13R{alpha}2 may have a complementary role with membrane IL-13R{alpha}1 in facilitating the formation of a high affinity IL-13R signaling complex. The possibility that sIL-13R binds directly to IL-13R{alpha}1 or IL-13R{alpha}2 chains has been ruled out by binding experiments on transfectants (see Footnote 4; J.-F. Gauchat, unpublished observations). However, it is possible that either IL-13 or another component is required to generate a complex involving sIL-13R that would bind to these surface receptors.

Until now, the similarities between IL-4 and IL-13 activities have been explained by the fact that both IL-4 and IL-13 can signal through the type II IL-4R. This is composed of the IL-4R{alpha} and IL-13R{alpha}1 chains (44). However, the possibility that the IL-13R{alpha}1 may provide STAT3 signaling elements could reconcile observations for the distinctive biological patterns seen between IL-4 and IL-13. For example, it has been shown recently that the clearing of certain pathogens was IL-13, rather than IL-4, dependent (50, 51, 52, 53). In contrast to IL-4-deficient mice (IL-4KO), IL-13-deficient mice (IL-13KO) could not clear certain strains of nematodes (51, 53), a phenotype shared by the IL-4R{alpha}-deficient (IL-4R{alpha}KO) (50, 52) and STAT6-deficient mice (STAT6KO) (52). These observations suggest that an IL-13-dependent signaling must occur that is undeliverable by IL-4.

The effects of sIL-13R are biologically significant, because a soluble form of IL-13R{alpha}1 exists physiologically (35). However, these observations may also mimic homotypic interactions between GC B cells that express IL-13R{alpha}1 on their surface (J. Poudrier et al., manuscript in preparation) and/or heterotypic interactions involving GC B cells and FDCs. Given our observation that sIL-13R increases IL-6 production by GC cells in vitro, it is possible that binding of sIL-13R on FDCs regulates IL-6 production by potentiating the expression of IL-6R/gp130 family components. The increased IL-6R/gp130 expression by B cells then allows for the production of more IgG2a and IgG2b isotypes in response to IL-6. The fact that these isotypes are generated later in GC cell reactions is consistent with an additional round of proliferation induced by sIL-13R and the requirement for this event to induce Ig class switching (54).

These results are consistent with those of other reports showing that IL-13 can promote IL-6 production. Indeed, in vivo administration of IL-13 to mice augmented the production of IL-6 (55, 56). The effect of IL-13 in potentiating IL-6 production has also been shown in human endothelial cells (57) and human keratinocytes (58), whereas decreased IL-6 production was observed in human monocytes (1). The overall effect of IL-13 on both murine and human IL-6 production appears to vary depending on the cell population studied. Based on our data, these effects may not be direct but, instead, occur via the regulation of receptors or ligands necessary for such events to occur.

We thus provide evidence for an IL-4R{alpha}-independent, type I IL-13R. This IL-13R seems to allow for murine B cells to respond to IL-13 and appears to be a likely candidate as a B cell differentiation molecule involved in secluded GC reactions and possibly regulating events taking place during B cell maturation. Indeed, the expression of IL-13R{alpha}1 within lymphoid organs is restricted to B cell follicles and GCs, and B cell-specialized DCs such as FDCs, but not T cells or interdigitating DCs (J. Poudrier et al., manuscript in preparation).

The observation that mice injected with sIL-13R deviate their Ag-specific Ab production toward IgG2a and IgG2b is of interest in the field of IgE-mediated asthma. Given that IgG2a and IgG2b are the most potent at fixing complement (45), understanding the sIL-13R pathway is also of interest for defining antiviral vaccination strategies.


   Acknowledgments
 
We thank Laurent Potier and Roberto Lia for animal care assistance, and Dr. Manfred Kopf for providing the IL-6KO mice and for his comments on this manuscript.


   Footnotes
 
1 J.P. is a Medical Research Council of Canada postdoctoral fellow.<./> Back

2 Address correspondence and reprint requests to Dr. Marie H. Kosco-Vilbois, Department of Immunology, Serono Pharmaceutical Research Institute, 14 Chemin des Aulx, CH-1228 Plan-les-Ouates, Geneva, Switzerland. E-mail address: Back

3 Abbreviations used in this paper: GC, germinal center; sIL-13R, soluble IL-13 receptor; LD, low buoyant density; IL-6KO, IL-6 deficient; wt, wild type; CD40L, CD40 ligand; FDC, follicular dendritic cell; LN, lymph node. Back

4 D. Gretener, P. Graber, J.-P. Aubry, J. Poudrier, G. Elson, C. Losberger, T.Wells, J.-Y. Bonnefoy, M. Kosco-Vilbois, and J.-F. Gauchat. 1999. Human IL-13R{alpha}1 binds activated monocytes and modulates monokine release. Submitted for publication. Back

Received for publication October 27, 1998. Accepted for publication May 11, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Minty, A., P. Chalon, J. M. Derocq, X. Dumont, J. C. Guillemot, M. Kaghad, C. Labit, P. Leplatois, P. Liauzun, B. Miloux, et al 1993. Interleukin-13 is a new human lymphokine regulating inflammatory and immune responses. Nature 362:248.[Medline]
  2. Zurawski, S. M., F. J. Vega, B. Huyghe, G. Zurawski. 1993. Receptors for interleukin-13 and interleukin-4 are complex and share a novel component that functions in signal transduction. EMBO J. 12:2663.[Medline]
  3. Zurawski, G., J. E. de Vries. 1994. Interleukin 13, an interleukin 4-like cytokine that acts on monocytes and B cells, but not on T cells. Immunol. Today 15:19.[Medline]
  4. Chomarat, P., J. Bancherau. 1997. An update on interleukin-4 and its receptor. Eur. Cytokine Network 8:333.[Medline]
  5. deWaal Malefyt, R., C.G. Figdor, R. Huijbens, S. Mohan-Peterson, B. Bennett, J. Culpepper, W. Dang, G. Zurawski, J. E. deVries. 1993. Effects of IL-13 on phenotype, cytokine production, and cytotoxic function of human monocytes: comparison with IL-4 and modulation by IFN-{gamma} or IL-10. J. Immunol. 151:6370.[Abstract]
  6. Andersson, A., S. M. Grunewald, A. Duschl, A. Fischer, J. P. DiSanto. 1997. Mouse macrophage development in the absence of the common {gamma} chain: defining receptor complexes responsible for IL-4 and IL-13 signaling. Eur. J. Immunol. 27:1762.[Medline]
  7. Doherty, T. M., R. Kastelein, S. Menon, S. Andrade, R. L. Coffman. 1993. Modulation of murine macrophage function by IL-13. J. Immunol. 151:7151.[Abstract]
  8. Jacobsen, S. E. W., C. Okkenhaug, O. P. Veiby, D. Caput, P. Ferrara, A. Minty. 1994. Interleukin 13: novel role in direct regulation of proliferation and differentiation of primitive hematopoietic progenitor cells. J. Exp. Med. 180:75.[Abstract/Free Full Text]
  9. Nicoletti, F., G. Mancuso, V. Cusumano, R. DiMarco, P. Zaccone, K. Bendtzen, G. Teti. 1997. Prevention of endotoxin-induced lethality in neonatal mice by interleukin-13. Eur. J. Immunol. 27:1580.[Medline]
  10. Lebman, D. A., R. L. Coffman. 1988. Interleukin 4 causes isotype switching to IgE in T cell-stimulated clonal B cell cultures. J. Exp. Med. 168:853.[Abstract/Free Full Text]
  11. Pene, J., F. Rousset, F. Briere, I. Chretien, J. Y. Bonnefoy, H. Spits, T. Yokota, N. Arai, K. Arai, J. Banchereau, et al 1988. IgE production by normal human lymphocytes is induced by interleukin 4 and suppressed by interferons {gamma} and {alpha} and prostaglandin E2. Proc. Natl. Acad. Sci. USA 85:6880.[Abstract/Free Full Text]
  12. Punnonen, J., G. Aversa, B. G. Cocks, A. N. McKenzie, S. Menon, G. Zurawski, R. de Waal Malefyt, J. E. de Vries. 1993. Interleukin 13 induces interleukin 4-independent IgG4 and IgE synthesis and CD23 expression by human B cells. Proc. Natl. Acad. Sci. USA 90:3730.[Abstract/Free Full Text]
  13. Defrance, T., P. Carayon, G. Billian, J. C. Guillemot, A. Minty, D. Caput, P. Ferrara. 1994. Interleukin 13 is a B cell stimulating factor. J. Exp. Med. 179:135.[Abstract/Free Full Text]
  14. McKenzie, A. N., J. A. Culpepper, R. de Waal Malefyt, F. Briere, J. Punnonen, G. Aversa, A. Sato, W. Dang, B. G. Cocks, S. Menon, et al 1993. Interleukin 13, a T-cell-derived cytokine that regulates human monocyte and B-cell function. Proc. Natl. Acad. Sci. USA 90:3735.[Abstract/Free Full Text]
  15. Welham, M. J., L. Learmonth, H. Bone, J. W. Schrader. 1995. Interleukin-13 signal transduction in lymphohemopoietic cells: similarities and differences in signal transduction with interleukin-4 and insulin. J. Biol. Chem. 270:12286.[Abstract/Free Full Text]
  16. Orchansky, P., S. D. Ayres, D. J. Hilton, J. W. Schrader. 1997. An interleukin (IL)-13 receptor lacking the cytoplasmic domain fails to transduce IL-13-induced signals and inhibits responses to IL-4. J. Biol. Chem. 272:22940.[Abstract/Free Full Text]
  17. Hilton, D. J., J. G. Zhang, D. Metcalf, W. S. Alexander, N. A. Nicola, T. A. Willson. 1996. Cloning and characterization of a binding subunit of the interleukin 13 receptor that is also a component of the interleukin 4 receptor. Proc. Natl. Acad. Sci. USA 93:497.[Abstract/Free Full Text]
  18. Caput, D., P. Laurent, M. Kaghad, J. M. Lelias, S. Lefort, N. Vita, P. Ferrara. 1996. Cloning and characterization of a specific interleukin (IL)-13 binding protein structurally related to the IL-5 receptor {alpha} chain. J. Biol. Chem. 271:16921.[Abstract/Free Full Text]
  19. Aman, M. J., N. Tayebi, N. I. Obiri, R. K. Puri, W. S. Modi, W. J. Leonard. 1996. cDNA cloning and characterization of the human interleukin 13 receptor {alpha} chain. J. Biol. Chem. 271:29265.[Abstract/Free Full Text]
  20. Miloux, B., P. Laurent, O. Bonnin, J. Lupker, D. Caput, N. Vita, P. Ferrara. 1997. Cloning of the human IL-13R{alpha}1 chain and reconstitution with the IL4R{alpha} of a functional IL-4/IL-13 receptor complex. FEBS Lett. 401:163.[Medline]
  21. Gauchat, J.-F., E. Schlagenhauf, N. P. Feng, R. Moser, M. Yamage, P. Jeannin, S. Alouani, G. Elson, L. D. Notarangelo, T. Wells, et al 1997. A novel 4-kb interleukin-13 receptor {alpha} mRNA expressed in human B, T, and endothelial cells encoding an alternate type-II interleukin-4/interleukin-13 receptor. Eur. J. Immunol. 27:971.[Medline]
  22. Zhang, J. G., D. J. Hilton, T. A. Willson, C. McFarlane, B. A. Roberts, R. L. Moritz, R. J. Simpson, W. S. Alexander, D. Metcalf, N. A. Nicola. 1997. Identification, purification, and characterization of a soluble interleukin (IL)-13-binding protein: evidence that it is distinct from the cloned Il-13 receptor and Il-4 receptor {alpha}-chains. J. Biol. Chem. 272:9474.[Abstract/Free Full Text]
  23. Donaldson, D. D., M. J. Whitters, L. J. Fitz, T. Y. Neben, H. Finnerty, S. L. Henderson, Jr R. M. O’Hara, D. R. Beier, K. J. Turner, C. R. Wood, et al 1998. The murine IL-13 receptor {alpha}2: molecular cloning, characterization, and comparison with murine IL-13 receptor {alpha}1. J. Immunol. 161:2317.[Abstract/Free Full Text]
  24. Bazan, J. F.. 1990. Structural design and molecular evolution of a cytokine receptor superfamily. Proc. Natl. Acad. Sci. USA 87:6934.[Abstract/Free Full Text]
  25. Tanner, W. J., W. Chen, R. L. Young, G. D. Longmore, A. S. Shaw. 1995. The conserved box1 motif of cytokine receptors is required for association with JAK kinases. J. Biol. Chem. 270:6523.[Abstract/Free Full Text]
  26. Stahl, N., T. J. Farruggella, T. G. Boulton, Z. Zhong, Jr J. E. Darnell, G. D. Yancopoulos. 1995. Choice of STATs and other substrates specified by modular tyrosine-based motifs in cytokine receptors. Science 267:1349.[Abstract/Free Full Text]
  27. MacLennan, I. C.. 1994. Germinal centers. Annu. Rev. Immunol. 12:117.[Medline]
  28. Kosco-Vilbois, M., J.-Y. Bonnefoy, Y. Chvatchko. 1997. The physiology of murine germinal center reactions. Immunol. Rev. 156:127.[Medline]
  29. Kosco-Vilbois, M., H. G. J. a. B. J. Y. Zentgraf. 1997. To "B" or not to "B" a germinal center?. Immunol. Today 18:225.[Medline]
  30. Gray, D., S. Bergthorsdottir, D. vanEssen, M. Wykes, J. Poudrier, K. Siepmann. 1997. Observations on memory B-cell development. Semin. Immunol. 9:249.[Medline]
  31. Kawabe, T., T. Naka, K. Yoshida, T. Tanaka, H. Fujiwara, S. Suematsu, N. Yoshida, T. Kishimoto, H. Kikutani. 1994. The immune responses in CD40-deficient mice: impaired immunoglobulin class switching and germinal center formation. Immunity 1:167.[Medline]
  32. Xu, J., T. M. Foy, J. D. Laman, E. A. Elliot, J. J. Dunn, T. J. Waldschmidt, J. Elsemore, R. J. Noelle, R. A. Flavell. 1994. Mice deficient for CD40 ligand. Immunity 1:423. (Abstr.). [Medline]
  33. Grewal, I. S., J. Xu, R. A. Flavell. 1995. Impairment of antigen-specific T-cell priming in mice lacking CD40 ligand. Nature 378:617.[Medline]
  34. Clark, E. A., J.A. Ledbetter. 1994. How B and T cells talk to each other. Nature 367:425.[Medline]
  35. Graber, P., D. Gretener, S. Herren, J.-P. Aubry, G. Elson, J. Poudrier, S. Lecoanet-Henchoz, C. Alouani, C. Losberger, J.-Y. Bonnefoy, et al 1998. The distribution of IL-13R1 expression by B cells, T cells and monocytes and its regulation by IL-13 and IL-4. Eur. J. Immunol. 28:4286.[Medline]
  36. deVries, J. E., G. Zurawski. 1995. Immunoregulatory properties of IL-13: its potential role in atopic disease. Int.l Arch. Allergy Immunol. 106:175.[Medline]
  37. Gray, D., M. Kosco, B. Stockinger. 1991. Novel pathways of antigen presentation for the maintenance of memory. Int. Immunol. 3:141.[Abstract/Free Full Text]
  38. Kopf, M., H. Baumann, G. Freer, M. Freudenberg, M. Lamers, T. Kishimoto, R. Zinkernagel, H. Bluethmann, G. Kohler. 1994. Impaired immune and acute-phase responses in interleukin-6-deficient mice. Nature 368:339.[Medline]
  39. Mazzei, G. J., M. D. Edgerton, C. Losberger, S. Lecoanet-Henchoz, P. Graber, A. Durandy, J. F. Gauchat, A. Bernard, B. Allet, J. Y. Bonnefoy. 1995. Recombinant soluble trimeric CD40 ligand is biologically active. J. Biol. Chem. 270:7025.[Abstract/Free Full Text]
  40. Keller, G., M. Kennedy, T. Papayannopoulou, M.V. Wiles. 1993. Hematopoietic commitment during embryonic stem cell differentiation in culture. Mol. Cell. Biol. 13:473.[Abstract/Free Full Text]
  41. Johansson, B. M., M. V. Wiles. 1995. Evidence for involvement of activin a and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol. Cell. Biol. 15:141.[Abstract]
  42. Aubry, J. P., N. Dugas, S. Lecoanet-Henchoz, F. Ouaaz, H. Zhao, J. F. Delfraissy, P. Graber, J. P. Kolb, B. Dugas, J. Y. Bonnefoy. 1997. The 25-kDa soluble CD23 activates type III constitutive nitric oxide-synthase activity via CD11b and CD11c expressed by human monocytes. J. Immunol. 159:614.[Abstract]
  43. Kosco, M. H., E. Pflugfelder, D. Gray. 1992. Follicular dendritic cell-dependent adhesion and proliferation of B cells in vitro. J. Immunol. 148:2331.[Abstract]
  44. Callard, R. E., D. J. Matthews, L. Hibbert. 1996. IL-4 and IL-13 receptors: are they one and the same?. Immunol. Today 17:108.[Medline]
  45. Kopf, M., S. Herren, M. V. Wiles, M. B. Pepys, M. H. Kosco-Vilbois. 1998. Interleukin 6 influences germinal center development and antibody production via a contribution of C3 complement component. J. Exp. Med. 000:000.
  46. Taga, T., T. Kishimoto. 1997. gp130 and the interleukin-6 family of cytokines. Annu. Rev. Immunol. 15:797.[Medline]
  47. Fukada, T., M. Hibi, Y. Yamanaka, M. Takahashi-Tezuka, Y. Fujitani, T. Yamaguchi, K. Nakajima, T. Hirano. 1996. Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis. Cell 5:449.
  48. Akira, S., K. Yoshida, T. Tanaka, T. Taga, T. Kishimoto. 1995. Targeted disruption of the IL-6 related genes: gp130 and NF-IL-6. Immunol. Rev. 148:221.[Medline]
  49. Ogata, H., D. Ford, N. Kouttab, T. C. King, N. Vita, A. Minty, J. Stoeckler, D. Morgan, C. Girasole, J. W. Morgan, et al 1998. Regulation of interleukin-13 receptor constituents on mature human B lymphocytes. J. Biol. Chem. 273:9864.[Abstract/Free Full Text]
  50. Barner, M., M. Mohrs, F. Brombacher, M. Kopf. 1998. Differences between IL-4Ra-deficient and IL-4-deficient mice reveal a role for IL-13 in the regulation of Th2 responses. Curr. Biol. 8:669.[Medline]
  51. Bancroft, A. J., A. N. J. Mckenzie, R. K. Grencis. 1998. A critical role for IL-13 in resistance to intestinal nematode infection. J. Immunol. 160:3453.[Abstract/Free Full Text]
  52. Jr Urban, J. F., N. Noben-Trauth, D. D. Donaldson, K. B. Madden, S. C. Morris, M. Collins, F.D. Finkelman. 1998. IL-13, Il-4Ra, and STAT6 are required for the expulsion of the gastrointestinal nematode parasite Nippostrongylus brasiliensis. Immunity 8:255.[Medline]
  53. McKenzie, G. J., A. Bancroft, R. K. Grencis, A. N. J. Mckenzie. 1998. A distinct role for interleukin-13 in Th2-cell-mediated immune responses. Curr. Biol. 8:339.[Medline]
  54. Morse, L., D. Chen, D. Franklin, Y. Xiong, S. Chen-Kiang. 1997. Induction of cell cycle arrest and B cell terminal differentiation by cdk inhibitor p18(ink4c) and IL-6. Immunity 6:47.[Medline]
  55. Lai, Y. H., J. M. Heslan, S. Poppema, J. F. Elliot, T. R. Mosmann. 1996. Continuous administration of IL-13 to mice induces extramedullary hemopoiesis and monocytosis. J. Immunol. 156:3166.[Abstract]
  56. DiSanto, E., C. Meazza, M. Sironi, P. Fruscella, A. Mantovani, J. D. Sipe, P. Ghezzi. 1997. IL-13 inhibits TNF production but potentiates that of IL-6 in vivo and ex vivo in mice. J. Immunol. 159:379.[Abstract]
  57. Sironi, M., F. L. Sciacca, C. Matteucci, M. Conni, A. Vecchi, S. Bernasconi, A. Minty, D. Caput, P. Ferrara, F. Colotta, et al 1994. Regulation of endothelial and mesothelial cell function by interleukin-13: selective induction of vascular cell adhesion molecule-1 and amplification of interleukin-6 production. Blood 84:1913.[Abstract/Free Full Text]
  58. Derocq, J.-M., M. Segui, C. Püoinot-Chazel, A. Minty, D. Caput, P. Ferrara, and P. Casellas. 1994. Interleukin-13 stimulates interleukin-6 production by human keratinocytes: similarity with interleukin-4. FEBS Lett. 343:32.



This article has been cited by other articles:


Home page
 J. Immunol.Home page
N. Gao, P. Schwartzberg, J. A. Wilder, B. R. Blazar, and D. Yuan
B Cell Induction of IL-13 Expression in NK Cells: Role of CD244 and SLAM-Associated Protein.
J. Immunol., March 1, 2006; 176(5): 2758 - 2764.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
R. Sacedon, B. Diez, V. Nunez, C. Hernandez-Lopez, C. Gutierrez-Frias, T. Cejalvo, S. V. Outram, T. Crompton, A. G. Zapata, A. Vicente, et al.
Sonic Hedgehog Is Produced by Follicular Dendritic Cells and Protects Germinal Center B Cells from Apoptosis
J. Immunol., February 1, 2005; 174(3): 1456 - 1461.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. Liu, C. Liang, Z. Liang, K. Tus, and E. K. Wakeland
Sle1ab Mediates the Aberrant Activation of STAT3 and Ras-ERK Signaling Pathways in B Lymphocytes
J. Immunol., February 1, 2005; 174(3): 1630 - 1637.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
A. N.J. McKenzie and P. G. Fallon
Decoy Receptors in the Regulation of T Helper Cell Type 2 Responses
J. Exp. Med., March 17, 2003; 197(6): 675 - 679.
[Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Mattes, M. Yang, A. Siqueira, K. Clark, J. MacKenzie, A. N. J. McKenzie, D. C. Webb, K. I. Matthaei, and P. S. Foster
IL-13 Induces Airways Hyperreactivity Independently of the IL-4R{alpha} Chain in the Allergic Lung
J. Immunol., August 1, 2001; 167(3): 1683 - 1692.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Respir. Cell Mol. Bio.Home page
S. Matsukura, C. Stellato, S. N. Georas, V. Casolaro, J. R. Plitt, K. Miura, S. Kurosawa, U. Schindler, and R. P. Schleimer
Interleukin-13 Upregulates Eotaxin Expression in Airway Epithelial Cells by a STAT6-Dependent Mechanism
Am. J. Respir. Cell Mol. Biol., June 1, 2001; 24(6): 755 - 761.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. Urban, H. Fang, Q. Liu, M. J. Ekkens, S.-J. Chen, D. Nguyen, V. Mitro, D. D. Donaldson, C. Byrd, R. Peach, et al.
IL-13-Mediated Worm Expulsion Is B7 Independent and IFN-{gamma} Sensitive
J. Immunol., April 15, 2000; 164(8): 4250 - 4256.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Poudrier, J.
Right arrow Articles by Kosco-Vilbois, M. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Poudrier, J.
Right arrow Articles by Kosco-Vilbois, M. H.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS