|
|
||||||||
Mediates a Novel Antiviral Activity Through Dynamic Modulation of TRAIL and TRAIL Receptor Expression



Departments of
*
Molecular Immunology,
Molecular Biology, and
Bioinformatics, Immunex Corporation, Seattle, WA 98101
| Abstract |
|---|
|
|
|---|
, by TNF-
, and by infection with human CMV, and
has potent antiviral activity in vitro. CMV infection and IFN-
also
reciprocally modulate TRAIL receptor (TRAIL-R) expression. CMV
infection increased the expression of TRAIL-R1 and -R2, whereas IFN-
down-regulated the expression of TRAIL-Rs on uninfected fibroblasts.
Moreover, IFN-
significantly decreased the basal level of NF-
B
activation, a known survival factor that inhibits apoptosis. Thus,
TRAIL selectively kills virus-infected cells while leaving uninfected
cells intact, and IFN-
potentiates these effects by dynamic
modulation of TRAIL and TRAIL-R expression and by sensitizing cells to
apoptosis. The regulation of TRAIL and TRAIL-R expression may represent
a general mechanism that contributes to the control of TRAIL-mediated
apoptosis. | Introduction |
|---|
|
|
|---|
is produced by T and B lymphocytes, NK cells, and monocyte/macrophages,
and can influence a vast number of cellular responses (1).
However, IFN-
is perhaps best known for its direct antiviral
activities, which are mediated primarily through induction of the
dsRNA-activated protein kinase, 2'-5' oligoadenylate synthase, and
RNaseL (2). A role for IFN-
in apoptotic cell death and
immune suppression has also become apparent (3, 4). In
fact, IFN-
up-regulates the expression of a number of
apoptosis-associated proteins in vitro, including Fas (5),
and induces apoptosis of mouse monocytes (6). IFN-
mediates its affects by binding to a specific cellular receptor that is
ubiquitously expressed on most cells, especially nonlymphoid cells
(7).
TNF-related apoptosis-inducing ligand
(TRAIL)2 is capable of
inducing apoptosis of a wide range of human tumor cells, but generally
not normal cells (8). TRAIL induces apoptosis by binding
and cross-linking death-domain containing receptors, TRAIL-R1 (also
known as DR4 (9)) and TRAIL-R2 (10) (also
called DR5 or TRAIL receptor inducer of cell killing 2 (TRICK2)
(11, 12, 13, 14, 15)). Apoptotic signaling occurs via recruitment of
adapter proteins, which results in the activation of caspases (reviewed
in Refs. 16 and 17). Two non-death
domain-containing TRAIL receptors (TRAIL-Rs) also exist: TRAIL-R3
(18) (or decoy receptor-1 DcR1/TRAIL receptor without an
intracellular domain (TRID) (11, 13, 14, 15)) and TRAIL-R4
(19) (or DcR2/TRAIL receptor with a truncated death domain
(TRUNDD) (20, 21)). TRAIL-R3 is an extracellular
GPI-linked protein; TRAIL-R4 is a transmembrane receptor that is
similar to TRAIL-R1 and -R2 but lacks an intact death-domain and
therefore cannot signal cell death. It has been proposed that TRAIL-R3
and -R4 act predominately as decoy receptors to inhibit the cytotoxic
effects of TRAIL (11, 15, 17, 18, 19). However, their
physiological role is still uncertain and all three transmembrane
receptors (TRAIL-R1, TRAIL-R2, and TRAIL-R4) can transduce signals that
result in the activation of NF-
B proteins in vitro (19, 22).
The events that are required for TRAIL-resistant cells to become susceptible to TRAIL-mediated apoptosis are not well understood. Many viruses have a significant impact on host cell metabolism; hence, it might be predicted that cells infected with viruses might acquire sensitivity to TRAIL. That apoptosis is an important innate antiviral response of the host organism is attested to by the fact that many viruses have incorporated open reading frames encoding potent regulators of cell death (reviewed in Refs. 23, 24, 25). In fact, viruses with targeted disruptions or naturally occurring mutations in these genes often exhibit replication defects in vitro as well as reduced virulence in vivo (26, 27, 28). Therefore, apoptosis of virus-infected cells and viral resistance to apoptosis-inducing ligands are important factors that can determine the outcome of virus infection in vivo.
With these facts in mind, we studied the effects of TRAIL on virus
infection. Given that TRAIL does not induce apoptosis of most normal
cells in vitro (8) or when administered in vivo as a
potently active trimeric protein (29), we used primary
human fibroblasts that are not normally susceptible to TRAIL but are
capable of supporting productive virus infection. In this setting, we
have demonstrated the efficient killing of virally infected fibroblasts
by TRAIL. We found that human CMV (HCMV)-infection directly
up-regulated the expression of TRAIL and TRAIL-Rs on
virus-infected fibroblasts; IFN-
potentiated these effects by
inducing TRAIL expression and down-regulating the expression of
TRAIL-Rs on uninfected fibroblasts. Collectively, these data
describe a novel mechanism by which IFN-
mediates antiviral
activity through the regulation of TRAIL and TRAIL-R expression.
| Materials and Methods |
|---|
|
|
|---|
Primary human foreskin fibroblast (HFF) cells were cultured in DMEM with 10% FBS, L-glutamine, and antibiotics at 37°C in 10% CO2. Primary normal human bronchial airway epithelial (NHBE) cells (Clonetics, San Diego, CA) were grown in bronchial epithelial growth medium (Clonetics) at 37°C in 5% CO2. CV-1 cells and HEp-2 cells (American Type Culture Collection, Manassas, VA) were grown in DMEM supplemented with 5% FBS as described above.
Virus
HCMV strain AD169 was a gift of Thomas Jones (Wyeth-Ayerst Research, Pearl River, NY). HCMV stocks were titrated on HFF cells, vaccinia virus (VV)-WR strain was titrated on CV-1 cells, and respiratory syncytial virus (RSV) (Long strain) was titrated on HEp-2 cells, by standard techniques.
Cytokines and Abs
The following cytokines were used: human rIFN-
(rhuIFN-
)
(10 ng/ml), IFN-
/
(10 ng/ml), TNF-
(1 ng/ml) (R&D Systems,
Minneapolis, MN), leucine zipper (LZ)-tagged soluble trimeric human
TRAIL, CD40 ligand (CD40L), or receptor activator of NF-
B ligand
(RANKL) (1 µg/ml, Immunex Corporation). The following Abs were used:
monoclonal anti-human TRAIL-R1 (IgG1, M270), anti-human
TRAIL-R2 (IgG1, M413), anti-human TRAIL-R3 (IgG1, M430),
anti-human TRAIL-R4 (IgG1, M444), and anti-human TRAIL (IgG1,
M181; Immunex Corporation); all have been described previously
(30). Other Abs and staining reagents used include:
PE-conjugated mouse anti-human TNF receptor (TNFR)-p55 (mouse IgG1,
clone 16803.1), PE anti-human TNFR-p75 (mouse IgG2a, clone 22235.3)
(both from R&D Systems), biotinylated goat anti-human Ig (Sigma,
St. Louis, MO), annexin-V-biotin, avidin-Texas Red (PharMingen, San
Diego, CA), and FITC-conjugated anti-HCMV (Dako, Carpinteria,
CA).
FACS
Cells were removed from tissue culture dishes by gently pipetting in 2x SSC. Nonspecific binding was blocked by incubating HFF cells in FACS blocking buffer for 30 min at 4°C. Cells were incubated with anti-TRAIL M181 or anti-TRAIL-R-specific Abs (2 µg/ml), washed, and incubated with biotinylated goat anti-human Ig (1 µg/ml) and finally with streptavidin (SA)-PE (PharMingen). Two-color flow cytometry was performed by incubating cells with PE-mouse anti-human TNFR-p55 or PE-anti-human TNFR-p75 (1 µg/ml) in the final step reagent. Cells were fixed in 1% paraformaldehyde/PBS. Data were collected (10,000 or 30,000 events) using a Becton Dickinson FACScan or FACScalibur and analyzed using CellQuest software (Becton Dickinson, San Jose, CA).
Confocal microscopy
HFF cells were seeded into 8-chamber coverslips, infected with
HCMV at various multiplicities of infection (moi), and subsequently
cultured in media with or without IFN-
and TRAIL. Cultures were
incubated for 24 or 48 h at 37°C, at which time 10x binding
buffer (PharMingen) and biotinylated annexin-V were added directly to
the culture media. Cultures were incubated for 20 min at 37°C,
washed, and incubated in avidin-Texas Red (PharMingen) for an
additional 20 min at room temperature. Cells were fixed in 1%
paraformaldehyde/PBS and incubated with a 1/5 dilution of FITC-HCMV
(Dako) in 0.1% saponin for 45 min. Cells were washed again in fresh
media containing 0.1% saponin, covered with glycerol/PBS containing
10% DABCO (Sigma), and examined by confocal laser scanning microscopy.
The percentage of annexin-V+
FITC+ cells was scored from randomly selected
low-power fields, representative of the whole culture.
RT-PCR
HFF cells were seeded into 10-cm dishes and treated with cytokines or were infected with HCMV at an moi of 2. At 24 or 48 h posttreatment and/or virus infection, HFF cells were washed in PBS and harvested directly into RNA lysis buffer. Total cellular RNA was prepared using RNeasy minicolumns (Qiagen, Valencia, CA). RNA was quantitated by absorbance at 260 nm, and 2 µg was used as the template for first strand random-primed cDNA synthesis using the preamplification system (Life Technologies, Grand Island, NY). PCR amplification of cDNAs specific to TRAIL, TRAIL-R1, TRAIL-R2, TRAIL-R3, and TRAIL-R4 as well as to TNFR-p55, TNFR-p75, dihydrofolate reductase (DHFR), and HCMV open reading frames UL-18 and UL-67 was performed using specific primers. Plasmids containing the specific target cDNAs were used as PCR controls to indicate amplification of the specific cDNA. To ensure that detection was in the linear range, PCRs were performed at various cycles and repeated at least twice.
Plasmids and transfections
An NF-
B-responsive luciferase reporter plasmid, IL8p-LUC, was
constructed by ligating the IL-8 promoter sequence into the
ASP718-XhoI site of pGL-Basic (Promega, Madison,
WI). An IFN-
-responsive luciferase reporter plasmid pSTAT-LUC was
similarly generated by cloning the Fc
RI promoter into the
ASP718-XhoI sites immediately upstream of the
minimal thymidine kinase promoter (-35 to +10 of the HSV thymidine
kinase promoter). Therefore, this promoter contains four copies of a
functional
activation site (CGTATTTCCCAGAAAAGGAA) spaced 20 bp
apart. HFF cells (105/well) were seeded into
24-well tissue culture plates, and triplicate cultures were transfected
with reporter plasmids by DEAE-dextran. HFF cells were allowed to
recover for 12 h before infection (or mock infection) with 100
µl of HCMV at an moi of 2 for 1 h at 37°C. Cells were cultured
in DMEM in the absence or presence of various cytokines (IFN-
,
CD40L, TRAIL, IFN-
and TRAIL, or CD40L and TRAIL). Lysates were
prepared at either 24 or 48 h postinfection (p.i.) and assayed
independently for luciferase activity using a Lumat LB9507 luminometer
(EG&G Berthold, Wildbad, Germany).
Lactate dehydrogenase (LDH) assays
HFF cells (104/well) were seeded in 96-well flat-bottom plates, infected with HCMV at an moi of 2 for 1 h, and incubated in the presence or absence of cytokines for 24 (data not shown) or 48 h. Aliquots of supernatants (100 µl) were then assayed for LDH release using the Cytotoxicity Detection kit (Boehringer Mannheim, Indianapolis, IN). Minimum lysis was determined from cells cultured in medium alone; maximum lysis was induced by adding 100 µl of media containing 0.1% Triton X-100. Percent specific lysis was calculated using the following formula: % specific LDH release = ([experimental release - minimum release]/[maximal release - minimum release]) x 100.
| Results |
|---|
|
|
|---|
to induce death of virus-infected
cells
TRAIL was first described as a TNF-related ligand that is capable
of inducing apoptosis of transformed cells of diverse origins
(8). To test whether TRAIL can also induce apoptosis of
virus-infected cells, we infected HFF cells with HCMV and cultured
these cells in the presence of TRAIL or TRAIL plus IFN-
. Cultures
were examined by phase contrast light microscopy at 12, 24, 48, and
72 h p.i. A rounded cytopathic effect was detectable in infected
cultures in the absence of cytokines by 24 h p.i. but was more
prominent by 48 h p.i. (data not shown). In contrast, extensive
cell death was apparent in HCMV-infected HFF cultures treated with
TRAIL or TRAIL plus IFN-
at 48 h p.i. To quantitate the extent
of cell death, we measured the release of LDH in the supernatants of
these cultures. LDH release was found in the supernatants of
HCMV-infected HFF cultures treated with IFN-
, TRAIL, or IFN-
and
TRAIL but was not found in uninfected HFF cultures treated with these
cytokines (Fig. 1
). In fact, uninfected
HFF cultures treated with IFN-
and TRAIL appeared healthy throughout
the experiment. The ability of TRAIL to induce the death of
HCMV-infected cells was comparable with the antiviral cytokine TNF-
(31, 32) in that HCMV-infected cells cultured with TNF-
or TNF-
plus IFN-
were also killed by 48 h p.i. (Fig. 1
).
Importantly, the death-inducing effects of TRAIL were not specific to
HCMV-infected HFF cells, because TRAIL also induced cell death in
RSV-infected NHBE cells, especially in the presence of IFN-
(data
not shown). These data indicate that TRAIL, either alone or in
combination with IFN-
, can induce cell death in virus-infected
cultures in vitro.
|
for 24 or 48 h. We subsequently stained these
cells with an FITC-conjugated anti-HCMV Ab and with
annexin-V-biotin and SA-Texas Red. Using confocal microscopy, we were
therefore able to specifically detect the virus-infected cells and
determine whether they were undergoing apoptosis. By 24 h p.i.,
HCMV-infected cells cultured in the presence of TRAIL and IFN-
exhibited rounded morphology, HCMV-specific staining, and annexin-V
surface staining, indicating that the virus-infected cells were
undergoing early stages of apoptotic cell death (Fig. 2
were negative for annexin-V staining (Fig. 2
-treated cultures, but
5% of uninfected
cultures were annexin-V+ when cultured with these
cytokines for 48 h (Table I
|
|
To assess whether the TRAIL-induced apoptosis of the
virus-infected cells occurred before productive virus replication and
whether TRAIL has antiviral activity on other viruses in different cell
types, we measured the amount of infectious progeny virus recoverable
in TRAIL-treated cultures infected with HCMV, RSV, and VV. IFN-
alone caused a notable decrease in recoverable HCMV, RSV, and VV,
consistent with its known antiviral activity (Table II
). Exposure of cells to TRAIL alone
also resulted in reduced recovery of HCMV and RSV but not of VV.
Importantly, treating cells with IFN-
plus TRAIL resulted in a
further reduction of titratable HCMV, RSV, and VV compared with cells
treated with IFN-
or TRAIL alone (Table II
). Although both
RSV-infected NHBE cells and VV-infected HFF cells appeared to be less
sensitive to the apoptosis mediated by TRAIL than did HCMV-infected HFF
cells, the combination of TRAIL and IFN-
still had an impact on the
replication of these viruses (Table II
). Therefore, TRAIL-mediated
apoptosis of virus-infected cells was not specific only to
HCMV-infected cells and occurred before maximal virus replication.
Thus, TRAIL has antiviral activity by inducing apoptosis of
virus-infected cells in vitro. It is unknown whether TRAIL can exert
additional antiviral activity distinct from apoptosis induction.
|
Next, we investigated the mechanism by which TRAIL selectively
kills only the virus-infected cells. Semiquantitative RT-PCR analysis
was used to study the relative abundance of distinct TRAIL-R mRNA in
HCMV-infected or uninfected HFF cells or after exposure to cytokines.
IFN-
clearly decreased the abundance of TRAIL-R3 and TRAIL-R4 mRNA
in uninfected or infected HFF cells by 24 h posttreatment. By
48 h after HCMV infection, TRAIL-R4 mRNA was present at levels
similar to those seen in untreated or uninfected cells, even in the
presence of IFN-
(Fig. 3
). In
contrast, HCMV infection resulted in an increase in mRNA for TRAIL-R2
by 24 h p.i. and in an increase for both TRAIL-R1 and TRAIL-R2 by
48 h p.i. By comparison, TNFR-p55 and the housekeeping gene DHFR
mRNA were detectable at relatively similar levels in all samples
irrespective of treatment with cytokines; TNFR-p75 mRNA was inducible
by HCMV infection under all culture conditions (Fig. 3
). We also
performed RT-PCR for TRAIL mRNA and found increased TRAIL mRNA after
HCMV infection, either in the presence or absence of IFN-
. As an
indicator of viral infection, RT-PCR for the HCMV early gene
UL-18 and late gene UL-67 was also performed
(data not shown). Taken together, the RT-PCR data indicate that clear
differences exist in the relative abundance of TRAIL and TRAIL-R mRNA
in HFF cells after treatment with IFN-
or after HCMV infection.
Thus, IFN-
and HCMV infection either transcriptionally regulates the
expression of TRAIL and TRAIL-Rs in HFF cells or alters the stability
or half-life of these mRNAs by unknown mechanisms.
|
It was important to determine whether the relative changes in
abundance of mRNA transcripts for these receptors correlated with their
expression as cell surface proteins and whether these or other
cytokines could similarly influence TRAIL expression. First, we
assessed the expression of each distinct TRAIL-R on uninfected HFF
cells using TRAIL receptor-specific mAbs. HFF cells expressed TRAIL-R2
and low but detectable levels of TRAIL-R1, but not TRAIL-R3 or
TRAIL-R4, as assessed relevant to staining with a control Ab (Fig. 4
A). Treatment with IFN-
for 24 h resulted in decreased expression of TRAIL-R1 and TRAIL-R2
on uninfected HFF cells (Fig. 4
B). Furthermore, we found
that IFN-
also down-regulated the expression of TRAIL-R3 and -R4 on
primary human B cells (data not shown). In contrast, HCMV infection
directly up-regulated the expression of death domain-containing
TRAIL-R1, and TRAIL-R2 by 24 h p.i. (Fig. 4
B).
Interestingly, HCMV-infected HFF cells cultured in IFN-
did not
exhibit decreased TRAIL-R2 expression. Thus, in the presence of
IFN-
, the expression of TRAIL-R1 and-R2 was significantly higher on
HCMV-infected HFF cells than on uninfected HFF cells (Fig. 4
B). For comparison, we also stained HFF cells with specific
Abs to TNFR-p55 and TNFR-p75 and found that the expression of TNFR-p55
was not significantly altered after treatment with IFN-
, IFN-
,
CD40L, or TRAIL (data not shown), whereas TNFR-p55 and TNFR-p75 were
both up-regulated on HCMV-infected HFF cells (data not shown). We were
particularly interested in determining whether TRAIL itself was
expressed on virus-infected HFF cells, because we had found that HCMV
infection induced TRAIL mRNA. Using an Ab specific to human TRAIL, we
found that both IFN-
and TNF-
, but not a control reagent, RANKL,
induced a small but reproducible increase in TRAIL expression on
uninfected HFF cells (Fig. 4
C). Furthermore, HCMV infection
resulted in a dramatic induction of TRAIL expression on HFF cells (Fig. 4
C). These results are consistent with the relative
abundance of TRAIL and TRAIL-R mRNA detected by RT-PCR (Fig. 3
) and
confirmed that exposure to cytokines or HCMV infection directly
influences both TRAIL and TRAIL-R expression on primary human
fibroblasts.
|
B activation
TRAIL-R1, TRAIL-R2, and TRAIL-R4 are capable of inducing the
activation of NF-
B proteins in vitro (19, 22). Because
HFF cells normally express detectable TRAIL-R2 protein but are not
normally killed by TRAIL, we assessed the extent of NF-
B activation
in unstimulated HFF cells after the ligation of TRAIL-R2 by TRAIL,
after exposure to IFN-
or to the control reagent CD40L, and after
HCMV infection. We found that treating HFF cells with IFN-
or
IFN-
plus TRAIL resulted in a 10-fold decrease in basal NF-
B
activation (Fig. 5
A), whereas
transfection with the parent promoterless plasmid did not induce
luciferase activity (data not shown). For control purposes, HFF cells
were transfected with a
activation site containing,
IFN-
-responsive luciferase reporter plasmid pSTAT-LUC; as expected,
IFN-
induced a 4-fold increase in pSTAT-LUC-mediated luciferase
activity (data not shown). Thus, TRAIL does not activate NF-
B
proteins in uninfected HFF cells, even though they express TRAIL-R2 and
are not normally killed by TRAIL, whereas IFN-
clearly suppressed
basal NF-
B levels in uninfected HFF cells.
|
B activity in HCMV-infected
HFF cells (Fig. 5
B proteins
(33). However, treating HCMV-infected HFF cells with TRAIL
and IFN-
, either individually or in combination, decreased NF-
B
activity by
50% (Fig. 5
B activity to almost 4-fold
above that found in HCMV-infected fibroblasts, which is consistent with
the fact that CD40 is known to be expressed on most fibroblasts,
including foreskin fibroblasts, and can activate NF-
B (33, 34) Furthermore, CD40L-treated HCMV-infected HFF cells cultured
in TRAIL were found to have a 10-fold induction of NF-
B activity
compared with infected cells cultured in TRAIL alone, indicating that
CD40L was sufficient to overcome the decrease in NF-
B activity
induced by TRAIL. Similar to uninfected cells, control
pSTAT-LUC-transfected HCMV-infected HFF cells showed increased
IFN-
-inducible luciferase activity over uninfected cells (data not
shown). Taken together, these results confirm the finding that HCMV
infection induced the activation of NF-
B proteins, but this was
insufficient to prevent TRAIL-mediated apoptosis of infected HFF
cells. | Discussion |
|---|
|
|
|---|
, TNF-
, and CMV infection and has potent
antiviral activity in vitro by selectively killing virus-infected
fibroblasts. Furthermore, we have demonstrated that virus infection and
cytokines alter the expression of TRAIL-Rs.
It has been suggested that the reason why some cells are susceptible to
TRAIL while others appear to be resistant lies in the endogenous
presence of the non-death-signaling TRAIL-Rs (35).
However, examination of various tumor cell types has shown that basal
expression of TRAIL-Rs does not correlate with susceptibility to TRAIL
(30, 36). Alternatively, the presence or absence of
intracellular inhibitors of apoptosis such as the cellular inhibitor of
caspase 8/FLICE-inhibitory protein (cFLIP) may be important
(37), and in some circumstances, cFLIP expression does
correlate with the susceptibility of tumor cells to TRAIL
(36). In contrast, we have shown here that cytokines and
virus infection differentially modulate TRAIL and TRAIL-R expression at
the cell surface, and that these alterations directly correlate with
susceptibility versus resistance to TRAIL. Therefore, we propose that
modulation of TRAIL-R expression and the relative abundance of each
distinct receptor at the time of exposure to TRAIL significantly
contribute to regulating susceptibility to TRAIL-mediated apoptosis. In
the case of HCMV-infected HFF cells, virus infection induced the
expression of the death-domain containing receptors TRAIL-R1 and
TRAIL-R2, whereas IFN-
down-regulated TRAIL-Rs on uninfected HFF
cells. Thus IFN-
influences the susceptibility of HFF cells to
TRAIL, in part by regulating the abundance of specific TRAIL-Rs at the
cell surface. IFN-
might also have effectively concentrated soluble
TRAIL to target the virus-infected cells. Moreover, both HCMV infection
and IFN-
directly induced TRAIL protein expression on HFF cells,
indicating that endogenous expression of TRAIL itself may act to induce
apoptosis via suicide and/or fratricide.
The modulation of TRAIL-R expression need not exclude a role for
intracellular factors in contributing to susceptibility to TRAIL. In
this regard, it is curious that global activation of NF-
B by HCMV
infection was itself insufficient to prevent TRAIL-mediated apoptosis,
yet activation of NF
B has been widely described as a major
prosurvival factor, capable of overcoming the apoptosis mediated by
death-inducing ligands in vitro (38). This might be
explained in terms of the order in which survival or proapoptotic
events occur, the magnitude of NF-
B activation, or differential
induction of distinct NF-
B/Rel proteins. The presence and abundance
of different NF-
B proteins has recently been shown to explain the
ability of CD40L versus LPS to initiate Ig class switching in B cells
(39). Interestingly, IFN-
not only modulated TRAIL-R
expression but also significantly decreased NF-
B-activation, which
presumably enhanced susceptibility to TRAIL by decreasing the survival
threshold of these cells. Moreover, the viral impact on host cell
metabolism may also sensitize cells to TRAIL in an analogous manner to
protein or nucleic acid inhibitors such as cycloheximide or actinomycin
D. These agents are often capable of sensitizing cells to
TRAIL-mediated apoptosis in vitro (data not shown). Hence, our results
are consistent with a situation whereby the balance of apoptotic versus
survival signals cumulatively dictates the final outcome of
susceptibility versus resistance to TRAIL-mediated cell death. However,
our data are also consistent with the idea that modulation of TRAIL-R
expression at the cell surface is a crucial upstream event that
influences this process.
It is important to consider the question of whether TRAIL is normally
expressed in a manner relevant to virus infection in vivo. We have
demonstrated that TRAIL is inducible by HCMV infection as well as by
the antiviral cytokines IFN-
and TNF-
(31, 32).
Moreover, we have also shown recently that IFN-
induces functional
TRAIL expression on freshly isolated human peripheral blood monocytes
(40), and TRAIL has also been found to be a functional
cytotoxic effector molecule expressed on primary human NK cells
(41). Induction of IFN-
and the role of NK cells and
macrophages during virus infection in both humans and mice have been
well documented, although characterization of TRAIL expression and its
role during virus infection in vivo remains to be investigated.
Interestingly, a role for TRAIL in the activation-induced cell death of
T cells in HIV-infected individuals has also been proposed
(42). Therefore, a role for TRAIL in virus infection in
vivo is strongly implied. Finally, the ability of IFN-
to modulate
both TRAIL and TRAIL-R expression on the same cell is currently
undefined at a molecular level, and further studies will be required to
dissect which signaling proteins mediate these events.
In conclusion, we have demonstrated that TRAIL is directly inducible on
primary human fibroblasts by IFN-
, TNF-
, and HCMV infection and
can selectively kill virally infected cells. We have also documented
that virus infection and IFN-
differentially regulate the expression
of TRAIL-Rs, which directly correlates with the susceptibility of
virus-infected cells to TRAIL-mediated apoptosis. Therefore, the
differential regulation of TRAIL and TRAIL-R expression on
virus-infected cells represents a novel mechanism by which IFN-
mediates antiviral activity.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Abbreviations used in this paper: TRAIL, TNF-related apoptosis-inducing ligand; TRAIL-R, TRAIL receptor; HCMV, human CMV; RSV, respiratory syncytial virus; moi, multiplicity of infection; TNFR, TNF receptor; CD40L, CD40 ligand; DcR, decoy receptor; HFF, human foreskin fibroblast; NHBE, normal human bronchial airway epithelial; VV, vaccinia virus; DHFR, dihydrofolate reductase; LDH, lactate dehydrogenase; SA, streptavidin; p.i., postinfection; rhu, recombinant human; LZ, leucine zipper; RANKL, receptor activator of NF-
B ligand. ![]()
Received for publication February 8, 1999. Accepted for publication April 30, 1999.
| References |
|---|
|
|
|---|
. Annu. Rev. Immunol. 15:749.[Medline]
and tumor necrosis-
and potentiated cytokine mediated haematopoietic suppression in vitro. Blood 85:3183.
. J. Exp. Med. 181:127.
B and protects against TRAIL-mediated apoptosis, yet retains an incomplete death domain. Immunity 7:813.[Medline]
B. Immunity 7:831.[Medline]
and ß inhibit virus replication and synergize with interferons. Nature 323:819.[Medline]
B mobilization and induction of IL-6 production. J. Immunol. 155:4588.[Abstract]
B activation attenuated apoptosis resistance in lymphoid cells. Blood 91:4624.
B/Rel proteins. Mol. Cell. Biol. 18:5523.This article has been cited by other articles:
![]() |
P. Clarke, J. D. Beckham, J. S. Leser, C. C. Hoyt, and K. L. Tyler Fas-Mediated Apoptotic Signaling in the Mouse Brain following Reovirus Infection J. Virol., June 15, 2009; 83(12): 6161 - 6170. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. L. Brincks, A. Katewa, T. A. Kucaba, T. S. Griffith, and K. L. Legge CD8 T Cells Utilize TRAIL to Control Influenza Virus Infection J. Immunol., October 1, 2008; 181(7): 4918 - 4925. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Lan, S. Gorke, S. J. Rau, M. B. Zeisel, E. Hildt, K. Himmelsbach, M. Carvajal-Yepes, R. Huber, T. Wakita, A. Schmitt-Graeff, et al. Hepatitis C Virus Infection Sensitizes Human Hepatocytes to TRAIL-Induced Apoptosis in a Caspase 9-Dependent Manner J. Immunol., October 1, 2008; 181(7): 4926 - 4935. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Sanders, C. L. Clark, C. S. Morello, and D. H. Spector Development of Cell Lines That Provide Tightly Controlled Temporal Translation of the Human Cytomegalovirus IE2 Proteins for Complementation and Functional Analyses of Growth-Impaired and Nonviable IE2 Mutant Viruses J. Virol., July 15, 2008; 82(14): 7059 - 7077. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Foulds, M. J. Rotte, M. A. Paley, B. Singh, D. C. Douek, B. J. Hill, J. J. O'Shea, W. T. Watford, R. A. Seder, and C.-Y. Wu IFN-{gamma} Mediates the Death of Th1 Cells in a Paracrine Manner J. Immunol., January 15, 2008; 180(2): 842 - 849. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Rus, V. Nguyen, R. Puliaev, I. Puliaeva, V. Zernetkina, I. Luzina, J. C. Papadimitriou, and C. S. Via T Cell TRAIL Promotes Murine Lupus by Sustaining Effector CD4 Th Cell Numbers and by Inhibiting CD8 CTL Activity J. Immunol., March 15, 2007; 178(6): 3962 - 3972. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Shlapobersky, R. Sanders, C. Clark, and D. H. Spector Repression of HMGA2 Gene Expression by Human Cytomegalovirus Involves the IE2 86-Kilodalton Protein and Is Necessary for Efficient Viral Replication and Inhibition of Cyclin A Transcription. J. Virol., October 1, 2006; 80(20): 9951 - 9961. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. M. Sedger, S. R. Osvath, X.-M. Xu, G. Li, F. K.-M. Chan, J. W. Barrett, and G. McFadden Poxvirus Tumor Necrosis Factor Receptor (TNFR)-Like T2 Proteins Contain a Conserved Preligand Assembly Domain That Inhibits Cellular TNFR1-Induced Cell Death. J. Virol., September 1, 2006; 80(18): 9300 - 9309. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Huang, N. Erdmann, H. Peng, S. Herek, J. S. Davis, X. Luo, T. Ikezu, and J. Zheng TRAIL-Mediated Apoptosis in HIV-1-Infected Macrophages Is Dependent on the Inhibition of Akt-1 Phosphorylation J. Immunol., August 15, 2006; 177(4): 2304 - 2313. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Iannello, O. Debbeche, E. Martin, L. H. Attalah, S. Samarani, and A. Ahmad Viral strategies for evading antiviral cellular immune responses of the host J. Leukoc. Biol., January 1, 2006; 79(1): 16 - 35. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chaperot, A. Blum, O. Manches, G. Lui, J. Angel, J.-P. Molens, and J. Plumas Virus or TLR Agonists Induce TRAIL-Mediated Cytotoxic Activity of Plasmacytoid Dendritic Cells J. Immunol., January 1, 2006; 176(1): 248 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Siegmund, A. Wicovsky, I. Schmitz, K. Schulze-Osthoff, S. Kreuz, M. Leverkus, O. Dittrich-Breiholz, M. Kracht, and H. Wajant Death Receptor-Induced Signaling Pathways Are Differentially Regulated by Gamma Interferon Upstream of Caspase 8 Processing Mol. Cell. Biol., August 1, 2005; 25(15): 6363 - 6379. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. R. Kirshner, A. Y. Karpova, M. Kops, and P. M. Howley Identification of TRAIL as an Interferon Regulatory Factor 3 Transcriptional Target J. Virol., July 15, 2005; 79(14): 9320 - 9324. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Ishikawa, M. Nakazawa, M. Yoshinari, and M. Minami Role of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand in Immune Response to Influenza Virus Infection in Mice J. Virol., June 15, 2005; 79(12): 7658 - 7663. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuda, A. Almasan, M. Tomita, K. Tamaki, M. Saito, M. Tadano, H. Yagita, T. Ohta, and N. Mori Dengue virus-induced apoptosis in hepatic cells is partly mediated by Apo2 ligand/tumour necrosis factor-related apoptosis-inducing ligand J. Gen. Virol., April 1, 2005; 86(4): 1055 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Bremer, D. F. Samplonius, L. van Genne, M. H. Dijkstra, B. J. Kroesen, L. F. M. H. de Leij, and W. Helfrich Simultaneous Inhibition of Epidermal Growth Factor Receptor (EGFR) Signaling and Enhanced Activation of Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) Receptor-mediated Apoptosis Induction by an scFv:sTRAIL Fusion Protein with Specificity for Human EGFR J. Biol. Chem., March 18, 2005; 280(11): 10025 - 10033. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Matsuda, A. Almasan, M. Tomita, J.-n. Uchihara, M. Masuda, K. Ohshiro, N. Takasu, H. Yagita, T. Ohta, and N. Mori Resistance to Apo2 Ligand (Apo2L)/Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL)-Mediated Apoptosis and Constitutive Expression of Apo2L/TRAIL in Human T-Cell Leukemia Virus Type 1-Infected T-Cell Lines J. Virol., February 1, 2005; 79(3): 1367 - 1378. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Tang, W. Wu, S.-y. Sun, I. I. Wistuba, W. K. Hong, and L. Mao Hypermethylation of the Death-Associated Protein Kinase Promoter Attenuates the Sensitivity to Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand-Induced Apoptosis in Human Non-Small Cell Lung Cancer Cells Mol. Cancer Res., December 1, 2004; 2(12): 685 - 691. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Merchant, X. Yang, F. Melchionda, M. Romero, R. Klein, C. J. Thiele, M. Tsokos, H. U. Kontny, and C. L. Mackall Interferon {gamma} Enhances the Effectiveness of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand Receptor Agonists in a Xenograft Model of Ewing's Sarcoma Cancer Res., November 15, 2004; 64(22): 8349 - 8356. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Kokkinakis, X. Liu, S. Chada, M. M. Ahmed, M. M. Shareef, U. K. Singha, S. Yang, and J. Luo Modulation of Gene Expression in Human Central Nervous System Tumors under Methionine Deprivation-induced Stress Cancer Res., October 15, 2004; 64(20): 7513 - 7525. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Vidal, P. Serrant, B. Schlosser, P. van den Broek, F. Lorget, and A. Donnet-Hughes Osteoprotegerin production by human intestinal epithelial cells: a potential regulator of mucosal immune responses Am J Physiol Gastrointest Liver Physiol, October 1, 2004; 287(4): G836 - G844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Schmeck, R. Gross, P. D. N'Guessan, A. C. Hocke, S. Hammerschmidt, T. J. Mitchell, S. Rosseau, N. Suttorp, and S. Hippenstiel Streptococcus pneumoniae-Induced Caspase 6-Dependent Apoptosis in Lung Epithelium Infect. Immun., September 1, 2004; 72(9): 4940 - 4947. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. J. Wurzer, C. Ehrhardt, S. Pleschka, F. Berberich-Siebelt, T. Wolff, H. Walczak, O. Planz, and S. Ludwig NF-{kappa}B-dependent Induction of Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL) and Fas/FasL Is Crucial for Efficient Influenza Virus Propagation J. Biol. Chem., July 23, 2004; 279(30): 30931 - 30937. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Kassis, F. Larrous, J. Estaquier, and H. Bourhy Lyssavirus Matrix Protein Induces Apoptosis by a TRAIL-Dependent Mechanism Involving Caspase-8 Activation J. Virol., June 15, 2004; 78(12): 6543 - 6555. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lum, D. J. Schnepple, Z. Nie, J. Sanchez-Dardon, G. L. Mbisa, J. Mihowich, N. Hawley, S. Narayan, J. E. Kim, D. H. Lynch, et al. Differential Effects of Interleukin-7 and Interleukin-15 on NK Cell Anti-Human Immunodeficiency Virus Activity J. Virol., June 1, 2004; 78(11): 6033 - 6042. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Koga, A. Matsuzaki, A. Suminoe, H. Hattori, and T. Hara Neutrophil-Derived TNF-Related Apoptosis-Inducing Ligand (TRAIL): A Novel Mechanism of Antitumor Effect by Neutrophils Cancer Res., February 1, 2004; 64(3): 1037 - 1043. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mezosi, S. H. Wang, S. Utsugi, L. Bajnok, J. D. Bretz, P. G. Gauger, N. W. Thompson, and J. R. Baker Jr. Interleukin-1{beta} and Tumor Necrosis Factor (TNF)-{alpha} Sensitize Human Thyroid Epithelial Cells to TNF-Related Apoptosis-Inducing Ligand-Induced Apoptosis through Increases in Procaspase-7 and Bid, and the Down-Regulation of p44/42 Mitogen-Activated Protein Kinase Activity J. Clin. Endocrinol. Metab., January 1, 2004; 89(1): 250 - 257. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kotelkin, E. A. Prikhod'ko, J. I. Cohen, P. L. Collins, and A. Bukreyev Respiratory Syncytial Virus Infection Sensitizes Cells to Apoptosis Mediated by Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand J. Virol., September 1, 2003; 77(17): 9156 - 9172. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Lonergan, D. Aponso, K. W. Marvin, R. J. A. Helliwell, T. A. Sato, M. D. Mitchell, T. Chaiwaropongsa, R. Romero, and J. A. Keelan Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (TRAIL), TRAIL Receptors, and the Soluble Receptor Osteoprotegerin in Human Gestational Membranes and Amniotic Fluid during Pregnancy and Labor at Term and Preterm J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3835 - 3844. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Washburn, M. A. Weigand, A. Grosse-Wilde, M. Janke, H. Stahl, E. Rieser, M. R. Sprick, V. Schirrmacher, and H. Walczak TNF-Related Apoptosis-Inducing Ligand Mediates Tumoricidal Activity of Human Monocytes Stimulated by Newcastle Disease Virus J. Immunol., February 15, 2003; 170(4): 1814 - 1821. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Renshaw, J. S. Parmar, V. Singleton, S. J. Rowe, D. H. Dockrell, S. K. Dower, C. D. Bingle, E. R. Chilvers, and M. K. B. Whyte Acceleration of Human Neutrophil Apoptosis by TRAIL J. Immunol., January 15, 2003; 170(2): 1027 - 1033. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Ahmad, S. T. A. Sindhu, E. Toma, R. Morisset, and A. Ahmad Elevated Levels of Circulating Interleukin-18 in Human Immunodeficiency Virus-Infected Individuals: Role of Peripheral Blood Mononuclear Cells and Implications for AIDS Pathogenesis J. Virol., November 13, 2002; 76(24): 12448 - 12456. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Matysiak, A. Jurewicz, D. Jaskolski, and K. Selmaj TRAIL induces death of human oligodendrocytes isolated from adult brain Brain, November 1, 2002; 125(11): 2469 - 2480. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kabsch and A. Alonso The Human Papillomavirus Type 16 E5 Protein Impairs TRAIL- and FasL-Mediated Apoptosis in HaCaT Cells by Different Mechanisms J. Virol., October 25, 2002; 76(23): 12162 - 12172. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mezosi, H. Yamazaki, J. D. Bretz, S. H. Wang, P. L. Arscott, S. Utsugi, P. G. Gauger, N. W. Thompson, and J. R. Baker Jr. Aberrant Apoptosis in Thyroid Epithelial Cells from Goiter Nodules J. Clin. Endocrinol. Metab., September 1, 2002; 87(9): 4264 - 4272. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kumar-Sinha, S. Varambally, A. Sreekumar, and A. M. Chinnaiyan Molecular Cross-talk between the TRAIL and Interferon Signaling Pathways J. Biol. Chem., January 4, 2002; 277(1): 575 - 585. [Abstract] [Full Text] |
||||
![]() |
G. Arrode, C. Boccaccio, J.-P. Abastado, and C. Davrinche Cross-Presentation of Human Cytomegalovirus pp65 (UL83) to CD8+ T Cells Is Regulated by Virus-Induced, Soluble-Mediator-Dependent Maturation of Dendritic Cells J. Virol., January 1, 2002; 76(1): 142 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Lum, A. A. Pilon, J. Sanchez-Dardon, B. N. Phenix, J. E. Kim, J. Mihowich, K. Jamison, N. Hawley-Foss, D. H. Lynch, and A. D. Badley Induction of Cell Death in Human Immunodeficiency Virus-Infected Macrophages and Resting Memory CD4 T Cells by TRAIL/Apo2L J. Virol., November 15, 2001; 75(22): 11128 - 11136. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Hausmann, K. Schamel, and P. Staeheli CD8+ T Lymphocytes Mediate Borna Disease Virus-Induced Immunopathology Independently of Perforin J. Virol., November 1, 2001; 75(21): 10460 - 10466. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Secchiero, P. Mirandola, D. Zella, C. Celeghini, A. Gonelli, M. Vitale, S. Capitani, and G. Zauli Human herpesvirus 7 induces the functional up-regulation of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) coupled to TRAIL-R1 down-modulation in CD4+ T cells Blood, October 15, 2001; 98(8): 2474 - 2481. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. E. Tollefson, K. Toth, K. Doronin, M. Kuppuswamy, O. A. Doronina, D. L. Lichtenstein, T. W. Hermiston, C. A. Smith, and W. S. M. Wold Inhibition of TRAIL-Induced Apoptosis and Forced Internalization of TRAIL Receptor 1 by Adenovirus Proteins J. Virol., October 1, 2001; 75(19): 8875 - 8887. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.-O. Vidalain, O. Azocar, H. Yagita, C. Rabourdin-Combe, and C. Servet-Delprat Cytotoxic Activity of Human Dendritic Cells Is Differentially Regulated by Double-Stranded RNA and CD40 Ligand J. Immunol., October 1, 2001; 167(7): 3765 - 3772. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. M. Baetu, H. Kwon, S. Sharma, N. Grandvaux, and J. Hiscott Disruption of NF-{kappa}B Signaling Reveals a Novel Role for NF-{kappa}B in the Regulation of TNF-Related Apoptosis-Inducing Ligand Expression J. Immunol., September 15, 2001; 167(6): 3164 - 3173. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Furlan, E. Brambilla, F. Ruffini, P. L. Poliani, A. Bergami, P. C. Marconi, D. M. Franciotta, G. Penna, G. Comi, L. Adorini, et al. Intrathecal Delivery of IFN-{gamma} Protects C57BL/6 Mice from Chronic-Progressive Experimental Autoimmune Encephalomyelitis by Increasing Apoptosis of Central Nervous System-Infiltrating Lymphocytes J. Immunol., August 1, 2001; 167(3): 1821 - 1829. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. L. Jelachich and H. L. Lipton Theiler's Murine Encephalomyelitis Virus Induces Apoptosis in Gamma Interferon-Activated M1 Differentiated Myelomonocytic Cells through a Mechanism Involving Tumor Necrosis Factor Alpha (TNF-{alpha}) and TNF-{alpha}-Related Apoptosis-Inducing Ligand J. Virol., July 1, 2001; 75(13): 5930 - 5938. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Ganster, B. S. Taylor, L. Shao, and D. A. Geller Complex regulation of human inducible nitric oxide synthase gene transcription by Stat 1 and NF-kappa B PNAS, June 28, 2001; (2001) 151239498. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Chawla-Sarkar, D. W. Leaman, and E. C. Borden Preferential Induction of Apoptosis by Interferon (IFN)-{beta} Compared with IFN-{{alpha}}2: Correlation with TRAIL/Apo2L Induction in Melanoma Cell Lines Clin. Cancer Res., June 1, 2001; 7(6): 1821 - 1831. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Liu, Y. Yu, M. Zhang, W. Wang, and X. Cao The Involvement of TNF-{{alpha}}-Related Apoptosis-Inducing Ligand in the Enhanced Cytotoxicity of IFN-{{beta}}-Stimulated Human Dendritic Cells to Tumor Cells J. Immunol., May 1, 2001; 166(9): 5407 - 5415. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Di Pietro, P. Secchiero, R. Rana, D. Gibellini, G. Visani, K. Bemis, L. Zamai, S. Miscia, and G. Zauli Ionizing radiation sensitizes erythroleukemic cells but not normal erythroblasts to tumor necrosis factor-related apoptosis-inducing ligand (TRAIL)-mediated cytotoxicity by selective up-regulation of TRAIL-R1 Blood, May 1, 2001; 97(9): 2596 - 2603. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. B. Adkins, S. C. Blacklow, and J. A. T. Young Two Functionally Distinct Forms of a Retroviral Receptor Explain the Nonreciprocal Receptor Interference among Subgroups B, D, and E Avian Leukosis Viruses J. Virol., April 15, 2001; 75(8): 3520 - 3526. [Abstract] [Full Text] |
||||
![]() |
M. J. Smyth, E. Cretney, K. Takeda, R. H. Wiltrout, L. M. Sedger, N. Kayagaki, H. Yagita, and K. Okumura Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (Trail) Contributes to Interferon {gamma}-Dependent Natural Killer Cell Protection from Tumor Metastasis J. Exp. Med., March 19, 2001; 193(6): 661 - 670. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Miura, N. Misawa, N. Maeda, Y. Inagaki, Y. Tanaka, M. Ito, N. Kayagaki, N. Yamamoto, H. Yagita, H. Mizusawa, et al. Critical Contribution of Tumor Necrosis Factor-Related Apoptosis-Inducing Ligand (Trail) to Apoptosis of Human Cd4+T Cells in HIV-1-Infected Hu-Pbl-Nod-Scid Mice J. Exp. Med., March 5, 2001; 193(5): 651 - 660. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Yun, M. D. Tallquist, A. Aicher, K. L. Rafferty, A. J. Marshall, J. J. Moon, M. K. Ewings, M. Mohaupt, S. W. Herring, and E. A. Clark Osteoprotegerin, a Crucial Regulator of Bone Metabolism, Also Regulates B Cell Development and Function J. Immunol., February 1, 2001; 166(3): 1482 - 1491. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wang, L. Zhang, X. Zhang, J. Moreno, X. Luo, M. Tondravi, and Y. Shi Differential Regulation of the Expression of CD95 Ligand, Receptor Activator of Nuclear Factor-{{kappa}}B Ligand (RANKL), TNF-Related Apoptosis-Inducing Ligand (TRAIL), and TNF-{{alpha}} During T Cell Activation J. Immunol., February 1, 2001; 166(3): 1983 - 1990. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Hilliard, A. Wilmen, C. Seidel, T.-S. T. Liu, R. Goke, and Y. Chen Roles of TNF-Related Apoptosis-Inducing Ligand in Experimental Autoimmune Encephalomyelitis J. Immunol., January 15, 2001; 166(2): 1314 - 1319. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. A. Street, E. Cretney, and M. J. Smyth Perforin and interferon-{gamma} activities independently control tumor initiation, growth, and metastasis Blood, January 1, 2001; 97(1): 192 - 197. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Arrode, C. Boccaccio, J. Lulé, S. Allart, N. Moinard, J.-P. Abastado, A. Alam, and C. Davrinche Incoming Human Cytomegalovirus pp65 (UL83) Contained in Apoptotic Infected Fibroblasts Is Cross-Presented to CD8+ T Cells by Dendritic Cells J. Virol., November 1, 2000; 74(21): 10018 - 10024. [Abstract] [Full Text] |
||||
![]() |
J. M. Routes, S. Ryan, A. Clase, T. Miura, A. Kuhl, T. A. Potter, and J. L. Cook Adenovirus E1A Oncogene Expression in Tumor Cells Enhances Killing by TNF-Related Apoptosis-Inducing Ligand (TRAIL) J. Immunol., October 15, 2000; 165(8): 4522 - 4527. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Clarke, S. M. Meintzer, S. Gibson, C. Widmann, T. P. Garrington, G. L. Johnson, and K. L. Tyler Reovirus-Induced Apoptosis Is Mediated by TRAIL J. Virol., September 1, 2000; 74(17): 8135 - 8139. [Abstract] [Full Text] |
||||
![]() |
A. S. Diamond and R. G. Gill An Essential Contribution by IFN-{gamma} to CD8+ T Cell-Mediated Rejection of Pancreatic Islet Allografts J. Immunol., July 1, 2000; 165(1): 247 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Zamai, P. Secchiero, S. Pierpaoli, A. Bassini, S. Papa, E. S. Alnemri, L. Guidotti, M. Vitale, and G. Zauli TNF-related apoptosis-inducing ligand (TRAIL) as a negative regulator of normal human erythropoiesis Blood, June 15, 2000; 95(12): 3716 - 3724. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. F. Tran, T. H. Holmstrom, M. Ahonen, V.-M. Kahari, and J. E. Eriksson MAPK/ERK Overrides the Apoptotic Signaling from Fas, TNF, and TRAIL Receptors J. Biol. Chem., May 4, 2001; 276(19): 16484 - 16490. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. W. Ganster, B. S. Taylor, L. Shao, and D. A. Geller Complex regulation of human inducible nitric oxide synthase gene transcription by Stat 1 and NF-kappa B PNAS, July 17, 2001; 98(15): 8638 - 8643. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |