The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mickelsen, S.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mickelsen, S.
Right arrow Articles by Meek, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
The Journal of Immunology, 1999, 163: 834-843.
Copyright © 1999 by The American Association of Immunologists

Modulation of Terminal Deoxynucleotidyltransferase Activity by the DNA-Dependent Protein Kinase1

Scott Mickelsen*, Carolyn Snyder*, Kelly Trujillo{dagger}, Molly Bogue{ddagger}, David B. Roth{ddagger} and Katheryn Meek2,*

* Harold C. Simmons Arthritis Research Center and Departments of Internal Medicine and Microbiology, University of Texas Southwestern Medical Center, Dallas, TX 75235; {dagger} Department of Molecular Medicine, Institute for Biotechnology, University of Texas Health Science Center, San Antonio, TX 78245; and {ddagger} Department of Microbiology and Immunology and § Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX 77030


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Rare Ig and TCR coding joints can be isolated from mice that have a targeted deletion in the gene encoding the 86-kDa subunit of the Ku heterodimer, the regulatory subunit of the DNA-dependent protein kinase (DNA-PK). However in the coding joints isolated from Ku86-/- animals, there is an extreme paucity of N regions (the random nucleotides added during V(D)J recombination by the enzyme TdT). This finding is consistent with a decreased frequency of coding joints containing N regions isolated from C.B-17 SCID mice that express a truncated form of the catalytic subunit of the DNA-PK (DNA-PKCS). This finding suggests an unexpected role for DNA-PK in addition of N nucleotides to coding ends during V(D)J recombination. In this report, we establish that TdT forms a stable complex with DNA-PK. Furthermore, we show that DNA-PK modulates TdT activity in vitro by limiting both the length and composition of nucleotide additions.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The third complementarity determining regions (CDR3) of Igs and TCRs are unequivocally the most diverse structures in biology. This diversity is generated during site specific recombination (V(D)J rearrangement) of the gene segments that encode Ag receptors (reviewed in Refs. 1, 2, 3). Diversity is achieved by several mechanisms, including 1) combinatorial diversity, 2) asymmetric opening of the hairpin coding end intermediates generating palindromic overhangs (P segments), 3) nucleotide loss from coding ends, and 4) random nucleotide additions (N segments) by the enzyme TdT (4, 5, 6, 7, 8, 9).

In recent years, considerable progress has been made in understanding mechanistic details of the V(D)J recombination reaction. Recombination is initiated by the lymphocyte specific endonuclease, composed of recombination activating gene-1 (RAG-1)3 1 and RAG-2, leaving hairpinned coding end intermediates and blunt phosphorylated signal end intermediates (9, 10, 11, 12, 13, 14, 15, 16, 17). Resolution of recombination intermediates is mediated by ubiquitously expressed factors of the DNA double strand break repair pathway (18, 19). Four of these double strand break repair factors have been defined: Ku70, Ku86, DNA-PKCS, and XRCC4 (20, 21, 22, 23, 24, 25, 26). The heterodimeric DNA end binding factor, Ku, has been shown to direct DNA-PKCS (the SCID factor) to damaged DNA, thus generating a DNA-dependent protein kinase (DNA-PK; Refs. 27, 28). Although Ku and DNA-PKCS are clearly required for V(D)J recombination, there are currently no biochemical data clarifying what their specific role(s) are. The fact that DNA-PK is activated by damaged DNA has led to the hypothesis that DNA-PK may activate mediators of DNA repair via phosphorylation. To date, this model has not been tested, and other functions for DNA-PK (such as a role in scaffolding to facilitate assembly of the repair complex) have also been suggested (reviewed in Refs. 29, 30, 31). We have recently demonstrated that XRCC4 is both a target for and complexes with DNA-PK in vitro, suggesting that DNA-PK and XRCC4 may function in concert in resolving DNA breaks (32). In addition, XRCC4 has been shown to interact with and stimulate DNA ligase IV activity (33, 34). These data suggest a model whereby XRCC4 may target cellular ligase activities to damaged DNA bound by DNA-PK.

It has been appreciated for more than a decade that the resolution of coding ends and signal ends are fundamentally different (35). Signal ends are largely unmodified before ligation, whereas coding joints exhibit both nucleotide loss and gain at the site of joining (2, 35). It has been established that nucleotide loss from coding ends is an intrinsic characteristic of the recombination reaction. The degree of nucleotide loss is largely dependent on the fine structure of the coding ends and is not differentially regulated (7, 8, 36); the exonuclease(s) responsible for coding modification has not been identified (37). In contrast, nucleotide addition is not an intrinsic feature of the recombination reaction in that N segments are not observed in certain coding joints (for example in mice, Ig light chains and fetal and neonatal immune receptors generally lack N segments (7, 38, 39, 40, 41, 42, 43)). This is explained by the regulated expression of TdT, both during development (absent in fetal and neonatal lymphocytes) and during B cell ontogeny (expressed in pro B cells but absent in pre B cells; reviewed in Ref. 44). However, regulated expression of TdT does not explain the relative lack of N segments in signal joints.

Recently, we reported that rare coding joints from Ku86-/--deficient mice have virtually no N segments even though TdT mRNA is expressed (45). In fact, in Ku86-/- animals, the number of rearrangements with N segments is comparable with that observed in TdT-/- animals (Table IGo; Refs. 46, 47). Furthermore, a less complete (but still severe) deficit in N segment addition is observed in coding joints isolated from C.B-17 SCID mice (48); these animals are defective in DNA-PKCS expression because of a premature stop codon in the coding region resulting in a small C-terminal deletion (49, 50). Although the mutation in DNA-PKCS in SCID mice deletes only the C-terminal 83 aa, the expressed protein is not stable and DNA-PKCS levels are severely diminished (0–10% of wild-type levels, depending on the cell type analyzed) (50). Together, these findings (summarized in Table IGo) suggest an unsuspected role for DNA-PK in addition of N nucleotides to DNA ends during V(D)J recombination. Thus, in this report we investigated interactions between DNA-PK and TdT in vitro. We present the first evidence that TdT can form a stable complex with DNA-PK bound to DNA.


View this table:
[in this window]
[in a new window]
 
Table I. V(D)J rearrangements with N nucleotide additions1

 
Though TdT can be demonstrated to have both nucleotide preferences and specific DNA end preferences in vitro, under certain conditions, the enzyme can catalyze very long (1 kb or more) nucleotide additions (with either dATP, dCTP, dGTP, or dTTP) to virtually any DNA end containing a 3'-OH (51, 52, 53, 54). The actions of TdT are more limited in vivo in that only a few nucleotides (on average, 2–5) are added to coding ends, and there is a marked bias toward dGTP and dCTP additions. Thus we also investigated the capacity of DNA-PK to modulate TdT activity and found that the level of nucleotide addition by TdT is limited in the presence of DNA-PK.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Oligonucleotides

Sequences of the oligonucleotides used in these studies are as follows: 50 mers: top, 5'-GATCTGGCCTGTCTTACACAGTGCTACAGACTGGAACApAAAACCCTGCAG-3'; bottom, 5'-CTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATC-3'; bottom 5' overhang, 5'-TCCTGCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGA; bottom 3' overhang, 5'-GCAGGGTTTTTGTTCCAGTCTGTAGCACTGTGTAAGACAGGCCAGATCCT. 30 mers: top, 5'-TACGCTGGGAATTCGGGAAAGGATCCGGCC-3'; bottom, 5'-GGCCGGATCCTTTCCCGAATTCCCAGCGTA-3'; bottom 3' overhang, 5'- GGATCCTTTCCCGAATTCCCAGCGTA.

The 50 mers used in Figs. 1Go, 3Go, 5Go, and 6Go contain a V(D)J RSS; however, completely analogous results were obtained with other oligonucleotides lacking RSS. Single-stranded oligonucleotides were labeled at the 5' termini with T4 PNK (New England Biolabs; Beverly, MA) and [{gamma}-32P]ATP and were annealed with complementary oligonucleotides to generate double-stranded oligonucleotides with blunt termini, or termini with either 5' or 3' extensions. After annealing, oligonucleotides were purified on native polyacrylamide gels.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 1. TdT forms a stable complex with DNA-PK+DNA by EMSA. A, A 32P-labeled double-stranded oligonucleotide 30 mer with a blunt terminus was incubated as follows: alone (lane 1); 30 ng recombinant Ku alone (lane 2); 10 ng recombinant TdT (Life Technologies) and 30 ng recombinant Ku (lane 3); 20 ng recombinant TdT (Life Technologies) and 30 ng recombinant Ku (lane 4); 40 ng recombinant TdT (Life Technologies) and 30 ng recombinant Ku (lane 5); 40 ng recombinant TdT alone (lane 6); 75 ng complete DNA-PK alone (lane 7); 75 ng complete DNA-PK (Promega) and 10 ng recombinant TdT (lane 8); 75 ng complete DNA-PK (Promega) and 20 ng recombinant TdT (lane 9); 75 ng complete DNA-PK (Promega) and 40 ng recombinant TdT (lane 10); 40 ng recombinant TdT which had been heat inactivated at 95°C for 5 min (lane 11). (Heat denaturation of TdT resulted in some nonspecific precipitation of the DNA probe in lane 11.) Migration retarded species corresponding to Ku + DNA, DNA-PK (i.e., DNA-PKCS + Ku)+DNA, and TdT + DNA-PK + DNA are indicated. A total of 120 ng recombinant bovine TdT was analyzed by silver staining (lane 12) or immunoblotting with a polyclonal anti-TdT antisera (Dako, Carpinteria, CA; lane 13) after separating by 12% SDS-PAGE. B, A 32P-labeled double-stranded oligonucleotide 30 mer with a blunt terminus was incubated with the following: 30 ng recombinant Ku alone (lane 1) or with 60, 120, or 240 ng highly purified DNA-PKCS (lanes 2–4); 240 ng highly purified DNA-PKCS alone (lane 5); 30 ng recombinant TdT (Life Technologies) plus 240 ng highly purified DNA-PKCS (lane 6); 30 ng recombinant TdT alone (lane 7); 30 ng recombinant TdT plus 30 ng recombinant Ku (lane 8); 30 ng recombinant Ku, 240 ng DNA-PKCS, and 30 ng recombinant TdT (lane 9); no protein (lane 10); 60 ng complete DNA-PK alone (lane 11); 60 ng complete DNA-PK and 30 ng recombinant TdT. Migration retarded species corresponding to Ku + DNA, DNA-PK + DNA, and TdT + DNA-PKm+ DNA are indicated. Silver staining of 1.8 µg complete DNA-PK (lane 12), 1.8 µg purified DNA-PKCS (lane 14), 3 µg recombinant Ku; and control Ni+ fractions of wild-type AcMNPV-infected Sf9 cells (lane 16) after separating by 8% SDS-PAGE. C, A 32P-labeled double-stranded oligonucleotide 50 mer with a blunt terminus was incubated with the following: 30 ng recombinant Ku alone (lane 1); 25 U calf thymus TdT (Boehringer Mannheim) and 30 ng recombinant Ku (lane 2); 50 U calf thymus TdT and 30 ng recombinant Ku (lane 2); 50 U TdT alone (lane 4); 120 ng complete DNA-PK alone (lane 5); 120 ng complete DNA-PK and 25 U calf thymus TdT (lane 6); 120 ng complete DNA-PK and 50 U calf thymus TdT (lane 7) as indicated above each lane. Migration retarded species corresponding to Ku + DNA, 2x Ku + DNA, DNA-PK (i.e., DNA-PKCS + Ku)+DNA, and TdT + DNA-PK + DNA are indicated. A total of 100 U calf thymus TdT was analyzed by silver staining (lane 8) or immunoblotting (lane 9) after separating by 12% SDS-PAGE.

 


View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 3. TdT binds DNA-PK complexed to DNA with a variety of different termini by EMSA. A 32P-labeled oligonucleotide was annealed to three different complementary pairs to generate double-stranded oligonucleotides with termini having either 5' extensions (lanes 1 and 2), blunt termini (lanes 3 and 4), or termini with 3' extensions (lanes 5 and 6). A total of 125 ng DNA-PK alone (lanes 1, 3, and 5) or with 30 ng TdT (lanes 2, 4, and 6) was incubated with each of the radiolabeled probes as indicated. Migration retarded species corresponding to DNA-PK + DNA, and TdT + DNA-PK + DNA are indicated.

 


View larger version (66K):
[in this window]
[in a new window]
 
FIGURE 5. DNA-PK inhibition of TdT activity using either dNTPs, dATP, dCTP, dGTP, or dTTP. TdT activity (using magnesium as the divalent cation) was assessed in the absence (lanes 2, 4, 6, 8, and 10) or presence of DNA-PK (lanes 3, 5, 7, 9, and 11). A 32P end-labeled double-stranded oligonucleotide with a 3' extension was used as the TdT substrate. TdT activity was assessed with the following sources of nucleotides: 1 mM dATP; 1 mM dCTP; 1 mM dGTP; 1 mM dTTP (lanes 1–3) and 1 mM dATP (lanes 4 and 5); 1 mM dCTP (lanes 6 and 7); 1 mM dGTP (lanes 8 and 9); or 1 mM dTTP (lanes 10 and 11). Reactions were analyzed on a 10% sequencing gel. The position of the unmodified oligonucleotide is as indicated.

 


View larger version (63K):
[in this window]
[in a new window]
 
FIGURE 6. The DNA-PK kinase activity does not contribute to its ability to either interact with TdT or modulate the activity of TdT. A, Recombinant murine XRCC4 (32 ) was incubated with DNA-PK (Promega) in the presence (lanes 1, 3, 5, and 7) or absence (lanes 2, 4, 6, and 8) of linearized plasmid DNA. Wortmannin was included at final concentrations of 0.05, 0.5, or 5 µM as indicated. Kinase reactions were analyzed on a 10% SDS-PAGE gel which was exposed to film. Migration of recombinant XRCC4 is as indicated. B, A 32P-labeled double-stranded oligonucleotide was incubated with 105 ng DNA-PK (Promega) in the presence or absence of the indicated concentrations of wortmannin (Sigma) as indicated above each lane. Migration retarded species corresponding to Ku + DNA, 2x Ku + DNA, and DNA-PKCS + Ku + DNA are indicated. C, A 32P-labeled double-stranded oligonucleotide was incubated with 105 ng DNA-PK (Promega) in the presence or absence of 30 U (~20 ng) recombinant TdT (Life Technologies) and in the presence or absence of 5 µM wortmannin (Sigma) as indicated above each lane. Migration retarded species corresponding to Ku + DNA, 2x Ku + DNA, DNA-PKCS + Ku + DNA, and TdT + DNA-PKCS + Ku + DNA are indicated. D, TdT activity (using cobalt as the divalent cation) was assessed using calf thymus TdT (lanes 2–7) in the absence (lanes 2–4) or presence of DNA-PK (lane 5–7), and in the presence of either 0.5 µM (lanes 3 and 6) or 5 µM wortmannin (lanes 4 and 7) as indicated.

 
EMSA analyses

EMSAs were done by the method of Landolfi et al. (55) with the following modifications. Binding reactions were done in the following buffer C (10 mM HEPES (pH 7.9), 12.5% glycerol, 210 mM NaCl, and 0.75 mM MgCl2) instead of buffer D, nonspecific competitor was not added, and BSA was included at a concentration of 3 mg/ml. DNA-PK purified from HeLa cells (Promega, Madison, WI) was used in conjunction with either recombinant bovine TdT (Life Technologies, Gaithersburg, MD) or bovine TdT purified from calf thymus (Boehringer Mannheim, Indianapolis, IN). Binding reactions were assembled on ice and then incubated at 30°C for 30 min. Protein/DNA complexes were resolved on 4% native polyacrylamide gels in 0.5x TBE with 2% glycerol.

Purification of DNA-PKCS from Raji cell extracts

Clarified nuclear extract (fraction I), prepared as described (56, 57) from 10 ml of human Burkitt’s lymphoma cell pellet (Raji cells; purchased from the National Cell Culture Center, Minneapolis, MN) obtained from 10 liters culture, was treated with ammonium sulfate at 0.21 g/ml. The supernatant obtained after centrifugation (20,000 x g; 30 min) was treated with additional ammonium sulfate at 0.08 g/ml, and the protein precipitate was collected by centrifugation (20,000 x g, 30 min), dissolved in 20 ml buffer T (20 mM Tris-HCl (pH 7.4), 10% glycerol, 0.5 mM EDTA, and 1 mM DTT) with protease inhibitors (2 µg/ml each of aprotinin, chymostatin, leupeptin, and pepstatin A), and dialyzed for 3 h against buffer T with 50 mM KCl. The dialysate (fraction II) was applied onto a column of Q-Sepharose (3 ml total) and the bound proteins were eluted with a 40-ml gradient of 50–330 mM KCl in buffer T, collecting 40 fractions. The peak of DNA-PKCS (fraction III, 4.5 ml), eluting at ~200 mM KCl, was identified by immunoblotting and applied directly onto a 1-ml Macrohydroxyapatite (Bio-Rad, Richmond, CA) column, which was developed with a 24-ml gradient of 100–300 mM KH2PO4 in buffer K (20 mM KH2PO4, 10% glycerol, 0.5 mM EDTA, 0.5 mM DTT, and 0.01% Nonidet P-40) with 50 mM KCl, collecting 24 fractions. The DNA-PKCS pool (fraction IV, 3 ml), which eluted at ~200 mM KH2PO4, was concentrated to 0.5 ml in a Centricon-30 microconcentrator (Amicon, Beverly, MA) and subjected to gel filtration in a 22 ml Sephacryl S300 column in buffer K with 100 mM KCl. The S300 pool of DNA-PKCS (fraction V, 2.4 ml) was fractionated in a MiniS column (Pharmacia, Piscataway, NJ) with an 8-ml gradient of 50–525 mM KCl in K buffer, collecting 32 fractions. The DNA-PKCS peak (~275 mM KCl, fraction VI, 1.0 ml) was diluted with two volumes of buffer K and further fractionated in a MiniQ column (Pharmacia) with a 6-ml gradient of 50–330 mM KCl in buffer K. Nearly homogeneous DNA-PKCS (fraction VII, ~200 mM KCl) was concentrated to a small volume and stored at -70°C in small portions.

Purification of recombinant Ku

The Ku86 and Ku70 baculoviruses were the generous gifts of Dr. J. Donald Capra (Oklahoma Medical Research Foundation, Oklahoma City, OK) and have been described previously (58). For protein purification, 3.5 x 108 Sf9 cells which had been infected with either equal ratios of Ku86 and Ku70 encoding viruses or wild-type AcMNPV ~60 h earlier were collected and washed with PBS. Cell pellets were frozen and thawed three times in liquid nitrogen in 25 ml of the following buffer: 20 mM HEPES (pH 7.9), 0.42 M NaCl, 25% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 5 mM imidazole, and 0.5 mM PMSF. The lysates were centrifuged for 30 min at 18,000 x g. Lysates were incubated for 1.5 h at 4°C with 1 ml Ni-NTA resin (Qiagen, Chatsworth, CA), and the resin washed three times in the same buffer with the addition of 50 mM imidazole. Proteins were eluted in the same buffer with 500 mM imidazole and then dialyze into the starting buffer without imidazole. Contaminating Sf9 proteins can comprise a significant percentage of the total protein in crude Ni+ fractions; for this reason, control Ni+ preparations of wild-type infected Sf9 cells were also prepared and used as controls in EMSA assays and TdT assays.

TdT assays

32P-end labeled double-stranded oligonucleotides were used as TdT substrates. When using cobalt as a source of divalent cations, TdT activity was assessed in the following buffer: 100 mM potassium cacodylate (pH 7.2), 1 mM CoCl2, 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP, and 1.25 mg/ml BSA. When using magnesium as a source of divalent cations, TdT activity was assessed in the following buffer: 100 mM Na cacodylate (pH 7.5), 1 mM dATP, 1 mM dCTP, 1 mM dGTP, 1 mM dTTP, 1 mM MgCl2, and 3 mg/ml BSA. In some experiments, the nucleotide and/or divalent cation concentrations are altered as indicated in each figure legend. TdT reactions were analyzed on 10% sequencing gels.

Kinase assays

Recombinant murine XRCC4 (1 µg) (32) was incubated with 300 ng DNA-PK (Promega), with or without 100 ng of linearized pTZ19R plasmid DNA (Pharmacia Biotech) in a total volume of 20 µl Z buffer (25 mM HEPES/KOH (pH 7.9), 50 mM KCl, 10 mM MgCl2, 20% glycerol, 0.1% Nonidet P-40, and 1 mM DTT) (22). The mixtures were incubated with 37.5 µCi [{gamma}-32P]ATP for 30 min at 30oC, then mixed with an equal volume of 2x SDS-PAGE buffer and loaded onto a 10% SDS-polyacrylamide gel. Following electrophoresis, gels were dried and exposed to film. Wortmannin (Sigma, St. Louis, MO) was included at final concentrations of 0.05, 0.5, or 5 µM, as indicated.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TdT interacts with DNA-PK bound to DNA

Interactions between TdT and DNA-PK were first examined using EMSAs using commercially available complete DNA-PK (i.e., containing Ku + DNA-PKCS isolated from HeLa cells), baculovirus expressed Ku, and baculovirus expressed bovine TdT (Fig. 1GoA). One distinct species is apparent when recombinant Ku is incubated with the radiolabeled 30 mer corresponding to Ku + DNA (lane 2), whereas an additional weaker species is apparent when purified DNA-PK is incubated with the probe (corresponding to Ku + DNA-PKCS + DNA, lane 7). Under the conditions employed in Fig. 1GoA, stable TdT + DNA complexes are not observed (lane 6). However, TdT has been shown to stably complex with DNA in vitro (53, 54), but the binding of TdT to DNA was shown to be cooperative, and these interactions are best demonstrated with large DNA fragments (the probe in Fig. 1Go is only 30 bp). Thus, under the conditions employed, the interactions of TdT with DNA do not interfere with the assessment of the potential interactions of TdT with DNA-PK. In the presence of ~1.5-, 3-, and 6-fold molar excess of recombinant TdT (lanes 8–10), the Ku + DNA-PKCS + DNA species is completely converted to a slower migrating form, suggesting that TdT can complex with complete DNA-PK bound to DNA. This slower migrating form is not observed when the probe is incubated with DNA-PK and heat-inactivated TdT (lane 11). In the presence of TdT, the complex containing Ku + DNA-PKCS retards significantly more probe and at higher TdT concentrations, the Ku alone complex is diminished suggesting that the TdT dependent complex is more stable than Ku + DNA-PKCS alone. The fact that the DNA-PK complex is completely converted to a slower migrating form with only 1.5-fold molar excess of recombinant TdT suggests that TdT (as opposed to contaminants in the TdT preparation) is complexing with complete DNA-PK bound to DNA ends. Indeed, silver staining of this preparation demonstrates that the recombinant TdT preparations are extremely pure (lanes 12 and 13) containing only the 58-kDa and 42-kDa forms of TdT.

In contrast, the commercial preparation of DNA-PK is only ~70% pure; silver staining of this preparation demonstrates several contaminants (Fig. 1GoB, lane 13). To rule out the possibility that the DNA-protein complexes observed contain proteins other than DNA-PKCS, Ku + TdT, DNA-PK-TdT interactions were reassessed using recombinant Ku, and DNA-PKCS purified from HeLa cells to near homogeneity (as ascertained by silver staining, lane 14). Because the Ni+ agarose fractions of recombinant Ku are not completely pure (lane 15) a Ni+ agarose fraction of Sf9 cells infected with wild-type AcMNPV was used as a control (lanes 5–7). As can be seen in Fig. 1GoB, coincubation of 30 ng recombinant Ku with a radiolabeled 30 mer generates a single predominate retarded species representing Ku + DNA and a minor species which represents two Ku heterodimers bound to the DNA (lane 1). The addition, of increasing amounts of highly purified DNA-PKCS (60, 120, or 240 ng, lanes 2–4) generates a slower migrating complex which exactly comigrates with the slower migrating complex observed using preparations of complete DNA-PK (lane 11). The Ku + DNA protein complex is the predominate complex observed when recombinant TdT is coincubated with Ku + DNA (lane 8). However, when recombinant TdT is coincubated with highly purified DNA-PKCS and recombinant Ku (lane 9) or complete DNA-PK (lane 12), the slower migrating complex representing Ku + DNA + DNA-PKCS is completely converted to a slower migrating form. In lanes 4, 8, and 9, a minor complex which migrates slightly slower than Ku + DNA alone but faster than complete DNA-PK + DNA or the 2x Ku complex is observed suggesting a possible weak interaction between TdT and Ku. As in Fig. 1GoA, in the presence of TdT, complexes containing complete DNA-PK (lanes 9 and 12) retard significantly more probe than in the absence of TdT; in addition, in the presence of TdT, the Ku alone complex is diminished (in lane 9 there is a 2.5 molar excess of DNA-PKCS over Ku). This finding suggests that the TdT + Ku + DNA-PKCS + DNA complex is more stable than DNA-PKCS + Ku + DNA alone. As discussed above, stable TdT + DNA complexes are not observed under these conditions (lane 7). Although DNA-PKCS has been shown to bind DNA in the absence of Ku, this only occurs in conditions employing less than 100 mM NaCl (59). In this experiment (with 200 mM NaCl), when highly purified DNA-PKCS is incubated with radiolabeled 30 mer alone, no DNA-protein complexes are observed (lane 5). However, when the probe is coincubated with both recombinant TdT and highly purified DNA-PKCS, a weak complex is consistently observed which migrates similarly to the Ku + DNA-PKCS complex, suggesting that TdT and DNA-PKCS can bind DNA weakly in the absence of Ku (lane 6). Finally, we also assessed TdT interactions with DNA-PK by EMSA using low salt concentrations and the same buffer used to assay TdT catalysis (25 mM sodium cacodylate; see below) with completely analogous results (data not shown). In sum, these data demonstrate that TdT interacts with complete DNA-PK bound to DNA ends and suggest that DNA-PK may play a role in targeting TdT to DNA ends during V(D)J recombination.

We next assessed DNA-PK interactions with TdT isolated from calf thymus. As can be seen in Fig. 1GoC, when calf thymus TdT is coincubated with complete DNA-PK (lanes 6 and 7), the slower migrating complex representing Ku + DNA + DNA-PKCS is completely converted to an even slower migrating form completely analogous to what is observed when recombinant TdT is coincubated with complete DNA-PK and DNA. However, an additional complex is also observed which migrates just slower than the Ku + DNA complex, suggesting an interaction between Ku and TdT. Similarly, when calf thymus TdT is coincubated with recombinant Ku, an additional complex is observed which migrates more slowly than the Ku + DNA complex (lane 3). TdT isolated from normal cells is extremely heterogeneous consisting of 58-, 44-, 42-, and 32-kDa forms that result from proteolysis of the full-length (58-kDa) form. It is not entirely clear whether these catalytically active degradation products are physiologically relevant. Many commercially available preparations of TdT from calf thymus contain only the smaller proteolytic fragments of TdT. The impurity of the calf thymus preparations which contain predominately the 44-kDa and 32-kDa forms (lane 8) precludes concluding that Ku alone interacts with TdT. However, numerous coprecipitation experiments conducted using untagged and His-tagged forms of both Ku and full-length TdT expressed in Sf9 cells consistently failed to demonstrate interactions between full-length TdT and Ku (data not shown). The question of whether Ku interacts with proteolytic fragments of TdT is under investigation.

DNA-PK inhibits TdT catalysis

In vitro TdT catalyzes template-independent addition of long extensions (up to several kilobases; Ref. 51) to the 3' ends of DNA. The properties exhibited by purified TdT in vitro do not correlate well with the characteristics of N regions produced in vivo (44). However, in vitro, the extent of modification varies dramatically under different conditions; for instance, the addition of cobalt ions has been demonstrated to result in higher TdT activity than magnesium or manganese ions. (The physiologic divalent cofactor for TdT is not known.) The relative concentrations of divalent cation and free nucleotides have also been reported to alter TdT catalysis (51). In vivo, the concentration of divalent cations exceeds that of free nucleotide (in lymphocytes, free nucleotide concentrations have been estimated to be ~30–90 µM, (60)). We investigated the effect of altering the ratio of nucleotide and divalent cation concentrations to determine whether under more physiologic nucleotide concentrations, TdT catalysis more closely mimicked authentic N segment addition (Fig. 2GoA). Conditions normally used in TdT assays include 1 mM cobalt and 1 mM dNTPS. Under these conditions, extremely long TdT additions are observed (lanes 2 and 10). When the concentration of divalent cation is increased (so the concentration of cations exceeds nucleotide concentration, lanes 3–5) no major effect on catalysis is observed. In contrast, when the nucleotide concentration is decreased to more physiologic levels, the average length of TdT additions is actually markedly enhanced (lanes 11–13); whereas increasing free nucleotide levels above 1 mM strongly inhibits activity (lanes 6–8). Thus, it seems possible that the activity of TdT in vivo might be in some way regulated, and we next examined the effect of DNA-PK on the polymerase activity of TdT. Because of the extreme variability of TdT catalysis in vitro, we performed these experiments under a variety of conditions. In the presence of cobalt, TdT catalyzes the addition of several hundred nucleotides (Fig. 2GoB, lane 2), whereas in the presence of magnesium, TdT catalyzes the addition of 1–20 nt to the oligonucleotide substrate (Fig. 2GoB, lane 8). However, regardless of the divalent cation used, virtually all of the substrate is modified to some extent by TdT. Under both experimental conditions, the activity of TdT is altered by DNA-PK in two ways: less of the substrate is modified and shorter nucleotide extensions are observed (only 1–2 nt are added in the presence of DNA-PK and magnesium (Fig. 2GoB, lane 9); and 1–20 nt are added in the presence of DNA-PK and cobalt (Fig. 2GoB, lane 3)]. Furthermore, the same results were obtained using either recombinant TdT or TdT purified from calf thymus. As expected, heat inactivation ablates the inhibition of TdT activity of DNA-PK (Fig. 2GoB, lanes 4 and 10). Furthermore, TdT catalysis was not altered by the addition of several other DNA binding proteins (histone H1, topoisomerase I, data not shown). To more formally demonstrate that DNA-PK is responsible for the observed inhibition of TdT activity, we also assessed TdT activity in the presence of DNA-PK which had been pre-incubated with recombinant caspase-3. (It has been demonstrated previously that DNA-PKCS is specifically cleaved by caspase 3 during apoptosis (61, 62, 63, 64).) Thus, DNA-PK was preincubated with or without recombinant caspase-3; DNA-PKCS cleavage was confirmed by immunoblot analysis (data not shown). As can be seen in Fig. 2GoC, the inhibition of TdT catalysis for DNA-PK is substantially relieved by proteolytic cleavage of the catalytic subunit (compare lanes 3 and 4). Thus, we conclude that DNA-PKCS limits TdT catalysis in vitro. We next assessed the effect of both Ku and DNA-PKCS alone on TdT catalysis. As can be seen in Fig. 2GoD, TdT catalysis is not affected by 30 ng recombinant Ku (~2x molar excess, lane 4) as compared with control Ni+ fractions of wild-type AcMNPV infected Sf9 cells (lane 3). When increasing amounts of highly purified DNA-PKCS (60 ng, equal molar ratio; 120 ng, 2x molar ratio; 240 ng, 4x molar ratio; lanes 5–7) as well as Ku are included in the reaction, TdT catalysis is increasingly inhibited; the inhibition observed is roughly analogous to that observed when increasing concentrations of complete DNA-PK are included (lanes 11–13). Surprisingly, comparable inhibition is obtained with highly purified DNA-PKCS alone (lanes 8–10). Thus, we conclude that the catalytic subunit of DNA-PK inhibits TdT catalysis in vitro; the net result of this inhibition is that TdT extensions catalyzed in the presence of DNA-PK more closely resemble N segments in authentic immune receptors.



View larger version (51K):
[in this window]
[in a new window]
 
FIGURE 2. DNA-PK inhibits template-free nucleotide additions by TdT. A, TdT activity (using cobalt as the divalent cation) was assessed using calf thymus TdT with the following nucleotide and Co+ concentrations: lane 1, 1 mM Co+/1 mM dNTPs, no TdT; lane 2, 1 mM Co+/1 mM dNTPs; lane 3, 2 mM Co+/1 mM dNTPs; lane 4, 5 mM Co+/1 mM dNTPs; lane 5, 13 mM Co+/1 mM dNTPs; lane 6, 1 mM Co+/5 mM dNTPs; lane 7, 1 mM Co+/10 mM dNTPs; lane 8, 15 mM Co+/1 mM dNTPs; lane 9, 1 mM Co+/1 mM dNTPs but no TdT; lane 10, 1 mM Co+/1 mM dNTPs; lane 11, 1 mM Co+/0.1 mM dNTPs; lane 12, 1 mM Co+/0.01 mM dNTPs; lane 13, 1 mM Co+/0.001 mM dNTPs. Reactions were analyzed on a 10% sequencing gel. Migration of the xylene cyanol, which corresponds to ~55 bp, is shown. The position of the unmodified 30-bp oligonucleotide is as indicated. B, TdT activity (using cobalt as the divalent cation, lanes 1–6; or magnesium as the divalent cation, lanes 7–10) was assessed using calf thymus TdT (lanes 2–4 and 8–10) or recombinant bovine TdT (lanes 5 and 6) in the absence (lanes 2, 5, and 8), presence of DNA-PK (lane 3, 6, and 9), or presence of heat inactivated DNA-PK (95oC for 5 min, lanes 4 and 10). A 32P end-labeled double-stranded oligonucleotide with a 3' extension was used as the TdT substrate. Reactions were analyzed on a 10% sequencing gel. Migration of the xylene cyanol, which corresponds to ~55 bp, is shown. Position of the unmodified 30-bp oligonucleotide is as indicated. C, TdT activity was assessed using calf thymus TdT alone (lane 2), or in the presence of DNA-PK (lane 3), the presence of DNA-PK that was preincubated with recombinant caspase-3 (Upstate Biotechnology, Lake Placid, NY; lane 4), or in the presence of recombinant caspase 3 (lane 5). A 32P end-labeled double-stranded oligonucleotide with a 3' extension was used as the TdT substrate. Reactions were analyzed on a 10% sequencing gel. Migration of the xylene cyanol, which corresponds to ~55 bp, is shown. The position of the unmodified 30-bp oligonucleotide is as indicated. D, TdT activity (using cobalt as the divalent cation) was assessed as follows: lane 1, no TdT added; lane 2, TdT alone; lane 3, TdT with control Ni+ fractions of wild-type infected Sf9 cells; lane 4, 30 ng recombinant Ku; lane 5, 30 ng recombinant Ku and 60 ng DNA-PKCS; lane 6, 30 ng recombinant Ku and 120 ng DNA-PKCS; lane 7, 30 ng recombinant Ku and 240 ng DNA-PKCS; lane 8, 60 ng DNA-PKCS alone; lane 9, 120 ng DNA-PKCS alone; lane 10, 240 ng DNA-PKCS alone; lane 11, 60 ng complete DNA-PK; lane 12, 120 ng complete DNA-PK; lane 13, 240 ng complete DNA-PK.

 
DNA end structure affects TdT activity but not DNA-PK interaction

It is well established that N segment addition is generally limited to coding joints though short N segment additions are occasionally observed in signal joints (65, 66). If DNA-PK preferentially directs TdT to coding ends, this presents a paradox in that both coding and signal end resolution require DNA-PK (18, 67, 68, 69, 70, 71). In fact, both Ku and DNA-PKCS have been shown to complex with both coding and signal recombination intermediates in vitro (72). How then is TdT excluded from modifying signal ends bound by DNA-PK? One possibility is that in vivo blunt signal ends are poor substrates for TdT. Thus, we considered that DNA-PK bound to DNA probes with different termini might interact differently with TdT, and we compared the capacity of TdT to interact with DNA-PK bound to probes with 5' or 3' extensions and blunt termini. As can be seen in Fig. 3Go, when complete DNA-PK is coincubated with TdT and the DNA probe, virtually all of the DNA-PK + DNA complexes are shifted to a slower migrating form regardless of the structure of the DNA terminus. Thus, we conclude that TdT can interact with DNA-PK complexed to a variety of DNA end structures.

It has been reported that TdT prefers DNA termini with 3' or 5' extensions over blunt DNA ends though these preferences are somewhat controversial (51, 73, 74, 75). Thus, we next assessed DNA-PK inhibition of TdT activity using oligonucleotide substrates with different DNA termini. In these experiments, a single oligonucleotide was labeled and then annealed to two different complementary oligonucleotides to generate ends with either blunt or 3' extensions; TdT activity was subsequently assessed using these oligonucleotides in the presence of either cobalt or magnesium (Fig. 4Go). In both situations, the blunt DNA oligonucleotide is a poorer substrate for TdT than the oligonucleotide with the 3' extension, although considerable nucleotide addition to the blunt substrate is observed in the cobalt containing reactions. Furthermore, in the presence of DNA-PK, nucleotide addition by TdT is markedly inhibited for both substrates. However, in the presence of DNA-PK in the cobalt containing reactions (compare lanes 11 and 12), the relatively efficient (as compared with magnesium containing reactions) nucleotide addition to the blunt substrate is virtually completely ablated, whereas nucleotide addition to the 3' overhang substrate still occurs to a considerable degree (compare lanes 8 and 9). Furthermore, in the presence of DNA-PK, the lengths of TdT catalyzed additions to the 3' overhang substrate are dramatically shorter and more closely resemble authentic N segments. In sum, the inefficiency with which TdT catalyzes nucleotide additions to blunt vs overhang termini in the presence of DNA-PK is observed 1) with oligonucleotide substrates of different lengths and unrelated sequence, 2) in the presence of either magnesium or cobalt, and 3) when comparing DNA termini with either 3' or 5' extensions to blunt termini. These data support previous conclusions that blunt termini are the poorest templates for TdT additions; furthermore, this bias against blunt substrates is accentuated in the presence of DNA-PK. Thus, although other explanations cannot be excluded, the blunt termini of signal end intermediates may contribute to the relative lack of N segment addition to signal joints during V(D)J recombination.



View larger version (59K):
[in this window]
[in a new window]
 
FIGURE 4. DNA-PK inhibition of template-free nucleotide additions by TdT to DNA ends with 3' extensions or blunt termini. TdT addition to an oligonucleotide with a 3' extension (lanes 1–3 and 7–9) or blunt termini (lanes 4–6 and 10–12) was assessed using magnesium as the divalent cation, (lanes 1–6) or cobalt as the divalent cation (lanes 7–12). Activity was assessed in the absence (lanes 2, 5, 8, and 11), or presence of DNA-PK (lanes 3, 6, 9, and 12). Position of the unmodified 30-bp oligonucleotide and xylene cyanol (~55 bp) are as indicated.

 
The TdT nucleotide bias is accentuated in the presence of DNA-PK

It is well appreciated that TdT demonstrates certain nucleotide preferences (51, 74); still, in vitro, dATP, dCTP, dGTP, and dTTP are all added relatively efficiently. In vivo, N segment addition has a pronounced bias for GC over AT additions (the GC:AT ratios range from 2 to 3:1, (38, 41). Thus, we next assessed the capacity of DNA-PK to inhibit the addition of TdT of only dATP, dCTP, dGTP, or dTTP (Fig. 5Go). In the presence of dATP and dTTP and magnesium, TdT catalyzes very long extensions to the oligonucleotide (Fig. 5Go, lanes 4 and 10); furthermore, virtually all of the substrate is modified. These long nucleotide extensions were observed with a variety of different oligonucleotide substrates (data not shown). In the presence of dCTP and dGTP, although all of the substrate is modified, the extensions terminate at distinct lengths (Fig. 5Go, lanes 6 and 8), possibly because of secondary structures generated by the C or G homopolymer tails. This was also observed with a variety of different oligonucleotide substrates. In the presence of DNA-PK, addition of all four nucleotides is inhibited; however, addition of dGTP is consistently less inhibited than the other nucleotides. There is more substrate modified and longer extensions in the presence of dGTP (Fig. 5Go, lane 9) than dATP, dCTP, or dTTP (Fig. 5Go, lanes 5, 7, and 11). Although this difference in inhibition of dGTP is consistent with a variety of different oligonucleotide substrates, it is not seen in TdT reactions done in the presence of cobalt (data not shown). Thus, under certain experimental conditions, in the presence of DNA-PK, TdT polymerizes dGTP more efficiently than dATP, dCTP, or dTTP. This provides a potential explanation for the relatively high G/C content in Ig and TCR N segments.

Kinase activity is not required for the interaction of DNA-PK and TdT or for the inhibition of TdT activity

We considered that the regulation of the activity of TdT by DNA-PK could be due to phosphorylation of TdT; in fact, it has been established that TdT is phosphorylated in vivo (51, 52). Thus, we also assessed TdT as a DNA-PK substrate. However, we found no evidence of TdT phosphorylation by DNA-PK in vitro (data not shown). This was true in assessing phosphorylation of calf thymus TdT (which contains the 42- and 32-kDa forms) or recombinant TdT (which contains the 58- and 42-kDa forms). To more formally address whether the DNA-PK kinase activity contributes to its regulation of TdT activity, we next analyzed the effect of wortmannin on the capacity of DNA-PK to complex with TdT and to modulate TdT catalysis. Wortmannin inhibits members of the PI3K family by covalently (and irreversibly) binding to the catalytic site of the kinase (76). Although it has been demonstrated that wortmannin inhibits the kinase activity of DNA-PK (20), the effects of wortmannin on DNA-PK assembly have not been examined. Thus, we initially assessed whether concentrations of wortmannin which have previously been shown to ablate DNA-PK activity altered DNA-PK assembly in EMSA analyses. As can be seen, wortmannin concentrations as high as 5 µM had no demonstrable effect on the ability of either Ku or complete DNA-PK to complex to the DNA probe (Fig. 6GoB). In contrast (as shown previously (32), DNA-dependent phosphorylation of recombinant murine XRCC4 (Fig. 6GoA) is partially inhibited at wortmannin concentrations as low as 0.05 µM and completely inhibited by 0.5 µM wortmannin. As with DNA-PK assembly, wortmannin concentrations of 5 µM had no affect on the ability of TdT to complex with DNA-PK (Fig. 6GoC, compare lanes 1 and 3). Finally, the ability of DNA-PK to inhibit the extent of TdT catalysis in vitro was also not altered by the addition of wortmannin (Fig. 6GoD, lanes 6 and 7). Thus, we conclude that modulation of TdT activity by the DNA-dependent protein kinase is not mediated through the kinase activity of DNA-PK.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Here we present the first evidence for a physical interaction between TdT and DNA-bound DNA-PK. Because DNA-PK and TdT are both DNA binding proteins, the possibility exists that TdT and DNA-PK do not directly interact but colocalize on DNA via their DNA binding activities. Similarly, the DNA-PK inhibition of TdT catalysis could also be the consequence of the interaction of DNA-PK with DNA, and not with TdT. The fact that TdT and DNA-PK colocalize on DNA under conditions that do not facilitate stable TdT + DNA interactions suggests that TdT and DNA-PK directly interact. Similarly, the fact that complexes containing DNA-PKCS + Ku + DNA are stabilized in the presence of TdT suggest a direct interaction between complete DNA-PK and TdT.

The fact that TdT interacts with DNA-bound DNA-PK is consistent with the possibility that DNA-PK targets TdT to V(D)J recombination intermediates and suggests an explanation for the deficits in N segment addition observed in Ku-/- and C.B-17 SCID mice. Recent work has shown that V(D)J recombination intermediates are present in a stable complex containing the RAG proteins after cleavage (72). We have previously suggested that Ku and DNA-PK might be involved in remodeling these postcleavage complexes, removing the RAG proteins, and/or recruiting end processing and joining factors such as ligases and hairpin opening enzymes (77). Furthermore, in the absence of DNA-PK, it has been proposed that inefficient resolution of coding joints is mediated by an alternative DNA end joining pathway (77). The data presented here strongly support a role for DNA-PK in targeting processing factors such as TdT to coding end intermediates. In addition, this model predicts that the alternative DNA end joining pathway which inefficiently resolves coding ends in Ku-/- and SCID mice excludes TdT.

There is evidence that SCID rearrangements are aberrantly processed in that unusually long P segments are often observed. Another potential explanation for the relative diminution of rearrangements containing N segments in SCID cells is that the unusually long P segments in some way preclude N addition. However, the fact that rearrangements from Ku86 deficient mice do not have excessive P nucleotide additions, but also lack N segments, argues against this possibility.

We also considered an alternative (and not mutually exclusive) explanation for the lack of N segments in Ku86-/- and SCID mice: that N nucleotides might be added but fail to appear in the junctions (45). Here we have shown that in vitro DNA-PK substantially limits the length of N segments added by TdT. Thus, even if TdT could access recombination intermediates in the absence of DNA-PK, our data suggest that unregulated additions of extremely long N segments would occur that might block the joining reaction.

TdT catalyzes template-independent addition of long extensions (up to several kilobases, (51) to the 3' ends of DNA in vitro; furthermore, virtually all 3' ends (i.e., single stranded or double stranded with either blunt ends or termini with 5' or 3' extensions) can be modified. The actions of TdT are dramatically different in vivo (44) in that the average N segment length is only 2–5 bp (depending on which immune receptor rearrangements are analyzed (38, 41, 44), and the sequence composition is markedly biased toward G:C pairs. The nonprocessive nature of TdT synthesis may in part explain the difference between TdT additions in vitro and in vivo. In vitro, under optimal conditions, the catalysis of TdT is unimpeded and can result in very long additions. In vivo, for each nucleotide added, it seems likely that TdT must compete for free coding ends with repair factors; our data suggest that DNA-PK may be an important factor in regulating the access of TdT to coding ends during V(D)J recombination. In sum, although other explanations cannot be excluded, the fact that DNA-PK modulates both the length and content of TdT additions provides a plausible explanation for the dramatic differences observed between the products of TdT catalysis in vivo vs in vitro.

In addition, although TdT is often expressed during signal end resolution, N segments are rarely observed in signal joints. Here we demonstrate that in the presence of DNA-PK, the polymerase activity of TdT on blunt end substrates (as opposed to substrates with 3' or 5' extensions) is virtually completely inhibited. This finding provides one explanation for the low level of N additions in signal joints. Furthermore, in rearrangements derived from cells that express TdT, N segments are not found in all joints; for example, only 70–80% of Ig VH-DH and DH-JH joints from adult mice have N segment additions (38, 41). The significant proportion of coding joints lacking N segments could result from the nicking of hairpin coding ends to generate blunt termini, which are not efficiently modified by TdT.

The notion that DNA-PK may act to recruit joining factors is consistent with our recent data (32) showing that the ability of the XRCC4 protein to interact with DNA-PK correlates with its ability to complement the double-strand break repair defects in XRCC4-deficient cells. However, although XRCC4 was efficiently phosphorylated by DNA-PK, phosphorylation did not correlate with the functional activity of XRCC4. Similarly, the data presented here demonstrate that the kinase activity of DNA-PK is not essential for its capacity to either complex with TdT or modulate TdT activity. Together, these data suggest that an important aspect of the role of DNA-PK in V(D)J recombination may be to direct end joining and processing factors, such as XRCC4 and TdT, to the DNA ends.


    Acknowledgments
 
We thank Dr. J. Donald Capra for the Ku70 and Ku86 encoding baculoviruses. We thank Dr. Frank Bollum for the TdT encoding baculovirus. We thank Dr. Charles Hasemann for critical review of these data and many stimulating discussions. We thank Dr. Mary Purugganan for careful review of the manuscript. We thank Dr. Patrick Sung for invaluable assistance in purification of DNA-PKCS.


    Footnotes
 
1 This work was supported by National Institutes of Health Grants AI31229 (to K.M.) and AI-36420 (to D.B.R.), the Harold C. Simmons Research Center, and the Arthritis Foundation (to K.M.). Back

2 Address correspondence and reprint requests to Dr. Katheryn Meek, University of Texas Southwestern Medical Center, 5323 Harry Hines Boulevard, Dallas, TX 75235-8884. E-mail address: Back

3 Abbreviations used in this paper; RAG, recombination activating gene; RSS, recombination signal sequence; DNA-PK, DNA-dependent protein kinase; DNA-PKCS, DNA-PK catalytic subunit; XRCC, x-ray cross complementation group. Back

Received for publication November 9, 1998. Accepted for publication May 10, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bogue, M., D. B. Roth. 1996. Mechanism of V(D)J recombination. Curr. Opin. Immunol. 8:175.[Medline]
  2. Lewis, S. M.. 1994. The mechanism of V(D)J joining: lessons from molecular, immunological, and comparative analyses. Adv. Immunol. 56:27.[Medline]
  3. Zhu, C., D. B. Roth. 1996. Mechanism of V(D)J recombination. Cancer Surv. 28:295.[Medline]
  4. Alt, F. W., D. Baltimore. 1982. Joining of immunoglobulin heavy chain gene segments: implications from a chromosome with evidence of three D-JH fusions. Proc. Natl. Acad. Sci. USA 79:4118.[Abstract/Free Full Text]
  5. Lafaille, J. J., A. DeCloux, M. Bonneville, Y. Takagaki, S. Tonegawa. 1989. Junctional sequences of T cell receptor gamma delta genes: implications for {gamma}{delta} T cell lineages and for a novel intermediate of V-(D)-J joining. Cell 59:859.[Medline]
  6. McCormack, W. T., L. W. Tjoelker, L. M. Carlson, B. Petryniak, C. F. Barth, E. H. Humphries, C. B. Thompson. 1989. Chicken IgL gene rearrangement involves deletion of a circular episome and addition of single nonrandom nucleotides to both coding segments. Cell 56:785.[Medline]
  7. Meek, K.. 1990. Analysis of junctional diversity during B lymphocyte development. Science 250:820.[Abstract/Free Full Text]
  8. Nadel, B., A. J. Feeney. 1995. Influence of coding-end sequence on coding-end processing in V(D)J recombination. J. Immunol. 155:4322.[Abstract]
  9. Roth, D. B., J. P. Menetski, P. B. Nakajima, M. J. Bosma, M. Gellert. 1992. V(D)J recombination: broken DNA molecules with covalently sealed (hairpin) coding ends in scid mouse thymocytes. Cell 70:983.[Medline]
  10. Eastman, Q. M., T. M. Leu, D. G. Schatz. 1996. Initiation of V(D)J recombination in vitro obeying the 12/23 rule. Nature 380:85.[Medline]
  11. McBlane, J. F., D. C. van Gent, D. A. Ramsden, C. Romeo, C. A. Cuomo, M. Gellert, M. A. Oettinger. 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83:387.[Medline]
  12. Oettinger, M. A., D. G. Schatz, C. Gorka, D. Baltimore. 1990. RAG-1 and RAG-2, adjacent genes that synergistically activate V(D)J recombination. Science 248:1517.[Abstract/Free Full Text]
  13. Roth, D. B., P. B. Nakajima, J. P. Menetski, M. J. Bosma, M. Gellert. 1992. V(D)J recombination in mouse thymocytes: double-strand breaks near T cell receptor delta rearrangement signals. Cell 69:41.[Medline]
  14. Schatz, D. G., M. A. Oettinger, D. Baltimore. 1989. The V(D)J recombination activating gene, RAG-1. Cell 59:1035.[Medline]
  15. Schlissel, M., A. Constantinescu, T. Morrow, M. Baxter, A. Peng. 1993. Double-strand signal sequence breaks in V(D)J recombination are blunt, 5'-phosphorylated, RAG-dependent, and cell cycle regulated. Genes Dev. 7:2520.[Abstract/Free Full Text]
  16. van Gent, D. C., J. F. McBlane, D. A. Ramsden, M. J. Sadofsky, J. E. Hesse, M. Gellert. 1995. Initiation of V(D)J recombination in a cell-free system. Cell 81:925.[Medline]
  17. van Gent, D. C., D. A. Ramsden, M. Gellert. 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85:107.[Medline]
  18. Pergola, F., M. Z. Zdzienicka, M. R. Lieber. 1993. V(D)J recombination in mammalian cell mutants defective in DNA double-strand break repair. Mol. Cell. Biol. 13:3464.[Abstract/Free Full Text]
  19. Ramsden, D. A., J. F. McBlane, D. C. van Gent, M. Gellert. 1996. Distinct DNA sequence and structure requirements for the two steps of V(D)J recombination signal cleavage. EMBO J. 15:3197.[Medline]
  20. Blunt, T., N. J. Finnie, G. E. Taccioli, G. C. Smith, J. Demengeot, T. M. Gottlieb, R. Mizuta, A. J. Varghese, F. W. Alt, P. A. Jeggo, et al 1995. Defective DNA-dependent protein kinase activity is linked to V(D)J recombination and DNA repair defects associated with the murine scid mutation. Cell 80:813.[Medline]
  21. Boubnov, N. V., K. T. Hall, Z. Wills, S. E. Lee, D. M. He, D. M. Benjamin, C. R. Pulaski, H. Band, W. Reeves, E. A. Hendrickson, et al 1995. Complementation of the ionizing radiation sensitivity, DNA end binding, and V(D)J recombination defects of double-strand break repair mutants by the p86 Ku autoantigen. Proc. Natl. Acad. Sci. USA 92:890.[Abstract/Free Full Text]
  22. Errami, A., V. Smider, W. K. Rathmell, D. M. He, E. A. Hendrickson, M. Z. Zdzienicka, G. Chu. 1996. Ku86 defines the genetic defect and restores x-ray resistance and V(D)J recombination to complementation group 5 hamster cell mutants. Mol. Cell. Biol. 16:1519.[Abstract]
  23. He, D. M., S. E. Lee, E. A. Hendrickson. 1996. Restoration of X-ray and etoposide resistance, Ku-end binding activity and V(D) J recombination to the Chinese hamster sxi-3 mutant by a hamster Ku86 cDNA. Mutat. Res. 363:43.[Medline]
  24. Kirchgessner, C. U., C. K. Patil, J. W. Evans, C. A. Cuomo, L. M. Fried, T. Carter, M. A. Oettinger, J. M. Brown. 1995. DNA-dependent kinase (p350) as a candidate gene for the murine SCID defect. Science 267:1178.[Abstract/Free Full Text]
  25. Li, Z., T. Otevrel, Y. Gao, H. L. Cheng, B. Seed, T. D. Stamato, G. E. Taccioli, F. W. Alt. 1995. The XRCC4 gene encodes a novel protein involved in DNA double-strand break repair and V(D)J recombination. Cell 83:1079.[Medline]
  26. Taccioli, G. E., T. M. Gottlieb, T. Blunt, A. Priestley, J. Demengeot, R. Mizuta, A. R. Lehmann, F. W. Alt, S. P. Jackson, P. A. Jeggo. 1994. Ku80: product of the XRCC5 gene and its role in DNA repair and V(D)J recombination. Science 265:1442.[Abstract/Free Full Text]
  27. Gottlieb, T. M., S. P. Jackson. 1993. The DNA-dependent protein kinase: requirement for DNA ends and association with Ku antigen. Cell 72:131.[Medline]
  28. Hartley, K. O., D. Gell, G. C. Smith, H. Zhang, N. Divecha, M. A. Connelly, A. Admon, S. P. Lees-Miller, C. W. Anderson, S. P. Jackson. 1995. DNA-dependent protein kinase catalytic subunit: a relative of phosphatidylinositol 3-kinase and the ataxia telangiectasia gene product. Cell 82:849.[Medline]
  29. Anderson, C. W.. 1993. DNA damage and the DNA-activated protein kinase. Trends. Biochem. Sci. 18:433.[Medline]
  30. Lees-Miller, S. P.. 1996. The DNA-dependent protein kinase, DNA-PK: 10 years and no ends in sight. Biochem. Cell. Biol. 74:503.[Medline]
  31. Weaver, D. T.. 1995. V(D)J recombination and double-strand break repair. Adv. Immunol. 58:29.[Medline]
  32. Leber, R., T. W. Wise, R. Mizuta, K. Meek. 1998. The XRCC4 gene product is a target for, and interacts with, the DNA dependent protein kinase. J. Biol. Chem. 273:1794.[Abstract/Free Full Text]
  33. Critchlow, S. E., R. P. Bowater, S. P. Jackson. 1997. Mammalian DNA double-strand break repair protein XRCC4 interacts with DNA ligase IV. Curr. Biol. 7:588.[Medline]
  34. Grawunder, U., M. Wilm, X. Wu, P. Kulesza, T. E. Wilson, M. Mann, M. R. Lieber. 1997. Activity of DNA ligase IV stimulated by complex formation with XRCC4 protein in mammalian cells. Nature 388:492.[Medline]
  35. Lewis, S., A. Gifford, D. Baltimore. 1985. DNA elements are asymmetrically joined during the site-specific recombination of kappa immunoglobulin genes. Science 228:677.[Abstract/Free Full Text]
  36. Nadel, B., S. Tehranchi, A. J. Feeney. 1995. Coding end processing is similar throughout ontogeny. J. Immunol. 154:6430.[Abstract]
  37. Wang, C., M. A. Bogue, D. B. Roth, K. Meek. 1997. Normal junctional diversification of immune receptors in p53-deficient mice. J. Immunol. 159:757.[Abstract]
  38. Bangs, L. A., I. E. Sanz, J. M. Teale. 1991. Comparison of D, JH, and junctional diversity in the fetal, adult, and aged B cell repertoires. J. Immunol. 146:1996.[Abstract]
  39. Bogue, M., S. Candeias, C. Benoist, D. Mathis. 1991. A special repertoire of {alpha}ß T cells in neonatal mice. EMBO J. 10:3647.[Medline]
  40. Bogue, M., S. Gilfillan, C. Benoist, D. Mathis. 1992. Regulation of N-region diversity in antigen receptors through thymocyte differentiation and thymus ontogeny. Proc. Natl. Acad. Sci. USA 89:11011.[Abstract/Free Full Text]
  41. Feeney, A. J.. 1990. Lack of N regions in fetal and neonatal mouse immunoglobulin V-D-J junctional sequences. J. Exp. Med. 172:1377.[Abstract/Free Full Text]
  42. Feeney, A. J.. 1991. Junctional sequences of fetal T cell receptor ß chains have few N regions. J. Exp. Med. 174:115.[Abstract/Free Full Text]
  43. Gu, H., I. Forster, K. Rajewsky. 1990. Sequence homologies, N sequence insertion and JH gene utilization in VHDJH joining: implications for the joining mechanism and the ontogenetic timing of Ly1 B cell and B-CLL progenitor generation. EMBO J. 9:2133.[Medline]
  44. Gilfillan, S., C. Benoist, D. Mathis. 1995. Mice lacking terminal deoxynucleotidyl transferase: adult mice with a fetal antigen receptor repertoire. Immunol. Rev. 148:201.[Medline]
  45. Bogue, M. A., C. Wang, C. Zhu, D. B. Roth. 1997. V(D)J recombination in Ku86-deficient mice: distinct effects on coding, signal, and hybrid joint formation. Immunity 7:37.[Medline]
  46. Gilfillan, S., A. Dierich, M. Lemeur, C. Benoist, D. Mathis. 1993. Mice lacking TdT: mature animals with an immature lymphocyte repertoire. Science 261:1175.[Abstract/Free Full Text]
  47. Komori, T., A. Okada, V. Stewart, F. W. Alt. 1993. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science 261:1171.[Abstract/Free Full Text]
  48. Fish, S. M., M. J. Bosma. 1994. Abnormal deletions in the T-cell receptor {delta} locus of mouse thymocytes. Mol. Cell. Biol. 14:4455.[Abstract/Free Full Text]
  49. Blunt, T., D. Gell, M. Fox, G. E. Taccioli, A. R. Lehmann, S. P. Jackson, P. A. Jeggo. 1996. Identification of a nonsense mutation in the carboxyl-terminal region of DNA-dependent protein kinase catalytic subunit in the scid mouse. Proc. Natl. Acad. Sci. USA 93:10285.[Abstract/Free Full Text]
  50. Danska, J. S., D. P. Holland, S. Mariathasan, K. M. Williams, C. J. Guidos. 1996. Biochemical and genetic defects in the DNA-dependent protein kinase in murine scid lymphocytes. Mol. Cell. Biol. 16:5507.[Abstract]
  51. Chang, L. M., F. J. Bollum. 1986. Molecular biology of terminal transferase. CRC. Crit. Rev. Biochem. 21:27.[Medline]
  52. Chang, L. M., E. Rafter, R. Rusquet-Valerius, R. C. Peterson, S. T. White, F. J. Bollum. 1988. Expression and processing of recombinant human terminal transferase in the baculovirus system. J. Biol. Chem. 263:12509.[Abstract/Free Full Text]
  53. Robbins, D. J., M. D. Barkley, M. S. Coleman. 1987. Interaction of terminal transferase with single-stranded DNA. J. Biol. Chem. 262:9494.[Abstract/Free Full Text]
  54. Robbins, D. J., M. S. Coleman. 1988. Initiator role of double stranded DNA in terminal transferase catalyzed polymerization reactions. Nucleic Acids Res. 16:2943.[Abstract/Free Full Text]
  55. Landolfi, N. F., J. D. Capra, P. W. Tucker. 1986. Interaction of cell-type-specific nuclear proteins with immunoglobulin VH promoter region sequences. Nature 323:548.[Medline]
  56. Gottesman, M. E., E. S. Canellakis. 1966. The terminal nucleotidyltransferases of calf thymus nuclei. J. Biol. Chem. 241:4339.[Abstract/Free Full Text]
  57. Soderhall, S., T. Lindahl. 1975. Mammalian DNA ligases. Serological evidence for two separate enzymes. J. Biol. Chem. 250:8438.[Abstract/Free Full Text]
  58. Ono, M., P. W. Tucker, J. D. Capra. 1994. Production and characterization of recombinant human Ku antigen. Nucleic Acids Res. 22:3918.[Abstract/Free Full Text]
  59. Hammarsten, O., G. Chu. 1998. DNA-dependent protein kinase-DNA binding and activation in the absence of Ku. Proc.. Natl. Acad. Sci. USA 95:525.[Abstract/Free Full Text]
  60. Xie, K. C., W. Plunkett. 1996. Deoxynucleotide pool depletion and sustained inhibition of ribonucleotide reductase and DNA synthesis after treatment of human lymphoblastoid cells with 2-chloro-9-(2-deoxy-2-fluoro-ß-D-arabinofuranosyl) adenine. Cancer Res. 56:3030.[Abstract/Free Full Text]
  61. Song, Q., S. P. Lees-Miller, S. Kumar, Z. Zhang, D. W. Chan, G. C. Smith, S. P. Jackson, E. S. Alnemri, G. Litwack, K. K. Khanna, M. F. Lavin. 1996. DNA-dependent protein kinase catalytic subunit: a target for an ICE-like protease in apoptosis. EMBO J. 15:3238.[Medline]
  62. Teraoka, H., Y. Yumoto, F. Watanabe, K. Tsukada, A. Suwa, M. Enari, S. Nagata. 1996. CPP32/Yama/apopain cleaves the catalytic component of DNA-dependent protein kinase in the holoenzyme. FEBS Lett. 393:1.[Medline]
  63. Han, Z., N. Malik, T. Carter, W. H. Reeves, J. H. Wyche, E. A. Hendrickson. 1996. DNA-dependent protein kinase is a target for a CPP32-like apoptotic protease. J. Biol. Chem. 271:25035.[Abstract/Free Full Text]
  64. McConnell, K. R., W. S. Dynan, J. A. Hardin. 1997. The DNA-dependent protein kinase catalytic subunit (p460) is cleaved during Fas-mediated apoptosis in Jurkat cells. J. Immunol. 158:2083.[Abstract]
  65. Candeias, S., K. Muegge, S. K. Durum. 1996. Junctional diversity in signal joints from T cell receptor beta and delta loci via terminal deoxynucleotidyl transferase and exonucleolytic activity. J. Exp. Med. 184:1919.[Abstract/Free Full Text]
  66. Lieber, M. R., J. E. Hesse, K. Mizuuchi, M. Gellert. 1988. Lymphoid V(D)J recombination: nucleotide insertion at signal joints as well as coding joints. Proc. Natl. Acad. Sci. USA 85:8588.[Abstract/Free Full Text]
  67. Shin, E. K., L. E. Perryman, K. Meek. 1997. A kinase-negative mutation of DNA-PK(CS) in equine SCID results in defective coding and signal joint formation. J. Immunol. 158:3565.[Abstract]
  68. Taccioli, G. E., G. Rathbun, E. Oltz, T. Stamato, P. A. Jeggo, F. W. Alt. 1993. Impairment of V(D)J recombination in double-strand break repair mutants. Science 260:207.[Abstract/Free Full Text]
  69. Wiler, R., R. Leber, B. B. Moore, L. F. VanDyk, L. E. Perryman, K. Meek. 1995. Equine severe combined immunodeficiency: a defect in V(D)J recombination and DNA-dependent protein kinase activity. Proc. Natl. Acad. Sci. USA 92:11485.[Abstract/Free Full Text]
  70. Fukumura, R., R. Araki, A. Fujimori, M. Mori, T. Saito, F. Watanabe, M. Sarashi, H. Itsukaichi, K. Eguchi-Kasai, K. Sato, K. Tatsumi, M. Abe. 1998. Murine cell line SX9 bearing a mutation in the dna-pkcs gene exhibits aberrant V(D)J recombination not only in the coding joint but also in the signal joint. J. Biol. Chem. 273:13058.[Abstract/Free Full Text]
  71. Errami, A., D. M. He, A. A. Friedl, W. J. Overkamp, B. Morolli, E. A. Hendrickson, F. Eckardt-Schupp, M. Oshimura, P. H. Lohman, S. P. Jackson, M. Z. Zdzienicka. 1998. XR-C1, a new CHO cell mutant which is defective in DNA-PKcs, is impaired in both V(D)J coding and signal joint formation. Nucleic Acids Res. 26:3146.[Abstract/Free Full Text]
  72. Agrawal, A., D. G. Schatz. 1997. RAG1 and RAG2 form a stable postcleavage synaptic complex with DNA containing signal ends in V(D)J recombination. Cell 89:43.[Medline]
  73. Deng, G., R. Wu. 1983. Terminal transferase: use of the tailing of DNA and for in vitro mutagenesis. Methods Enzymol. 100:96.[Medline]
  74. Roychoudhury, R.. 1981. The use of terminal transferase for molecular cloning and nucleic acids analysis. Gene Amplif. Anal. 2:41.[Medline]
  75. Roychoudhury, R., C. P. Tu, R. Wu. 1979. Influence of nucleotide sequence adjacent to duplex DNA termini on 3' terminal labeling by terminal transferase. Nucleic Acids Res. 6:1323.[Abstract/Free Full Text]
  76. Stoyanova, S., G. Bulgarelli-Leva, C. Kirsch, T. Hanck, R. Klinger, R. Wetzker, M. P. Wymann. 1997. Lipid kinase and protein kinase activities of G-protein-coupled phosphoinositide 3-kinase {gamma}: structure-activity analysis and interactions with wortmannin. Biochem. J. 324:489.
  77. Zhu, C., M. A. Bogue, D. S. Lim, P. Hasty, D. B. Roth. 1996. Ku86-deficient mice exhibit severe combined immunodeficiency and defective processing of V(D)J recombination intermediates. Cell 86:379.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
J. M. Murray, J. P. O'Neill, T. Messier, J. Rivers, V. E. Walker, B. McGonagle, L. Trombley, L. G. Cowell, G. Kelsoe, F. McBlane, et al.
V(D)J Recombinase-Mediated Processing of Coding Junctions at Cryptic Recombination Signal Sequences in Peripheral T Cells during Human Development
J. Immunol., October 15, 2006; 177(8): 5393 - 5404.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
S. Fujisaki, A. Sato, T. Toyomoto, T. Hayano, M. Sugai, T. Kubota, and O. Koiwai
Direct binding of TReP-132 with TdT results in reduction of TdT activity
Genes Cells, January 1, 2006; 11(1): 47 - 57.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. E. Repasky, E. Corbett, C. Boboila, and D. G. Schatz
Mutational Analysis of Terminal Deoxynucleotidyltransferase- Mediated N-Nucleotide Addition in V(D)J Recombination
J. Immunol., May 1, 2004; 172(9): 5478 - 5488.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
Z. Sandor, M. L. Calicchio, R. G. Sargent, D. B. Roth, and J. H. Wilson
Distinct requirements for Ku in N nucleotide addition at V(D)J- and non-V(D)J-generated double-strand breaks
Nucleic Acids Res., March 26, 2004; 32(6): 1866 - 1873.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J. Smith, E. Riballo, B. Kysela, C. Baldeyron, K. Manolis, C. Masson, M. R. Lieber, D. Papadopoulo, and P. Jeggo
Impact of DNA ligase IV on the fidelity of end joining in human cells
Nucleic Acids Res., April 15, 2003; 31(8): 2157 - 2167.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. N. Mahajan, S. A. Nick McElhinny, B. S. Mitchell, and D. A. Ramsden
Association of DNA Polymerase {micro} (pol {micro}) with Ku and Ligase IV: Role for pol {micro} in End-Joining Double-Strand Break Repair
Mol. Cell. Biol., July 15, 2002; 22(14): 5194 - 5202.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
J.-B. Duvauchelle, L. Blanco, R. P. P. Fuchs, and A. M. Cordonnier
Human DNA polymerase mu (Pol {micro}) exhibits an unusual replication slippage ability at AAF lesion
Nucleic Acids Res., May 1, 2002; 30(9): 2061 - 2067.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. M. Purugganan, S. Shah, J. F. Kearney, and D. B. Roth
Ku80 is required for addition of N nucleotides to V(D)J recombination junctions by terminal deoxynucleotidyl transferase
Nucleic Acids Res., April 1, 2001; 29(7): 1638 - 1646.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
C. L. Benedict, S. Gilfillan, and J. F. Kearney
The Long Isoform of Terminal Deoxynucleotidyl Transferase Enters the Nucleus and, Rather than Catalyzing Nontemplated Nucleotide Addition, Modulates the Catalytic Activity of the Short Isoform
J. Exp. Med., January 2, 2001; 193(1): 89 - 100.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Bemark, J. E. Sale, H.-J. Kim, C. Berek, R. A. Cosgrove, and M. S. Neuberger
Somatic Hypermutation in the Absence of DNA-dependent Protein Kinase Catalytic Subunit (DNA-PKcs) or Recombination-activating Gene (RAG)1 Activity
J. Exp. Med., November 20, 2000; 192(10): 1509 - 1514.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Tuaillon and J. D. Capra
Evidence That Terminal Deoxynucleotidyltransferase Expression Plays a Role in Ig Heavy Chain Gene Segment Utilization
J. Immunol., June 15, 2000; 164(12): 6387 - 6397.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Mickelsen, S.
Right arrow Articles by Meek, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Mickelsen, S.
Right arrow Articles by Meek, K.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS