The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH
The Journal of Immunology, 1999, 163: 728-735.
Copyright © 1999 by The American Association of Immunologists

TCR and IL-12 Receptor Signals Cooperate to Activate an Individual Response Element in the IFN-{gamma} Promoter in Effector Th Cells1

Feng Zhang*, Tetsuo Nakamura{dagger} and Thomas M. Aune2,*

* Division of Rheumatology, Department of Medicine, Vanderbilt University School of Medicine, Nashville, TN 37232; and {dagger} Division of Medicine, Institute of Gastroenterology, Tokyo Women’s Medical College, Tokyo, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IFN-{gamma} is a key regulatory cytokine of the immune system. Reporter transgenic mice expressing the luciferase gene under the control of separate TCR-response elements (TCR-RE) from the IFN-{gamma} promoter or expressing the green fluorescent protein gene under the control of an IFN-{gamma} "minigene" were employed to explore the basis for IL-12 regulation of IFN-{gamma} gene transcription. In the absence of TCR stimulation, IL-12 did not activate the TCR-REs but did induce green fluorescent protein expression. TCR plus IL-12R stimulation of effector Th cells resulted in: 1) enhanced activation of the proximal, but not the distal, TCR-RE, and 2) increased induction of cJun-proximal TCR-RE complexes and c-Jun protein expression. Overexpression of cJun, but not cFos, increased activity of the proximal TCR-RE in T cells. These results suggest that IL-12R signaling affects IFN-{gamma} gene transcription by at least two separate mechanisms; IL-12R signaling without TCR signaling targets promoter regions outside of the ~100-bp IFN-{gamma} TCR-RE, and IL-12R signaling also stimulates TCR-induced activity of the proximal TCR-RE.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Interferon-{gamma} is produced by effector (e)3 Th1 cells, by NK cells, or by NK1.1+ T cells in response to TCR signaling or in response to stimulation by cytokines, such as IL-12 or IL-18 (1, 2, 3, 4, 5, 6, 7, 8, 9, 10). In addition, synergistic interactions between cytokine signaling (either IL-12R or IL-18R) and TCR signaling stimulate even greater levels of IFN-{gamma} gene expression by T cells (8, 9, 10, 11, 12, 13, 14). These distinct signaling pathways, which originate at the cell surface and activate separate signal transduction pathways, converge to regulate transcription at the nuclear level in a highly specific and coordinated fashion to achieve the cell specificity of IFN-{gamma} gene expression observed within the immune system.

A number of transcription factor binding sites and transcriptional enhancers have been identified within the 5' untranslated region of the IFN-{gamma} gene. Within the immediate 5' region (-108 bp to -40 bp) are two transcriptional elements that are responsive to TCR signaling in T cell lines and in primary eTh cells (15, 16, 17, 18). These elements contain imperfect cAMP-response element (CRE) and 12-O-tetradecanoylphorbol-13-acetate (TPA)-RE (TRE) consensus sequences and bind CRE binding protein (CREB)/activation transcription factor (ATF)-1/ATF-2/AP-1 transcription factors (16, 18, 19). A second set of transcription factor binding sites resides at -280 bp to -180 bp, upstream of the TCR-RE region (20, 21, 22, 23, 24). This second region contains AP-1, Stat, AP-2/YY-1, and NF-AT binding sites. While the first promoter region (-108 to -40 bp) is responsive to TCR signaling (17, 19), IL-12- and IL-18-mediated promoter activation has been assigned to this second region (-280 to -180 bp) of the IFN-{gamma} promoter (9).

To investigate transcriptional mechanisms of control of the immediate 5' flanking region of the IFN-{gamma} promoter, we have prepared reporter transgenic mice that express the luciferase gene under the control of the proximal (-70 to -44 bp) or distal (-98 to -78) TCR-RE (17, 19) or the green fluorescent protein (GFP) gene under the control of an IFN-{gamma} "minigene." Activity of the IFN-{gamma} TCR-RE is expressed in memory T cells and eTh cells, but is blocked in precursor (p) Th cells. This is due, in part, to dominant binding of nonstimulatory CREB/ATF-1 proteins in pTh cells. CREB/ATF-1 proteins are not induced in eTh cells by TCR stimulation, while stimulatory Jun and ATF-2 proteins are induced. Binding of Jun and ATF-2 to the distal IFN-{gamma}-TCR-RE dominates in eTh cells, and these cells express promoter activity. In addition, IL-12-priming of pTh cells results in enhanced activity of the distal TCR-RE in eTh1 cells following Ag activation and increased formation of Jun/ATF-2-distal TCR-RE protein-DNA complexes. eTh1 cells also contain greater levels of ATF-2 than pTh cells or eTh2 cells, which may account for increased formation of Jun/ATF-2-distal TCR-RE complexes.

Aside from inducing eTh1 differentiation, IL-12 also directly stimulates IFN-{gamma} gene expression and augments IFN-{gamma} production by T cells during Ag stimulation (10, 11, 12, 13, 14). This raises the question of whether direct induction of IFN-{gamma} gene expression by IL-12 or IL-12 stimulation of IFN-{gamma} gene expression induced by TCR activation will target TCR-RE within the IFN-{gamma} promoter or will target cytokine responsive elements or both. To investigate this question, we tested whether IL-12 could directly stimulate the IFN-{gamma} proximal and distal TCR-REs in eTh cells or could enhance TCR-stimulated promoter activity. The results show that: 1) IL-12 does not directly stimulate the activity of either the proximal or distal TCR-RE, but does stimulate expression of the GFP transgene, 2) IL-12 also selectively stimulates the activity of the proximal TCR-RE during TCR activation, 3) TCR plus IL-12R stimulation results in enhanced formation of an inducible nuclear proximal TCR-RE-protein complex that contains cJun and JunB transcription factors, 4) IL-12R signaling directly induces cJun protein expression in eTh cells, and 5) overexpression of cJun, but not cFos, increases activity of the proximal TCR-RE in T cells.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Transgenic mice

Reporter transgenic mice expressing the luciferase gene under the control of the proximal or distal TCR-RE have been described in detail elsewhere (17). Briefly, plasmids containing a head-to-tail (5' to 3') dimer of the IFN-{gamma} proximal element (-70 to -44 bp from the transcription start site) or tetramer of the IFN-{gamma} distal element (-98 to -78 bp) with the IFN-{gamma} minimal promoter were subcloned into the luc reporter plasmid (25). The 2.8-kb Hpa-1 fragment isolated from these plasmids was injected into fertilized C57BL/6 x CBA/N F2 eggs, and transgenic mice were generated as previously described (26). The IFN-{gamma}-GFP transgenic line will be described in detail elsewhere. Briefly, the GFP gene with polyadenylation sequences was excised from the pGreen Lantern-1 plasmid (Life Technologies, Rockville, MD) and ligated upstream of the neomycin resistance gene. This construct was excised and ligated into the PvuII site located in the 5' untranslated region, slightly upstream of the translation initiation codon of the murine IFN-{gamma} gene (Fig. 1Go). The construct used to prepare transgenic mice contains 1.4 kb of open reading frame 5' of the start site and the correct exon-intron structure. The 3' end stops at the end of the fourth exon. Transgenic mice were identified by slot blot of tail DNA. Murine lines initially derived from one founder for each transgene were employed for these studies. Two original proximal TCR-RE-luciferase founder lines and four original distal TCR-RE-luciferase founder lines were initially characterized. All had equivalent qualitative properties (17).



View larger version (17K):
[in this window]
[in a new window]
  		FIGURE 1. Stimulation of eTh cell IFN-{gamma} secretion by IL-12 does not activate proximal or distal TCR-RE from the IFN-{gamma} promoter. A, Transgenic mice were prepared by injecting fertilized eggs with the indicated construct, which has both the GFP and NEO genes with polyadenylation sequences inserted into the first exon of the murine IFN-{gamma} gene. A complete description of the properties of this transgenic line will be reported elsewhere. Briefly, GFP fluorescence is undetectable in freshly isolated splenocytes or lymph node cells. Primary stimulation of naive T cells from IFN-{gamma}-GFP transgenic mice results in normal T cell proliferation and IL-2 secretion, but no GFP expression. Primary stimulation of memory T cells or secondary stimulation of eTh cells derived from in vitro cultures results in GFP expression. GFP expression is also detectable by fluorescence microscopy with an FITC filter. GFP expression has not been observed in resting B cells or in B cells stimulated with LPS or LPS + IL-4. B, eTh cells derived from in vitro cultures of the appropriate transgenic lines were cultured for 48 h without restimulation or were restimulated with IL-2 + IL-12 or with anti-CD3. T cells were harvested and analyzed for GFP expression by flow cytometry or were lysed and analyzed for luciferase expression. Culture fluids were analyzed for levels of IFN-{gamma} by ELISA. Results are expressed as fluorescence intensity, relative luciferase units, or ng/ml IFN-{gamma} ±SE. Similar results were obtained in three independent experiments.

 
The cytochrome C (Cyt C) TCR transgenic mice (27) were obtained from The Jackson Laboratory (Bar Harbor, ME), and the Stat4-deficient mice (28) were obtained from Dr. James Ihle (St. Jude Children’s Research Hospital, Memphis, TN). Luciferase reporter transgenic mice have been backcrossed to B10.BR for four generations before intercrossing with the Cyt C TCR mice, which are also B10.BR. Double transgenic littermates were identified by Southern blot analysis of tail DNA for the luciferase gene and by flow cytometry of peripheral blood using FITC-coupled anti-CD4 and PE-coupled anti-Vß3. CD4 T cells from double transgenic mice were employed to analyze changes in transcriptional activity following antigenic stimulation.

Cell preparation and culture

Spleen cells, lymph node cells, or pooled spleen and lymph node cells were harvested from wild-type or transgenic animals. RBC were removed by hypotonic lysis. CD4+ T cells were purified by negative selection. Ia-expressing cells and NK cells were removed by incubation with an anti-IE,IA mAb (m5/115; American Type Culture Collection (ATCC), Manassas, VA) and an {alpha}-NK cell mAb (NK 1.1; ATCC), respectively. An anti-CD8 mAb (TIB 105; ATCC) was used to deplete CD8 T cells. Cells were incubated for 30 min at 4°C, washed, and further incubated with goat anti-mouse and anti-rat IgG bound to magnetic beads (Collaborative Research, Waltham, MA) for 30 min at 4°C with rocking. Cells bound to beads were removed with a magnet. Average purity of CD4 cells was ~90–95%, as determined by flow cytometry. RBC-depleted splenocytes from B10.BR mice were depleted of CD4+ and CD8+ T cells by negative selection with anti-CD4 and anti-CD8 mAb and were irradiated at 2000 rads from a cesium 137 source and used as APCs.

Reagents used to stimulate CD4 T cells were: Cyt C peptide, 0.05–5 µg/ml; anti-CD3 (145-2C11 clone; ATCC), 1 µg/ml; IL-2, 5 ng/ml; and IL-12, 10 ng/ml. Recombinant IL-2 was purchased from PharMingen (San Diego, CA); recombinant IL-12 was a gift from Genetics Institute (Cambridge, MA). Immobilized anti-CD3 was prepared by adding 0.5–1 ml of 10 µg/ml of 2C11 mAb in 0.1 M sodium bicarbonate (pH 9.6) to a 24- or 48-well tissue culture plate for 3–6 h at 37°C or overnight at 0–4°C. Culture plates were washed thoroughly before use.

The IFN-{gamma} ELISA was performed with Abs from PharMingen according to the manufacturer’s procedures. The sensitivity of the IFN-{gamma} ELISA was 0.02 ng/ml. The specific activity of IFN-{gamma} was 107 U/mg protein (PharMingen).

Cells from various sources were cultured in complete RPMI 1640 media with 10% FCS, 100 U/ml of penicillin, 100 U/ml of streptomycin, 2 mM L-glutamine, and 5 x 10-5 M 2-ME in 24- or 48-well tissue culture plates in volumes of 1 or 0.5 ml, respectively, at a density of 1 x 106/ml in the presence or absence of various stimuli, as described in the text, at 37°C in 5% CO2 in air. Syngeneic irradiated APC were used at a density of 1 x 106/ml of culture fluid. pTh cells were obtained 48–72 h after initial activation of purified CD4 T cells with peptide or anti-CD3 and APC. eTh cells were obtained by stimulating purified CD4 T cells with peptide or anti-CD3 and APC for 5 days and restimulating these cultures with either Ag and APC or with immobilized anti-CD3, respectively. eTh1 and eTh2 cells were prepared as described for eTh cells, except that cultures received either 5 ng/ml of IL-12 or 30 ng/ml of IL-4, respectively, during the primary cultures.

Analysis of luciferase activity

After the periods of time indicated in the text, cultures were harvested, washed twice in PBS, and suspended in 50 µl of lysis buffer (luciferase assay; Promega, Madison, WI) for 30 min at 20°C. The supernatant fluid was harvested, and 20-µl aliquots were assayed for luciferase activity with 100 µl of luciferase reagent (Promega) in a luminometer (Turner (Palo Alto, CA) TD20/20) for 15 s. Cultures were performed in duplicate. Duplicate analyses of two aliquots from each cell lysate were performed, and the results were averaged. Results are expressed as the average of these readings per 106 cells with the SE. The background measurement with luciferase reagent alone was subtracted from each reading. Results are expressed in relative light units. The absolute values obtained from individual readings ranged from ~0.02 (unstimulated cell lysates = instrument background) to 20 light units (lysates from maximally stimulated cells). The Turner TD 20/20 luminometer differs from many luminometers used in biomedical research because its scale is significantly different. For comparison, 1 fg of luciferase yields a reading of ~1 and 10 fg yields a reading of ~10 in the Turner TD 20/20 luminometer.

EMSA

Small-scale nuclear extracts were prepared from 5 x 106 cells (29, 30), as previously described. Binding reactions were conducted essentially as previously described using 5–15 µg of nuclear proteins and 1.5 x 104 cpm of 32P end-labeled double-stranded oligonucleotides. Sequences of the oligonucleotides (sense strand) used for EMSA are as follows: proximal TCR-RE (-71 to -43 bp), 5'-AAAACTTGTGAAAATACGTAATCCTCAGG; distal TCR-RE (-98 to -78 bp), TGCCTATCTGTCACCATCTCA; TRE, CGCTTGATGACTCAGCCGGAA; CRE, GGCAACTGTGACGTCATCACAAGA; GAS ({gamma} activation sequence), GCCGTCATTTCGGGGAAATCA; and NF-AT binding element from the human IL-2 promoter, AAGAAAGGAGGAAAAACTGTTTCATAC. Underlined regions indicate the consensus binding sites for each response element. Abs used for these studies include: anti-ATF-1 (sc-4006; Santa Cruz Biotechnology, Santa Cruz, CA), which recognizes CREB and ATF-1; anti-avian c-Jun (Upstate Biotechnology, Lake Placid, NY), which recognizes cJun of mouse, chicken, and human origin; anti-JunB; and anti-cFos (Santa Cruz Biotechnology). Abs (0.1–1 µg of purified Ab or 1–2 µl of serum) were preincubated with nuclear extracts for 1 h at room temperature before addition of probes. Complexes were resolved on 5% native polyacrylamide gels in TBE buffer. The anti-ATF-1 and ATF-2 Abs each induced formation of supershifted complexes with oligonucleotides containing a CRE site, and the cJun, JunB, and cFos Abs each induced formation of supershifted complexes formed with oligonucleotides containing a TRE site (data not shown).

Western blot analysis

Nuclear proteins were fractionated by SDS-PAGE, transferred to nitrocellulose membranes, and incubated with specific primary Abs, as outlined in the text. Membranes were washed and incubated with secondary HRP-conjugated anti-rabbit or anti-mouse Abs and developed with an enhanced chemiluminescent system (Amersham, Arlington Heights, IL), according to the vendor’s instructions. Before SDS-PAGE and protein immunoblotting, nuclear proteins were also treated with {lambda}-protein phosphatase (New England Biolabs, Beverly, MA), according to the manufacturer’s instructions.

Transient transfections

Plasmid DNA was preincubated with Transfast reagent (Promega) in RPMI 1640 media without serum for 15 min before addition to EL4 cells (1 x 107, in 500 µl of RPMI 1640 without serum, harvested from cultures of cells in log-phase). Incubation was continued for 1 h at 37°C. Cells were diluted into complete medium (5 ml) and cultured overnight before stimulation with PMA (200 nM) and ionomycin (500 ng/ml) and subsequent assay. JunB and cJun expression plasmids and "empty" vectors were obtained from Dr. Ron Wisdom (Vanderbilt University, Nashville, TN).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
IFN-{gamma} promoter TCR-REs are unresponsive to IL-12 stimulation

TCR stimulation or IL-12R stimulation induces IFN-{gamma} gene expression in eTh cells. It is uncertain whether these different stimuli activate common or distinct regions of the IFN-{gamma} promoter to induce gene transcription. To address this question, eTh cells from different lines of reporter transgenic mice were stimulated with either IL-12 or anti-CD3 and examined for levels of IFN-{gamma} secretion or expression of a heterologous reporter gene under the control of the IFN-{gamma} proximal TCR-RE, the IFN-{gamma} distal TCR-RE, or the IFN-{gamma} "minigene" (Fig. 1Go). IL-12 stimulated secretion of IFN-{gamma} and expression of GFP by eTh cells, but did not stimulate expression of the luciferase gene under the control of either the proximal or distal TCR-RE. By contrast, stimulation with anti-CD3 resulted in IFN-{gamma} secretion, expression of GFP, and expression of the luciferase reporter gene under the control of either the proximal or distal TCR-RE. These data argue that IL-12 stimulation of IFN-{gamma} gene expression in eTh cells is under transcriptional control, but that IL-12R signaling activates regions within the IFN-{gamma} promoter that are distinct from the IFN-{gamma} TCR-RE.

IL-12 stimulates the activity of an IFN-{gamma} promoter TCR-RE during Ag or mitogen activation of eTh cells

In differentiated eTh cells, including T cell clones, IL-12 stimulates IFN-{gamma} gene expression during Ag or mitogen activation (10, 11, 12). It is not clear from these studies whether the combination of TCR and IL-12R signaling targets TCR-RE elements within the IFN-{gamma} gene, or whether separate regulatory elements are individually targeted by TCR signaling and by IL-12R signaling to enhance IFN-{gamma} gene expression. To investigate this question, T cells were harvested from transgenic reporter mice, which express the luciferase gene under the control of separate IFN-{gamma} promoter TCR-RE, and stimulated to differentiate into eTh cells. Differentiated eTh cells were restimulated with anti-CD3 or with anti-CD3 and IL-12 and assayed for expression of promoter activity and for IFN-{gamma} secretion. Stimulation of eTh cells with anti-CD3 activated both the proximal and distal TCR-RE and induced IFN-{gamma} secretion (Fig. 2GoA). Stimulation of eTh cells with IL-12 during anti-CD3 activation increased both levels of IFN-{gamma} secretion, as well as activity of the proximal TCR-RE, but did not alter the activity of the IFN-{gamma} distal TCR-RE. Similar results were obtained if T cells, derived from single TCR-transgenic mice, were stimulated with peptide Ag and APC (Fig. 2GoB). Addition of the cytokines, IL18, IL2, IL4, or IFN{gamma}, did not alter the activity of the proximal TCR-RE in eTh cells stimulated with anti-CD3. This experiment illustrates that TCR signaling and IL-12R signaling can cooperate to stimulate the selective activity of a single IFN-{gamma} TCR-RE in eTh cells.



View larger version (13K):
[in this window]
[in a new window]
  		FIGURE 2. IL-12 stimulates the activity of the proximal, but not the distal, IFN-{gamma} TCR-RE during TCR stimulation of eTh cells. eTh cells derived from the indicated transgenic lines were restimulated with anti-CD3 (A) or Cyt C (B) peptide with (•) or without ({circ}) IL-12 for the indicated periods of time. Cells and culture fluids were analyzed for levels of luciferase expression or IFN-{gamma}. Results are expressed as relative luciferase units ±SE or as ng/ml of IFN-{gamma} ±SE. Similar results were obtained in three individual experiments.

 
Induction of proximal TCR-RE-protein complexes following stimulation of eTh cells

EMSA were performed to determine whether formation of nuclear protein complexes with the proximal TCR-RE was altered by the different stimulation conditions that regulated transcriptional activity under the control of the proximal IFN-{gamma} TCR-RE (Fig. 3Go, left panel). Nuclear extracts were prepared from eTh cells that were stimulated for 6, 24, or 48 h with: 1) no stimuli, 2) IL-12 (10 ng/ml), 3) anti-CD3, or 4) anti-CD3 + IL-12 (10 ng/ml). Following incubation of nuclear extracts with labeled proximal TCR-RE probe, mixtures were resolved on nondenaturing polyacrylamide gels to separate free probe from labeled DNA-protein complexes. One inducible complex (indicated by the arrow) was increased in intensity when extracts from anti-CD3 + IL-12-stimulated eTh cells were compared with extracts from unstimulated eTh cells, IL-12-stimulated eTh cells, or anti-CD3-stimulated eTh cells. This complex was largely absent in unstimulated eTh cell extracts. Maximum intensity of this complex was observed at 48 h, which corresponds to the time of maximum transcriptional activity. Formation of the noninducible upper complexes, which are ATF-1-CREB complexes (19), decreased in intensity following anti-CD3 or anti-CD3 + IL-12 stimulation. The effects of IL-12 on eTh1 differentiation and IFN-{gamma} gene transcription are blocked in Stat4-deficient mice (28, 31). Formation of the anti-CD3 + IL-12 inducible complex was also impaired in T cells from Stat4-deficient mice (Fig. 3Go, right panel).



View larger version (35K):
[in this window]
[in a new window]
  		FIGURE 3. IL-12 stimulates increased formation of TCR-induced protein-proximal TCR-RE complexes in eTh cells, as detected by EMSA. A, Nuclear extracts were prepared from eTh cells at the indicated times after stimulation with nothing, IL-12, anti-CD3, or anti-CD3 + IL-12. Equivalent amounts of protein were incubated with end-labeled proximal TCR-RE probe. Protein-DNA complexes were resolved by native PAGE. B, Nuclear extracts were prepared from eTh cells purified from Stat4-/- or from Stat4+/+ mice, which had been stimulated for 48 h as in A. EMSA was performed as in A. Similar results were obtained in three (A) or two (B) independent experiments.

 
The proximal TCR-RE binds a complex mixture of transcription factors in gel mobility shift assays. These include ATF-1/CREB family members, Jun family members, and ATF-2. First, the -T-A-C-G-T-A-A- sequence is proposed to represent an imperfect TRE-CRE binding element with homology to both a consensus TRE (-T-C-A-G-T-C-A-) and a consensus CRE (-T-C-A-C-G-T-C-A-) (16). DNA footprinting analysis shows that recombinant c-Jun and Fra-1 proteins bind to the -T-G-A-A-A-A-T-A-C-G-T- sequence of the proximal TCR-RE (18). Oligonucleotides containing CRE or TRE consensus sequences were tested for their ability to block formation of specific protein-proximal TCR-RE complexes. A specific CRE oligonucleotide blocked formation of the upper noninducible complexes, while a specific TRE oligonucleotide blocked formation of the anti-CD3 + IL-12-inducible complex (Fig. 4Go). Oligonucleotides containing Stat recognition sequences (GAS) or NF-AT recognition sequences did not block formation of specific protein-proximal TCR-RE complexes. The IFN-{gamma} distal TCR-RE also blocked formation of this inducible complex (data not shown). This suggests that the anti-CD3 + IL-12-inducible complex may contain Jun family proteins, either as Jun-Jun dimers or in combination with other proteins, such as Fos family members or ATF-2, as heterodimers. To investigate this possibility further, Abs specific for cJun, JunB, cFos, ATF-2, or CREB/ATF-1 were tested for their ability to yield supershifted anti-CD3 + IL-12-induced protein-proximal TCR-RE complexes. Both the anti-cJun and the anti-JunB Abs produced supershifted complexes (Fig. 5Go). By contrast, addition of anti-cFos or anti-ATF-2 did not produce supershifted complexes. These data argue that the protein-proximal TCR-RE-inducible complexes contain Jun family proteins, probably as Jun-Jun dimers. In our view, it is unlikely that these complexes contain Fos family members. Complexes formed with a labeled oligonucleotide containing a consensus TRE, which bind Jun family members and Fos family members as heterodimers, have significantly slower electrophoretic mobilities than these nuclear protein-proximal TCR-RE complexes.



View larger version (67K):
[in this window]
[in a new window]
  		FIGURE 4. Characterization of the ability of oligonucleotides containing CRE or TRE consensus sequences to inhibit formation of induced protein-proximal TCR-RE complexes. Nuclear extracts were prepared from eTh cells 48 h after activation with anti-CD3 and IL-12. Nuclear extracts were incubated with the indicated competitors and end-labeled proximal TCR-RE probe and complexes were separated by native PAGE. Similar results were obtained in three independent experiments.

 


View larger version (81K):
[in this window]
[in a new window]
  		FIGURE 5. Inducible proximal TCR-RE-protein DNA complexes are supershifted with anti-cJun or -JunB Ab. Nuclear extracts were prepared from eTh cells 48 h after activation with anti-CD3 and IL-12 and were incubated with end-labeled proximal TCR-RE as probe and the indicated purified Abs. Protein-DNA complexes were resolved by native PAGE. Similar results were obtained in experiments with nuclear extracts derived from three independent cultures.

 
These data indicate that the combination of TCR and IL-12R stimulation of eTh cells yields increased cJun- and JunB-proximal TCR-RE complexes when compared with unstimulated eTh cells or eTh cells stimulated via the TCR alone. This may result from increased cJun and/or JunB protein expression or from other mechanisms. Western blotting was performed to directly test if TCR, IL-12R, or TCR + IL-12R stimulation of eTh cells altered levels of cJun (Fig. 6GoA). Nuclear extracts employed in the experiment shown in Fig. 3Go were used for protein immunoblotting. Levels of cJun were very low in unstimulated eTh cells and rapidly increased following stimulation with IL-12, anti-CD3, or the combination of anti-CD3 and IL-12. By contrast, IL-12 stimulation did not increase levels of several other transcription factors induced in eTh cells by anti-CD3 stimulation, such as NF-ATc, ATF-2, or cFos (data not shown).



View larger version (25K):
[in this window]
[in a new window]
  		FIGURE 6. Induction of cJun protein expression by anti-CD3 and/or IL-12 stimulation of eTh cells. Upper panel, The identical nuclear extracts employed in Fig. 3Go were analyzed for induction of c-Jun protein expression in restimulated eTh cells by Western blotting. Similar results were obtained in three independent experiments. Lower panel, A, Nuclear extracts were prepared from eTh cells 48 h after activation with nothing, IL-12, IL-18, anti-CD3, anti-CD3 + IL-12, or anti-CD3 and IL-18. Equivalent amounts of protein were separated by SDS-PAGE; note that the run times were longer than in Fig. 6Go, upper panel, to add further resolution, and cJun was detected by protein immunoblotting. B, Extracts from anti-CD3 + IL-12-activated cells were treated with the indicated amounts of {lambda}-protein phosphatase for 30 min before analysis by SDS-PAGE and protein immunoblotting.

 
Transcriptional activation by cJun is highly dependent upon Thr and Ser phosphorylation. Phosphorylation of proteins can result in decreased electrophoretic mobility, which can be revealed during SDS-PAGE. By employing longer running times, we were able to identify two cJun species by protein immunoblotting, which differed in their electrophoretic mobilities during SDS-PAGE (Fig. 6GoB). The species with reduced electrophoretic mobility was the dominant species in samples from anti-CD3-stimulated T cells. Samples from anti-CD3-stimulated T cells were treated with {lambda}-protein phosphatase to deplete protein phosphorylation, especially at Ser and Thr residues. This resulted in an increase in electrophoretic mobility of cJun and suggests that the reduced electrophoretic mobility of the samples from anti-CD3-stimulated T cells was due to increased phosphorylation at Ser and Thr residues. Stimulation of T cells with anti-CD3, but not IL-12, also resulted in increased ATF-2 phosphorylation, as determined by SDS-PAGE and protein immunoblotting with a phospho-ATF-2 specific Ab (data not shown). T cells stimulated with IL-18 contained levels of cJun similar to unstimulated controls (Fig. 6GoB).

The above data suggest that increased formation of cJun-proximal TCR-RE protein complexes following stimulation with anti-CD3 + IL-12 may explain the increased activity of the proximal TCR-RE in these same cells. However, cJun also binds to the distal TCR-RE (16, 17), and, in cell lines, cJun is required for the expression of transcription under the control of both the proximal and the distal TCR-RE (16, 18). If IL-12 stimulates TCR-induced activity of the proximal TCR-RE, why doesn’t it also stimulate TCR-induced activity of the distal TCR-RE? One possibility is that the distal TCR-RE may have a greater affinity for cJun than the proximal TCR-RE, and levels of cJun induced by TCR stimulation alone may be sufficient to activate the distal TCR-RE. Although this possibility has not been investigated in detail, binding data would support this notion (Fig. 3Go, and Refs. 16, 17, 18). Therefore, cJun levels in eTh cells may not be rate-limiting for expression of distal TCR-RE activity, but may be rate-limiting for expression of proximal TCR-RE activity. We performed transient transfection assays in EL4 cells to test the ability of cJun to stimulate proximal and distal TCR-RE activity as well as the activity of the intact IFN-{gamma} TCR-RE (-108 bp to +64 bp) and a larger IFN-{gamma} promoter region (-562 bp to + 64 bp) (Fig. 7Go). Two points are illustrated by this experiment. First, in the absence of the cJun expression vector, activity of the distal TCR-RE was much higher than activity of the proximal TCR-RE, the IFN-{gamma} TCR-RE (-108 bp to + 64 bp), and the larger (-562 bp to + 64 bp) IFN-{gamma} promoter fragment. Second, over-expression of cJun or JunB (data not shown) resulted in a marked increase in the activity of the proximal TCR-RE, the complete IFN-{gamma} TCR-RE, and the larger (-562 bp to + 64 bp) IFN-{gamma} promoter fragment, but not the distal TCR-RE. Transient transfection of the cJun expression vector into EL4 cells resulted in increased levels of cJun protein expression, as determined by Western blotting (data not shown). By contrast, transfection of a cFos expression vector did not reproducibly alter the activity of any of these reporter constructs. This indicates that relative levels of cJun or JunB (data not shown) in T cells can differentially activate the proximal TCR-RE, as well as the IFN-{gamma} TCR-RE and the larger (-562 bp to +64 bp) IFN-{gamma} promoter fragment, without altering the activity of the distal TCR-RE. These results are consistent with the observed influence of IL-12 on cJun protein expression and the activities of the proximal and distal TCR-RE during TCR stimulation of eTh cells.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7. Differential activation of IFN-{gamma} promoter regulatory regions by overexpression of cJun. EL4 cells (107) were transfected with the proximal TCR-RE-luc, the distal TCR-RE-luc, the complete IFN-{gamma} TCR-RE-luc, or the (-562 to + 64) IFN-{gamma}-luc plasmid (2.5 µg each) and 5 µg each of the indicated cJun or JunB expression plasmids or empty plasmids and 0.5 µg of a reference reporter plasmid using Transfast from Promega. After 24 h, cells (106) were either left unstimulated or were stimulated with PMA (200 nM) and ionomycin (500 ng/ml) for 5 h or 24 h. After the indicated periods of time, cells were harvested, lysed, and analyzed for expression of luciferase. Results are expressed as the increase in luciferase expression over equivalent numbers of unstimulated control cells transfected with the reporter plasmid and empty expression vector. Results are expressed as fold induction ±SE. Similar results were obtained in three independent experiments.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
Two minimal TCR responsive transcriptional elements have been identified within the immediate 5' flanking region of the IFN-{gamma} gene (15). To characterize mechanisms of control of IFN-{gamma} gene transcription in primary T cells during Th cell differentiation, we have prepared reporter transgenic mice that express the luciferase gene under the control of each of these elements (17). These transcriptional elements are inactive in pTh cells following Ag or polyclonal stimulation, but are active in eTh cells or memory (CD45RBlow, CD44high) CD4 T cells following identical stimulation (17). CREB-ATF-1 proteins are the dominant binding partners to these transcriptional elements in activated pTh cells, and CREB inhibits the activity of these transcriptional elements in transient transfection assays. CREB-ATF-1 proteins are not induced in eTh cells and dominant CREB-ATF-1 binding is replaced by dominant Jun/Jun and Jun/ATF-2 binding, and eTh cells express transcriptional activity under the control of each of these elements from the IFN-{gamma} promoter.

IL-12 affects IFN-{gamma} gene expression in at least three distinct ways. First, activation of undifferentiated T cells with Ag and IL-12 stimulates eTh1 differentiation yielding a population of effector T cells that produce high levels of IFN-{gamma} in response to secondary Ag stimulation. Second, IL-12 directly induces IFN-{gamma} gene expression in certain cell types, such as NK cells or eTh cells. Third, IL-12 stimulates IFN-{gamma} gene expression induced by TCR ligation in eTh cells and Th1 clones. We have previously shown that stimulation of eTh1 differentiation by IL-12 produces an effector population, which upon secondary Ag stimulation expresses increased levels of activity of the distal IFN-{gamma} TCR-RE, but not the proximal IFN-{gamma} TCR-RE, when compared with eTh cells (no exogenous cytokine) or eTh2 cells (IL-4 primed). Increased activity is accompanied by increased formation of ATF-2/cJun-distal TCR-RE protein-DNA complexes in gel mobility shift assays (19). Increased distal IFN-{gamma} TCR-RE activity may contribute to increased IFN-{gamma} gene transcription in eTh1 cells following secondary Ag stimulation.

The purpose of the investigation presented here was to determine whether these minimal TCR-RE are also responsive to IL-12R stimulation, either alone or in combination with TCR stimulation. The results show that neither minimal TCR-RE was directly responsive to IL-12R stimulation in eTh cells under conditions employed here. However, IL-12R stimulation directly induced GFP transgene expression under control of an IFN-{gamma} "minigene" and IFN-{gamma} secretion in these same cells. This argues that IFN-{gamma} gene expression induced directly by IL-12 is under transcriptional control, but that the transcriptional control lies outside of regions contained within the proximal and distal TCR-RE of the IFN-{gamma} promoter.

IL-12 also stimulates TCR-induced IFN-{gamma} gene expression (11, 12). In contrast to the above data, IL-12 stimulated TCR-induced activity of the proximal TCR-RE, but not the distal TCR-RE, in eTh cells. Stimulation with the combination of anti-CD3 and IL-12 led to increased formation of cJun-proximal TCR-RE protein-DNA complexes. Both IL-12 and anti-CD3 also induced elevated cJun protein expression. These data suggest that stimulation of cJun protein expression by anti-CD3 and IL-12 may lead to an increase in the binding of cJun to the IFN-{gamma} proximal TCR-RE and an increase in transcriptional activation.

The fact that IL-12 did not directly stimulate the activity of the proximal TCR-RE may reflect the lack of posttranslational modification of cJun in the absence of TCR stimulation. In fact, analysis of cJun electrophoretic mobility, in the presence or absence of phosphatase treatment, suggested that cJun was largely phosphorylated in T cells stimulated with anti-CD3, but was largely unphosphorylated in T cells stimulated only with IL-12. TCR stimulation is known to activate JNK enzymes that phosphorylate Jun proteins (32); phosphorylated Jun proteins transactivate TRE with much greater efficiencies than unphosphorylated Jun proteins (33). IL-12R signaling is not known to activate these enzymes in murine lymphocytes. The increased activity of the proximal IFN-{gamma} TCR-RE and increased IFN-{gamma} gene expression following stimulation of T cells by the combination of TCR and IL-12R signaling may result from the combination of IL-12R- and TCR-induced elevation of Jun protein levels and TCR-induced activation of JNK.

Why TCR-stimulated activity of the proximal TCR-RE is augmented by IL-12, while the activity of the distal TCR-RE is unresponsive to IL-12 costimulation, is not entirely clear. Both elements are imperfect TREs that bind Jun family members (16, 18, 19). It is becoming increasingly clear that different transcriptional elements can exhibit different affinities for specific AP-1 family members (34, 35) and that AP-1 proteins exhibit different transcriptional properties due to the presence of specific activation and repression domains and different posttranslational modifications (36, 37, 38). In addition, transcriptional coactivators, such as JAB1 (Jun activation domain binding protein 1), can increase the specificity of AP-1 transcription factors for specific TRE elements (39). Although not rigorously tested, our data suggest that the proximal TCR-RE has a lower affinity for Jun family proteins than does the distal TCR-RE (19). Thus, this lower affinity may make the proximal TCR-RE more responsive to increased levels of Jun proteins induced by IL-12 than the distal TCR-RE. There may be sufficient levels of Jun proteins in eTh cells activated by TCR stimulation alone to fully activate the distal TCR-RE. This is supported by both functional studies and binding studies. Alternatively, differential posttranslational modifications or differences in the specific AP-1 proteins induced by TCR signaling vs TCR + IL-12R signaling may contribute to differential stimulation of the proximal and distal TCR-REs in eTh cells.

These data are consistent with other investigations into the regulation of IFN-{gamma} gene transcription. First, the original demonstration that IL-12R signaling involves activation of Stat4 employed an experimental system similar to this one (11). Interestingly, the evidence suggested that there was no direct interaction between Stat4 and the IFN-{gamma} promoter and raised the possibility that an indirect pathway requiring the modification or induction of secondary transcription factors via Stat4 may mediate the stimulation by IL-12 of TCR-induced IFN-{gamma} gene expression. Results presented here are consistent with that notion and argue that cJun represents at least one transcription factor induced by IL-12 that binds to the IFN-{gamma} promoter and can stimulate transcription. Second, IL-12 stimulation of human peripheral T cells will directly activate an IFN-{gamma} promoter fragment (-572 to +7) reporter gene construct (9). The data argue that binding of activated Stat4 to an imperfect GAS element at ~-230 bp to -240 bp within this fragment is required for efficient IL-12-induced transcription directed by this IFN-{gamma} promoter fragment. This interpretation is consistent with our results, which demonstrated induction of GFP expression under the control of an IFN-{gamma} "minigene" by IL-12 but lack of activation of the proximal or distal TCR-RE. Taken together, these data argue that separate TCR-RE and IL-12R-RE in the IFN-{gamma} promoter control gene transcription in T cells in response to these different signaling pathways, but that these signaling pathways can also cooperate to stimulate IFN-{gamma} gene expression by activating the IFN-{gamma} proximal TCR-RE in a coordinate and cooperative manner.


   Footnotes
 
1 This work was supported by grants from the National Institutes of Health (KO1AR02027) and the Arthritis Foundation. Back

2 Address correspondence and reprint requests to Dr. Thomas M. Aune, MCN T3219, Vanderbilt University Medical Center, 21st and Garland, Nashville, TN 37232. E-mail address: Back

3 Abbreviations used in this paper: e, effector; p, precursor; CRE, cAMP response element; CREB, CRE binding protein; ATF, activation transcription factor; TRE, 12-O-tetradecanoylphorbol-13-acetate (TPA)-response element; GAS, {gamma} activation site; Cyt C, cytochrome C; GFP, green fluorescent protein. Back

Received for publication January 27, 1999. Accepted for publication May 10, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Boehm, U., T. Klamp, M. Groot, J. Howard. 1997. Cellular responses to interferon. Annu. Rev. Immunol. 15:749.[Medline]
  2. Billiau, A.. 1996. Interferon. Adv. Immunol. 62:61.[Medline]
  3. Trinchieri, G.. 1994. Interleukin-12: a cytokine produced by antigen-presenting cells with immunoregulatory functions in the generation of T-helper cells type 1 and cytotoxic lymphocytes. Blood 84:4008.[Free Full Text]
  4. Hsieh, C. -S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O’Garra, K. M. Murphy. 1993. Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages. Science 260:547.[Abstract/Free Full Text]
  5. Scott, P.. 1993. IL-12: initiation cytokine for cell-mediated immunity. Science 260:496.[Free Full Text]
  6. Seder, R. A., W. E. Paul. 1994. Acquisition of lymphokine-producing phenotype by CD4 T cells. Annu. Rev. Immunol. 12:635.[Medline]
  7. Abbas, A. K., K. M. Murphy, A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787.[Medline]
  8. Okamura, H., H. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  9. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K.-H. Meyer zum Buschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-{gamma} promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
  10. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. Ogarra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF-{kappa}B. Immunity 7:571.[Medline]
  11. Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, Jr J. E. Darnell, K. M. Murphy. 1995. Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4. J. Exp. Med. 181:1755.[Abstract/Free Full Text]
  12. Chan, S. J., B. Perussia, J. W. Gupta, M. Kobayashi, M. Posisil, H. A. Young, S. F. Wolf, D. Young, S. C. Clark, G. Trinchieri. 1991. Induction of interferon-{gamma} production by natural killer stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.[Abstract/Free Full Text]
  13. Murphy, E. E., G. Terres, S. E. Macatonia, C. -S. Hsieh, J. Mattson, L. Lanier, M. Wysocka, G. Trinchieri, K. M. Murphy, A. O’Garra. 1994. B7 and interleukin 12 cooperate for proliferation and interferon-{gamma} production by mouse T helper clones that are unresponsive to B7 costimulation. J. Exp. Med. 180:223.[Abstract/Free Full Text]
  14. Kubin, M., M. Kamoun, G. Trinchieri. 1994. Interleukin 12 synergizes with B7/CD28 interaction in inducing efficient proliferation and cytokine production of human T cells. J. Exp. Med. 180:211.[Abstract/Free Full Text]
  15. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon {gamma} promoter confer activation specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  16. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, H. A. Young. 1995. Negative transcriptional regulation of the interferon-{gamma} (IFN{gamma}) promoter by glucocorticoids and dominant-negative mutants of c-Jun. J. Biol. Chem. 270:12548.[Abstract/Free Full Text]
  17. Aune, T. M., L. A. Penix, M. R. Rincon, R. A. Flavell. 1996. Differential transcription directed by discrete IFN{gamma} promoter elements in naive and memory (effector) CD4 T cells, and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
  18. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, C. B. Wilson. 1996. The proximal regulatory element of the interferon-{gamma} promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
  19. Zhang, F., D. Z. Wang, M. Boothby, L. Penix, R. A. Flavell, T. M. Aune. 1998. Regulation of the activity of IFN-{gamma} promoter elements during Th cell differentiation. J. Immunol. 161:6105.[Abstract/Free Full Text]
  20. Ye, J., P. Ghosh, M. Cippitelli, J. Subleski, K. J. Hardy, J. R. Ortaldo, H. A. Young. 1994. Characterization of a silencer regulatory element in the human interferon-{gamma} promoter. J. Biol. Chem. 269:25728.[Abstract/Free Full Text]
  21. Ye. J., M., L. Cippitelli, J. R. Dorman, J. R. Ortaldo, H. A. Young. 1996. The nuclear factor YY1 suppresses the human gamma interferon promoter through two mechanisms: inhbition of AP1 binding and activation of a silencer element. Mol. Cel. Biol. 16:4744.[Abstract]
  22. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text]
  23. Xu, X., Y.-L. Sun, T. Hoey. 1996. Cooperative DNA binding and sequence- selective recognition conferred by the STAT amino-terminal domain. Science 273:794.[Abstract]
  24. Sweetser, M. T., T. Hoey, Y. -L. Sun, W. M. Weaver, G. A. Price, C. B. Wilson. 1998. The roles of nuclear factor of activated T cells and Ying-Yang 1 in activation-induced expression of the interferon-{gamma} promoter in T cells. J. Biol. Chem. 273:34775.[Abstract/Free Full Text]
  25. De Wet, J. R., K. V. Wood, M. DeLuca, D. R. Helinska, S. Subramani. 1987. Firefly luciferase gene: structure and expression in mammalian cells. Mol. Cell. Biol. 7:725.[Abstract/Free Full Text]
  26. Hogan, B., F. Costantini, E. Lacy. 1986. Manipulating the Mouse Embryo, A Laboratory Manual Cold Spring Harbor Laboratory Press, Plainview.
  27. Kaye, J. M., M. -L. Hsu, M. -E. Sauron, S. C. Jameson, N. R. J. Gascoigne, S. M. Hedrick. 1989. Selective development of CD4+ T cells in transgenic mice expressing a class II MHC-restricted antigen receptor. Nature 341:746.[Medline]
  28. Thierfelder, W. E., J. M. van Deursen, K. Yamamoto, R. A. Tripp, S. R. Sarawar, R. R. Carson, M. Y. Sangster, D. A. A. Vignali, P. C. Doeherty, G. C. Grosveld, J. N. Ihle. 1996. Requirement for Stat4 in interleukin-12 mediated responses of natural killer and T cells. Nature 382:171.[Medline]
  29. Schreiber, E., P. Mathias, M. Muller, W. Sheffner. 1989. Rapid detection of octamer binding proteins with mini-extracts prepared from small numbers of cells. Nucleic Acids Res. 17:6419.[Free Full Text]
  30. Tugures, A., M. A. Alonso, F. Sanchez-Madrid, M. O. De Landazuri. 1992. Human T cell activation through the activation inducer molecule CD69 enhances the activity of transcription factor AP-1. J. Immunol. 148:2300.[Abstract]
  31. Kaplan, M. K., Y. Sun, T. Hoey, M. J. Grusby. 1996. Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice. Nature 382:174.[Medline]
  32. Su, B., E. Jacinto, M. Hibi, T. Kallunki, M. Karin, Y. Ben-Neriah. 1994. JNK is involved in signal integration during costimulation of T lymphocytes. Cell 77:727.[Medline]
  33. Karin, M., Z.-G. Liu, and E. Zandi. AP-1 function and regulation. Curr. Opin. Cell Biol. 9:240.
  34. Angel, P., M. Karin. 1991. The role of jun, fos and the AP-1 complex in cell proliferation and transformation. Biochim. Biophys. Acta 107:129.
  35. McBride, K., M. Nemer. 1998. The C-terminal domain of c-fos is required for activation of an AP-1 site specific for jun-fos heterodimers. Mol. Cell. Biol. 18:5073.[Abstract/Free Full Text]
  36. Deng, T., M. Karin. 1993. JunB differs from c-Jun in its DNA-binding and dimerization domains and represses c-Jun by formation of inactive heterodimers. Genes Dev. 7:479.[Abstract/Free Full Text]
  37. Lucibello, F.C., E. P. Slater, K. U. Jooss, M. Beato, R. Muller. 1990. Mutual transrepression of fos and the glucocorticoid receptor: involvement of a functional domain in fos which is absent in fosb. EMBO J. 9:2827.[Medline]
  38. Suzuki, T., H. Okuno, T. Yoshida, T. Endo, H. Nishinal, H. Iba. 1991. Difference in transcriptional regulatory function between c-Fos and Fra-2. Nucleic Acids Res. 19:5537.[Abstract/Free Full Text]
  39. Claret, F. -X., M. Hibi, S. Dhut, T. Toda, M. Karin. 1996. A new group of conserved coactivators that increase the specificity of AP-1 transcription factors. Nature 383:453.[Medline]



This article has been cited by other articles:


Home page
 Int ImmunolHome page
K.-Y. Chau, A. M. Keane-Myers, M. Fedele, Y. Ikeda, R. J. Creusot, L. Menozzi, D. J. Cousins, G. Manfioletti, L. Feigenbaum, A. Fusco, et al.
IFN-{gamma} gene expression is controlled by the architectural transcription factor HMGA1
Int. Immunol., March 1, 2005; 17(3): 297 - 306.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
J. H. Bream, R. E. Curiel, C.-R. Yu, C. E. Egwuagu, M. J. Grusby, T. M. Aune, and H. A. Young
IL-4 synergistically enhances both IL-2- and IL-12-induced IFN-{gamma} expression in murine NK cells
Blood, July 1, 2003; 102(1): 207 - 214.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
B. Samten, B. Wizel, H. Shams, S. E. Weis, P. Klucar, S. Wu, R. Vankayalapati, E. K. Thomas, S. Okada, A. M. Krensky, et al.
CD40 Ligand Trimer Enhances the Response of CD8+ T Cells to Mycobacterium tuberculosis
J. Immunol., March 15, 2003; 170(6): 3180 - 3186.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Soutto, F. Zhang, B. Enerson, Y. Tong, M. Boothby, and T. M. Aune
A Minimal IFN-{gamma} Promoter Confers Th1 Selective Expression
J. Immunol., October 15, 2002; 169(8): 4205 - 4212.
[Abstract] [Full Text] [PDF]

Home page
 Infect. Immun.Home page
T. K. Varma, T. E. Toliver-Kinsky, C. Y. Lin, A. P. Koutrouvelis, J. E. Nichols, and E. R. Sherwood
Cellular Mechanisms That Cause Suppressed Gamma Interferon Secretion in Endotoxin-Tolerant Mice
Infect. Immun., September 1, 2001; 69(9): 5249 - 5263.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zhang, F.
Right arrow Articles by Aune, T. M.
Right arrowPubmed/NCBI databases
*Substance via MeSH

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS