HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS		QUICK SEARCH:   [advanced] Author: Keyword(s): Year:  Vol:  Page:

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ozaki, H. Articles by Kita, T. Search for Related Content PubMed PubMed Citation Articles by Ozaki, H. Articles by Kita, T.

Cutting Edge: Combined Treatment of TNF- and IFN- Causes Redistribution of Junctional Adhesion Molecule in Human Endothelial Cells¹

Harunobu Ozaki^*, Kenji Ishii^2,*, Hisanori Horiuchi^*, Hidenori Arai^*, Takahiro Kawamoto^*, Katsuya Okawa, Akihiro Iwamatsu and Toru Kita^*

^* Department of Geriatric Medicine, Graduate School of Medicine, Faculty of Medicine, Kyoto University, Kyoto, Japan; and Central Laboratories for Key Technology, Kirin Brewery, Yokohama, Japan

	Abstract

Top Abstract Introduction Materials and Methods Results Discussion References

 
Proinflammatory cytokines such as TNF- and IFN- induce cell adhesion molecules in endothelial cells and promote transmigration of leukocytes across endothelial cells. However, when those two were administered together, leukocyte transmigration paradoxically decreased. We cloned a human and bovine homologue of the junctional adhesion molecule (JAM), a novel molecule at the tight junction, and examined the effects of proinflammatory cytokines on JAM in HUVECs. The combined treatment of TNF- plus IFN- caused a disappearance of JAM from intercellular junctions. However, flow cytometry, cell ELISA, and subcellular fractionation analysis demonstrated that the amount of JAM was not reduced. This suggested that JAM changed its distribution in response to proinflammatory cytokines. This redistribution of JAM might be involved in a decrease in transendothelial migration of leukocytes at inflammatory sites.

	Introduction

Top Abstract Introduction Materials and Methods Results Discussion References

 
Proinflammatory cytokines, such as TNF- and IFN- increase the expression of cell adhesion molecules, such as ICAM-1 and VCAM-1, in endothelial cells (ECs)³ and promote the transendothelial migration (TEM) of leukocytes (1, 2, 3). However, when those two cytokines were added in combination, TEM paradoxically decreased (4). This phenomenon was accompanied by the disappearance of platelet EC adhesion molecule-1 (PECAM-1) from intercellular junctions. PECAM-1 is a member of the Ig superfamily and is required for TEM (5, 6). Therefore, the reduction of adhesion molecules also might play important roles in TEM of leukocytes.

Recently, the junctional adhesion molecule (JAM), a novel member of the Ig gene superfamily, was identified and shown to be constitutively expressed at intercellular junctions of ECs (7). Padura et al. suggested that JAM might play a role in monocyte transmigration because anti-JAM mAb inhibited monocyte TEM in vitro and monocyte infiltration by chemokine in vivo. However, the effects of proinflammatory cytokines on JAM remain unknown.

In this study, we cloned human and bovine homologues of JAM independently from Padura et al. and investigated the effects of TNF- and IFN- on JAM in human ECs. We demonstrate that the treatment with TNF- plus IFN- induces redistribution of JAM on the cell surface. This redistribution might play an important role in regulating TEM of leukocytes in inflammation.

	Materials and Methods

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cell culture and preparation

HUVECs were isolated, cultured, and used at passage 2 to eliminate detachment or retraction as described (4). Bovine arterial ECs were prepared as described previously (8).

Cloning of human, bovine, and murine JAM cDNAs

During purifying a novel membrane-associated protease in bovine aortic ECs, we purified a 40-kDa protein as a by-product, and the amino acid sequence was determined (9). One of the peptide sequences matched genes in expression sequence tag (EST) data banks (Fig. 1). An oligonucleotide primer (gtcccatacccattccgtgcctc) was designed based on the human EST clone AA152150, and RT-PCR was performed using the human placental cDNA library (Marathon-Ready cDNA; Clontech, Palo Alto, CA). A single clone was obtained and subjected to nucleotide sequence analysis. A human colon EC line cDNA library (Stratagene, La Jolla, CA) was screened with the human cDNA fragment, and the positive clones were sequenced. A mouse 7-day embryo cDNA library (Clontech) was screened with EST clone AA561790, and a bovine aortic EC cDNA library (Stratagene) was screened with murine cDNA. Nucleotide sequencing was performed by dideoxy method (Prism 310, Applied Biosystems, Foster City, CA).

View larger version (66K): [in this window] [in a new window]   FIGURE 1. Deduced amino acid sequences of cDNA clones encoding the human, bovine, and murine JAM. Conserved cysteine residues are boxed. Putative N-glycosylation sites are printed by boldface type and are indicated by a triangle. The amino acid sequence that was detected in the EST clone was underlined. Putative phosphorylation sites are printed by boldface type and are indicated by an asterisk. The transmembrane domain is indicated by vertical blankets. Dashes indicate insertions to maximize homology. (GenBank accession number of human JAM, AF111713; bovine JAM, AF111714)

Rabbit Ab against the human JAM extracellular domain (ECD) (JAM (ECD)) was generated by immunizing rabbits with bacterial fusion protein GST-JAM (ECD). Rabbit Ab against the human JAM cytoplasmic domain was generated by immunizing rabbits with a synthetic peptide, CSQPSARSEGEFKQ. These Abs recognized JAM transiently expressed in Chinese hamster ovary (CHO) cells by Western blot and immunofluorescence microscopy. Mouse mAb against the human JAM (ECD), designated 3D8, was raised against JAM (ECD):IgG1 hinge fusion protein (10) and screened by cell ELISA against the stable CHO cell line that expresses human JAM.

Other Abs were obtained from Santa Cruz Biotechnology (Santa Cruz, CA) if not described.

Immunofluorescence microscopy

Cultured cells were fixed with 4% paraformaldehyde in PBS and blocked with 2% goat serum and 0.1% BSA in PBS. For staining in a nonpermeabilized condition, fixed cells were incubated with anti-JAM (ECD), anti-PECAM-1 mAb (158-2B3; Neo Markers, Union City, CA), anti-VCAM-1 mAb (10C9; PharMingen, San Diego, CA) followed by Alexa 488-conjugated secondary Abs (Molecular Probes, Eugene, OR). For staining in permeabilized conditions, paraformaldehyde-fixed cells were permeabilized with 0.1% Triton X-100 in PBS and then incubated with anti-JAM (3D8) followed by Alexa 488-conjugated secondary Ab and phalloidin-rhodamine (Molecular Probes).

Flow cytometry

HUVECs were dispersed by PBS with 1 mM EDTA, washed with PBS containing 1% BSA, and stained with rabbit anti-JAM (ECD), anti-PECAM-1 mAb 158-2B3, anti-VCAM-1 mAb 10C9, or anti-JAM (3D8) for 1 h at 4°C followed by incubating with Alexa 488-labeled secondary Abs. Flow cytometry was performed by using FACS (FACS Vantage; Becton Dickinson, Mountain View, CA).

Cell ELISA

HUVECs fixed with 4% paraformaldehyde were incubated with anti-VCAM-1 mAb (10C9), anti-JAM (3D8), or each isotype-matched control IgG followed by HRP-conjugated anti mouse Ab (Amersham-Pharmacia, Piscataway, NJ). The HRP activity was detected by development with tetramethylbenzidine (Dako, Carpinteria, CA). OD was measured at A_{450 nm}.

Fractionation of cell-surface proteins

Cell-surface proteins were biotin labeled with 1 mg/ml NHS-sulfo-biotin (Pierce, Rockford, IL) as described by Yip et al. (11). For fractionation of biotinylated cell-surface proteins from intracellular proteins, postnuclear supernatants were bound to streptavidin-agarose (Sigma, St. Louis, MO). The bound proteins were washed with Triton lysis buffer (20 mM Tris, pH 7.4, 10 mM EDTA, 1% Triton X-100, and protease inhibitors), and eluted into SDS sample buffer. The same amount of proteins (v/v) from the initial total-cell lysate, the eluate from streptavidin-beads (biotinylated surface proteins), and the flow through (unbiotinylated proteins) were then subjected to Western blot analysis. Protein concentration was determined by the Bradford method.

	Results

Top Abstract Introduction Materials and Methods Results Discussion References

 
Cloning of human, bovine, and murine JAM

Microsequensing analysis of a 40-kDa protein from bovine aortic ECs revealed an amino acid sequence of five peptides. We searched EST banks for cDNA homology deduced from the peptides and found three sequences (AA564790, AA152150, and AA304161) that were homologous to one of the sequences. Based on these sequences, we cloned human, bovine, and murine full-length cDNAs as described in Materials and Methods.

The degrees of identity at the amino acid level among human and the corresponding bovine or murine clones were 75% and 68%, respectively (Fig. 1). The amino acid sequence of the murine clone was identical with that of a recently identified murine adhesion molecule, JAM, except one amino acid (268 ThrArg) (7). Therefore, we concluded that the cDNAs were human and bovine homologues of murine JAM.

JAM disappears from intercellular junctions of HUVECs treated with TNF- plus IFN- in combination

We examined the localization of JAM and the effects of inflammatory cytokines on the distribution of JAM in HUVECs. HUVECs were treated with 100 U/ml TNF- and 200 U/ml IFN-, separately or in combination (4, 12, 13), and the localization of JAM was examined by immunofluorescence microscopy with anti-JAM (ECD). In untreated HUVECs, most of the JAM was expressed at intercellular junctions (Fig. 2Aa). In contrast, in TNF--treated HUVECs, JAM was stained less intensively at intercellular junctions (Fig. 2Ab). IFN- also slightly reduced the JAM expression (Fig. 2Ac). In a sharp contrast, after treatment with TNF- plus IFN- in combination, JAM was almost completely disappeared from intercellular junctions, which was accompanied with elongated morphology of ECs (12) (Fig. 2Ad). The disappearance of JAM occurred as early as 8 h after cytokine treatment (data not shown). We also found that this phenomenon is reversible 48 h after replacement of the medium (data not shown). The same combination of cytokine treatment also markedly reduced PECAM-1 expression from intercellular junctions (Fig. 2A, e and f) (4, 14). In contrast, VCAM-1 expression was markedly induced by the same treatment of HUVECs (Fig. 2A, g and h) (3). These results indicated that JAM disappeared from intercellular junctions by the treatment with the combination of TNF- plus IFN-. Double staining with anti-JAM mAb (3D8) and rhodamine-conjugated phalloidin demonstrated that a rearrangement of actin fibers was also induced by TNF- plus IFN- (Fig. 2B) (12). This result also indicated that a change in fluorescence staining is not because of any loss or change in the endothelial monolayer.

View larger version (77K): [in this window] [in a new window]   FIGURE 2. Localization of JAM in HUVEC treated with inflammatory cytokines. A, HUVECs were either untreated (a, e, g) or treated with 100 U/ml TNF- for 24 h (b), 200 U/ml IFN- for 24 h (c), or 100 U/ml TNF- plus 200 U/ml IFN- for 24 h (d, f, h). HUVECs were fixed and stained in a nonpermeabilized condition for JAM (a, b, c, d) with anti-JAM (ECD) and PECAM-1 (e, f) with mAb 158-2B3 and VCAM-1 (g, h) with 51-10C9 and followed by Alexa 488-cojugated secondary Ab against rabbit or mouse IgG. B, HUVECs were either untreated (a, b) or treated with 100 U/ml TNF- plus 200 U/ml IFN- for 24 h (c, d). Fixed HUVECs were permeabilized and stained for JAM with anti-JAM mAb 3D8 followed by Alexa 488-cojugated secondary Ab and for F-actin with rhodamine-conjugated phalloidin. Fluorescence for JAM (a, c) and F-actin (b, d) was detected. Note that the intensity of the immunofluorescence signal of JAM and PECAM-1 always seemed more intensive in overlapped areas of elongated HUVECs than in nonoverlapped areas (original magnification, x400).

TNF- and/or IFN- treatment did not change the amount of JAM on the cell surface of HUVECs

Next, to examine whether the amount of JAM on the cell surface is reduced in response to the cytokine treatment, we performed FACS analysis (Fig. 3). Unexpectedly, the expression of JAM and PECAM-1 was not decreased after the same cytokine treatment. In contrast, VCAM-1 expression was clearly increased by TNF- and/or IFN-. Furthermore, prolonged treatment with TNF- plus IFN- for up to 48 h did not change the cell-surface JAM expression (data not shown). FACS analysis using anti-JAM mAb (3D8) showed a comparable result with that using anti-JAM (ECD) (data not shown). The results of Figs. 2 and 3 suggested that the cytokine treatment might have changed the structure of intercellular junctions so that Abs could not reach. Therefore, to determine whether JAM is still present at intercellular junctions or changed its distribution to cell surface, JAM on the cell surface was determined by cell ELISA (Fig. 4). The expression of JAM in HUVECs after the treatment was almost equal to that in untreated cells (Fig. 4A). In contrast, VCAM-1 expression was clearly increased by the same treatment (Fig. 4B).

View larger version (45K): [in this window] [in a new window]   FIGURE 3. FACS of cytokines-treated HUVECs. Cell-surface expression of JAM, PECAM-1, and VECAM-1 on HUVECs under a baseline condition or treated with 100 U/ml TNF-, 200 U/ml IFN-, and 100 U/ml TNF-a plus 200 U/ml IFN- were assessed by FACS.

View larger version (19K): [in this window] [in a new window]   FIGURE 4. Cell ELISA of cytokines-treated HUVECs. Cell-surface expression of JAM (A) and VCAM-1 (B) on HUVECs under a baseline condition or after the treatment with 100 U/ml TNF- and 200 U/ml IFN- for 24 h were assessed by cell ELISA. Each experiment was performed in triplicate.

Neither subcellular localization nor total amount of JAM was affected by TNF- and/or IFN- treatment

The results of immunofluorescence microscopy, FACS, and cell ELISA indicated that JAM loses localization at intercellular junctions and redistributes on the cell surface by proinflammatory cytokines similarly to PECAM-1 (14). Therefore, to confirm this, we examined the change in the amount of JAM in the cell surface and intracellular fractions by cell-surface biotinylation and separating them from intracellular proteins with avidin-agarose (Fig. 5A). Western blotting revealed that JAM was predominantly distributed in the cell-surface fraction of unstimulated ECs. In contrast, extracellular signal-regulated kinase was exclusively localized in the intracellular fraction (15) and PECAM-1 was detected in both fractions (16).

View larger version (30K): [in this window] [in a new window]   FIGURE 5. A, Separation of cell-surface and intracellular proteins. HUVECs were biotinylated, and the postnuclear extracts were adsorbed with streptavidin-agarose. The same amount of proteins (v/v) from the initial total cell lysate (T), the eluate from streptavidin-beads (cell-surface proteins; CS), and the flow through (intracellular proteins; IC) were then subjected to Western blot with anti-JAM (ECD) (lanes 1–3), anti-PECAM-1 (lanes 4 and 5), and anti-ERK Abs (lanes 6 and 7). As rabbit anti-ERK1 Ab cross-reacts with ERK2, two bands were recognized (arrowheads: upper, ERK1; lower, ERK2). B, TNF- plus IFN- did not change the subcellular localization of JAM. HUVECs with or without treatment of TNF- plus IFN- were subjected to cell-surface biotinylation followed by fractionation with avidin-agarose as described in A. The equal amount of protein (v/v) was analyzed by Western blot with a rabbit Ab against human JAM cytoplasmic domain (lanes 1–4), anti-PECAM-1 Ab (lanes 5–8), and anti-VCAM-1 Ab (lanes 9–12).

	Discussion

Top Abstract Introduction Materials and Methods Results Discussion References

 
In this study, we cloned human and bovine JAM and demonstrated that the combined treatment of TNF- plus IFN- caused redistribution of JAM as well as PECAM-1. JAM disappeared from intercellular junctions of HUVECs by immunofluorescence microscopy (Fig. 2). However, flow cytometry, cell ELISA, and subcellular fractionation analysis showed that the amount of JAM on the cell surface was not changed by the treatment ( Figs. 3–5). Therefore, we concluded that JAM changed its distribution on the cell surface by the treatment, and we suggest that the redistribution of JAM might play a role in decreasing TEM of leukocytes.

Inflammatory cytokines are known to play pivotal roles in TEM of leukocytes by inducing several cell adhesion molecules in ECs. For example, Bradley et al. reported that prolonged treatment of HUVECs with TNF- causes induction of VCAM-1, ICAM-1 and -2, ß₁ and ß₃ integrins, and redistribution of them from the apical surface to intercellular junctions (17). The authors speculated that the expression of cell adhesion molecules on the apical surface might first facilitate attachment to ECs and subsequently redistribution to cell junctions might enhance transmigration. Interestingly, however, when ECs were treated with TNF- plus IFN- in combination, this increase in TEM of leukocytes was almost nullified (Ref. 4 and our unpublished observation). The authors have shown that this phenomenon correlates with a decrease of PECAM-1 at intercellular junctions. The mechanisms of a decrease of PECAM-1 at intercellular junctions by TNF- plus IFN- have been controversial. Rival et al. has reported that this decrease is due to the inhibition of synthesis (4), while Romer et al. has shown that PECAM-1 redistributed from the junction to the cell surface (14). Our results of flow cytometry, cell ELISA, and cell-surface fractionation gave evidence to support the latter report.

Here, we demonstrated that a new member of the Ig gene superfamily, JAM, is also regulated by inflammatory cytokines. TNF- or IFN- alone caused slight redistribution of JAM in HUVECs (Figs. 2 and 3), and combination of those two markedly induced the redistribution of JAM as well as PECAM-1. Given that JAM is localized at intercellular junctions and involved in TEM, it is conceivable that the redistribution of JAM also contributes to negative regulation of transmigration of leukocytes in addition to PECAM-1. Based on our study, we propose a novel family of cell adhesion molecule consisting of JAM and PECAM-1 that are involved in negative regulation of leukocyte TEM. Both molecules are predominantly expressed at intercellular junctions of ECs (6, 7) and redistribute in response to proinflamatory cytokines. However, different sublocalization in intercellular junctions, JAM at an apical side (7) and PECAM-1 at a basolateral side (18), suggests their different roles in TEM. Further study will help to reveal the physiological significance of JAM in vivo.

	Acknowledgments

 
We thank Dr. Brian Seed for the plasmid pCd5lneg1 that was used to generate JAM (ECD):IgG1 hinge fusion protein, Dr. Noriaki Kume for helpful discussion, and Xiaoming Hu and Yukio Ohshima for excellent technical assistance.

	Footnotes

 
¹ This study was supported by the Ministry of Education, Science, Sports, and Culture, Research Grants 09281104 and 09044293, the Takeda Medical Research Foundation (1998, 1999), and the HMG-CoA Reductase Research Foundation.

² Address correspondence and reprint requests to Dr. Kenji Ishii, Department of Geriatric Medicine, Graduate School of Medicine, Faculty of Medicine, Kyoto University, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan. E-mail address:

³ Abbreviations used in this paper: ECs, endothelial cells; ECD, extracellular domain; EST, expression sequence tag; JAM, junctional adhesion molecule; PECAM-1, platelet endothelial cell adhesion molecule-1; TEM, transendothelial migration; CHO, Chinese hamster ovary.

Received for publication March 11, 1999. Accepted for publication April 26, 1999.

	References

Top Abstract Introduction Materials and Methods Results Discussion References

 

1. Bevilacqua, M. P., J. S. Pober, D. L. Mendrick, R. S. Cotran, Jr M. A. Gimbrone. 1987. Identification of an inducible endothelial-leukocyte adhesion molecule. Proc. Natl. Acad. Sci. USA 84:9238.[Abstract/Free Full Text]
2. Dustin, M. L., R. Rothlein, A. K. Bhan, C. A. Dinarello, T. A. Springer. 1986. Induction by IL 1 and interferon-: tissue distribution, biochemistry, and function of a natural adherence molecule (ICAM-1). J. Immunol. 137:245.[Abstract]
3. Osborn, L., C. Hession, R. Tizard, C. Vassallo, S. Luhowskyj, G. Chi-Rosso, R. Lobb. 1989. Direct expression cloning of vascular cell adhesion molecule 1, a cytokine-induced endothelial protein that binds to lymphocytes. Cell 59:1203.[Medline]
4. Rival, Y., A. Del Maschio, M. J. Rabiet, E. Dejana, A. Duperray. 1996. Inhibition of platelet endothelial cell adhesion molecule-1 synthesis and leukocyte transmigration in endothelial cells by the combined action of TNF- and IFN-. J. Immunol. 157:1233.[Abstract]
5. Newman, P. J., M. C. Berndt, J. Gorski, G. C. D. White, S. Lyman, C. Paddock, W. A. Muller. 1990. PECAM-1 (CD31) cloning and relation to adhesion molecules of the immunoglobulin gene superfamily. Science 247:1219.[Abstract/Free Full Text]
6. Newman, P. J.. 1997. The biology of PECAM-1. J. Clin. Invest. 99:3.[Medline]
7. Martin-Padura, I., S. Lostaglio, M. Schneemann, L. Williams, M. Romano, P. Fruscella, C. Panzeri, A. Stoppacciaro, L. Ruco, A. Villa, D. Simmons, E. Dejana. 1998. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration. J. Cell Biol. 142:117.[Abstract/Free Full Text]
8. Ozaki, H., K. Ishii, H. Arai, N. Kume, T. Kita. 1999. Lysophosphatidylcholine activates mitogen-activated protein kinases by a tyrosine kinase-dependent pathway in bovine aortic endothelial cells. Atherosclerosis 143:261.[Medline]
9. Welch, M. D., A. Iwamatsu, T. J. Mitchison. 1997. Actin polymerization is induced by Arp2/3 protein complex at the surface of Listeria monocytogenes. Nature 385:265.[Medline]
10. Zettlmeissl, G., J.-P. Gregersen, J. M. Duport, S. Mehdi, G. Reiner, B. Seed. 1990. Expression and characterization of human CD4: immunoglobulin fusion proteins. DNA Cell Biol. 9:347.[Medline]
11. Yip, J. W., W. H. Ko, G. Viberti, R. L. Huganir, M. Donowitz, C. M. Tse. 1997. Regulation of the epithelial brush border Na⁺/H⁺ exchanger isoform 3 stably expressed in fibroblasts by fibroblast growth factor and phorbol esters is not through changes in phosphorylation of the exchanger. J. Biol. Chem. 272:18473.[Abstract/Free Full Text]
12. Stolpen, A. H., E. C. Guinan, W. Fiers, J. S. Pober. 1986. Recombinant tumor necrosis factor and immune interferon act singly and in combination to reorganize human vascular endothelial cell monolayers. Am. J. Pathol. 123:16.[Abstract]
13. Saegusa, Y., M. Ziff, L. Welkovich, D. Cavender. 1990. Effect of inflammatory cytokines on human endothelial cell proliferation. J. Cell. Physiol. 142:488.[Medline]
14. Romer, L. H., N. V. McLean, H. C. Yan, M. Daise, J. Sun, H. M. DeLisser. 1995. IFN- and TNF- induce redistribution of PECAM-1 (CD31) on human endothelial cells. J. Immunol. 154:6582.[Abstract]
15. Gonzalez, F. A., A. Seth, D. L. Raden, D. S. Bowman, F. S. Fay, R. J. Davis. 1993. Serum-induced translocation of mitogen-activated protein kinase to the cell surface ruffling membrane and the nucleus. J. Cell Biol. 122:1089.[Abstract/Free Full Text]
16. Goldberger, A., K. A. Middleton, J. A. Oliver, C. Paddock, H. C. Yan, H. M. DeLisser, S. M. Albelda, P. J. Newman. 1994. Biosynthesis and processing of the cell adhesion molecule PECAM-1 includes production of a soluble form. J. Biol. Chem. 269:17183.[Abstract/Free Full Text]
17. Bradley, J. R., J. S. Pober. 1996. Prolonged cytokine exposure causes a dynamic redistribution of endothelial cell adhesion molecules to intercellular junctions. Lab. Invest. 75:463.[Medline]
18. Ayalon, O., H. Sabanai, M. G. Lampugnani, E. Dejana, B. Geiger. 1994. Spatial and temporal relationships between cadherins and PECAM-1 in cell-cell junctions of human endothelial cells. J. Cell Biol. 126:247.[Abstract/Free Full Text]

This article has been cited by other articles:

				C. Scheiermann, B. Colom, P. Meda, N. S.A. Patel, M.-B. Voisin, A. Marrelli, A. Woodfin, C. Pitzalis, C. Thiemermann, M. Aurrand-Lions, et al. Junctional Adhesion Molecule-C Mediates Leukocyte Infiltration in Response to Ischemia Reperfusion Injury Arterioscler Thromb Vasc Biol, October 1, 2009; 29(10): 1509 - 1515. [Abstract] [Full Text] [PDF]

				I. Mack, R. S. BelAiba, T. Djordjevic, A. Gorlach, H. Hauner, and B. L. Bader Functional analyses reveal the greater potency of preadipocytes compared with adipocytes as endothelial cell activator under normoxia, hypoxia, and TNF{alpha} exposure Am J Physiol Endocrinol Metab, September 1, 2009; 297(3): E735 - E748. [Abstract] [Full Text] [PDF]

				R. R. Koenen, J. Pruessmeyer, O. Soehnlein, L. Fraemohs, A. Zernecke, N. Schwarz, K. Reiss, A. Sarabi, L. Lindbom, T. M. Hackeng, et al. Regulated release and functional modulation of junctional adhesion molecule A by disintegrin metalloproteinases Blood, May 7, 2009; 113(19): 4799 - 4809. [Abstract] [Full Text] [PDF]

				N. Bardin, M. Blot-Chabaud, N. Despoix, A. Kebir, K. Harhouri, J.-P. Arsanto, L. Espinosa, P. Perrin, S. Robert, F. Vely, et al. CD146 and its Soluble Form Regulate Monocyte Transendothelial Migration Arterioscler Thromb Vasc Biol, May 1, 2009; 29(5): 746 - 753. [Abstract] [Full Text] [PDF]

				C. Chen, M. S. Jamaluddin, S. Yan, D. Sheikh-Hamad, and Q. Yao Human Stanniocalcin-1 Blocks TNF-{alpha}-Induced Monolayer Permeability in Human Coronary Artery Endothelial Cells Arterioscler Thromb Vasc Biol, May 1, 2008; 28(5): 906 - 912. [Abstract] [Full Text] [PDF]

				M. U. Naik, T. U. Naik, A. T. Suckow, M. K. Duncan, and U. P. Naik Attenuation of Junctional Adhesion Molecule-A Is a Contributing Factor for Breast Cancer Cell Invasion Cancer Res., April 1, 2008; 68(7): 2194 - 2203. [Abstract] [Full Text] [PDF]

				Y. Sugano, M. Takeuchi, A. Hirata, H. Matsushita, T. Kitamura, M. Tanaka, and A. Miyajima Junctional adhesion molecule-A, JAM-A, is a novel cell-surface marker for long-term repopulating hematopoietic stem cells Blood, February 1, 2008; 111(3): 1167 - 1172. [Abstract] [Full Text] [PDF]

				D. Montufar-Solis, J. Schaefer, M. J. Hicks, and J. R. Klein Massive but selective cytokine dysregulation in the colon of IL-10 / mice revealed by multiplex analysis Int. Immunol., January 1, 2008; 20(1): 141 - 154. [Abstract] [Full Text] [PDF]

				R. J. Ossiboff and J. S. L. Parker Identification of Regions and Residues in Feline Junctional Adhesion Molecule Required for Feline Calicivirus Binding and Infection J. Virol., December 15, 2007; 81(24): 13608 - 13621. [Abstract] [Full Text] [PDF]

				B. Guezguez, P. Vigneron, N. Lamerant, C. Kieda, T. Jaffredo, and D. Dunon Dual Role of Melanoma Cell Adhesion Molecule (MCAM)/CD146 in Lymphocyte Endothelium Interaction: MCAM/CD146 Promotes Rolling via Microvilli Induction in Lymphocyte and Is an Endothelial Adhesion Receptor J. Immunol., November 15, 2007; 179(10): 6673 - 6685. [Abstract] [Full Text] [PDF]

				M. Mirza, C. Petersen, K. Nordqvist, and K. Sollerbrant Coxsackievirus and Adenovirus Receptor Is Up-Regulated in Migratory Germ Cells during Passage of the Blood-Testis Barrier Endocrinology, November 1, 2007; 148(11): 5459 - 5469. [Abstract] [Full Text] [PDF]

				C. Q.F. Wang and C. Y. Cheng A seamless trespass: germ cell migration across the seminiferous epithelium during spermatogenesis J. Cell Biol., August 9, 2007; 178(4): 549 - 556. [Abstract] [Full Text] [PDF]

				G. Mandicourt, S. Iden, K. Ebnet, M. Aurrand-Lions, and B. A. Imhof JAM-C Regulates Tight Junctions and Integrin-mediated Cell Adhesion and Migration J. Biol. Chem., January 19, 2007; 282(3): 1830 - 1837. [Abstract] [Full Text] [PDF]

				M. Lucerna, A. Zernecke, R. de Nooijer, S. C. de Jager, I. Bot, C. van der Lans, I. Kholova, E. A. Liehn, T. J. C. van Berkel, S. Yla-Herttuala, et al. Vascular endothelial growth factor-A induces plaque expansion in ApoE knock-out mice by promoting de novo leukocyte recruitment Blood, January 1, 2007; 109(1): 122 - 129. [Abstract] [Full Text] [PDF]

				S. Nourshargh, F. Krombach, and E. Dejana The role of JAM-A and PECAM-1 in modulating leukocyte infiltration in inflamed and ischemic tissues J. Leukoc. Biol., October 1, 2006; 80(4): 714 - 718. [Abstract] [Full Text] [PDF]

				M. S. Maginnis, J. C. Forrest, S. A. Kopecky-Bromberg, S. K. Dickeson, S. A. Santoro, M. M. Zutter, G. R. Nemerow, J. M. Bergelson, and T. S. Dermody {beta}1 Integrin Mediates Internalization of Mammalian Reovirus J. Virol., March 15, 2006; 80(6): 2760 - 2770. [Abstract] [Full Text] [PDF]

				M. U. Naik and U. P. Naik Junctional adhesion molecule-A-induced endothelial cell migration on vitronectin is integrin {alpha}v{beta}3 specific J. Cell Sci., February 1, 2006; 119(3): 490 - 499. [Abstract] [Full Text] [PDF]

				H. Chiba, T. Kojima, M. Osanai, and N. Sawada The Significance of Interferon-{gamma}-Triggered Internalization of Tight-Junction Proteins in Inflammatory Bowel Disease Sci. Signal., January 3, 2006; 2006(316): pe1 - pe1. [Abstract] [Full Text] [PDF]

				C. Lamagna, P. Meda, G. Mandicourt, J. Brown, R. J.C. Gilbert, E. Y. Jones, F. Kiefer, P. Ruga, B. A. Imhof, and M. Aurrand-Lions Dual Interaction of JAM-C with JAM-B and {alpha}M{beta}2 Integrin: Function in Junctional Complexes and Leukocyte Adhesion Mol. Biol. Cell, October 1, 2005; 16(10): 4992 - 5003. [Abstract] [Full Text] [PDF]

				M.-T. Huang, J. C. Mason, G. M. Birdsey, V. Amsellem, N. Gerwin, D. O. Haskard, A. J. Ridley, and A. M. Randi Endothelial intercellular adhesion molecule (ICAM)-2 regulates angiogenesis Blood, September 1, 2005; 106(5): 1636 - 1643. [Abstract] [Full Text] [PDF]

				A. Khandoga, J. S. Kessler, H. Meissner, M. Hanschen, M. Corada, T. Motoike, G. Enders, E. Dejana, and F. Krombach Junctional adhesion molecule-A deficiency increases hepatic ischemia-reperfusion injury despite reduction of neutrophil transendothelial migration Blood, July 15, 2005; 106(2): 725 - 733. [Abstract] [Full Text] [PDF]

				J. A. Campbell, P. Schelling, J. D. Wetzel, E. M. Johnson, J. C. Forrest, G. A. R. Wilson, M. Aurrand-Lions, B. A. Imhof, T. Stehle, and T. S. Dermody Junctional Adhesion Molecule A Serves as a Receptor for Prototype and Field-Isolate Strains of Mammalian Reovirus J. Virol., July 1, 2005; 79(13): 7967 - 7978. [Abstract] [Full Text] [PDF]

				O. M. Martinez-Estrada, L. Manzi, P. Tonetti, E. Dejana, and G. Bazzoni Opposite effects of tumor necrosis factor and soluble fibronectin on junctional adhesion molecule-A in endothelial cells Am J Physiol Lung Cell Mol Physiol, June 1, 2005; 288(6): L1081 - L1088. [Abstract] [Full Text] [PDF]

				M. Aurrand-Lions, C. Lamagna, J. P. Dangerfield, S. Wang, P. Herrera, S. Nourshargh, and B. A. Imhof Junctional Adhesion Molecule-C Regulates the Early Influx of Leukocytes into Tissues during Inflammation J. Immunol., May 15, 2005; 174(10): 6406 - 6415. [Abstract] [Full Text] [PDF]

				G. Ostermann, L. Fraemohs, T. Baltus, A. Schober, M. Lietz, A. Zernecke, E. A. Liehn, and C. Weber Involvement of JAM-A in Mononuclear Cell Recruitment on Inflamed or Atherosclerotic Endothelium: Inhibition by Soluble JAM-A Arterioscler Thromb Vasc Biol, April 1, 2005; 25(4): 729 - 735. [Abstract] [Full Text] [PDF]

				L. Fraemohs, R. R. Koenen, G. Ostermann, B. Heinemann, and C. Weber The Functional Interaction of the {beta}2 Integrin Lymphocyte Function-Associated Antigen-1 with Junctional Adhesion Molecule-A Is Mediated by the I Domain J. Immunol., November 15, 2004; 173(10): 6259 - 6264. [Abstract] [Full Text] [PDF]

				T. Vincent, R. F. Pettersson, R. G. Crystal, and P. L. Leopold Cytokine-Mediated Downregulation of Coxsackievirus-Adenovirus Receptor in Endothelial Cells J. Virol., August 1, 2004; 78(15): 8047 - 8058. [Abstract] [Full Text] [PDF]

				K. Zen, B. A. Babbin, Y. Liu, J. B. Whelan, A. Nusrat, and C. A. Parkos JAM-C Is a Component of Desmosomes and a Ligand for CD11b/CD18-mediated Neutrophil Transepithelial Migration Mol. Biol. Cell, August 1, 2004; 15(8): 3926 - 3937. [Abstract] [Full Text] [PDF]

				G. Bazzoni and E. Dejana Endothelial Cell-to-Cell Junctions: Molecular Organization and Role in Vascular Homeostasis Physiol Rev, July 1, 2004; 84(3): 869 - 901. [Abstract] [Full Text] [PDF]

				N. Reymond, A.-M. Imbert, E. Devilard, S. Fabre, C. Chabannon, L. Xerri, C. Farnarier, C. Cantoni, C. Bottino, A. Moretta, et al. DNAM-1 and PVR Regulate Monocyte Migration through Endothelial Junctions J. Exp. Med., May 17, 2004; 199(10): 1331 - 1341. [Abstract] [Full Text] [PDF]

				G. T. Mercier, J. A. Campbell, J. D. Chappell, T. Stehle, T. S. Dermody, and M. A. Barry A chimeric adenovirus vector encoding reovirus attachment protein {sigma}1 targets cells expressing junctional adhesion molecule 1 PNAS, April 20, 2004; 101(16): 6188 - 6193. [Abstract] [Full Text] [PDF]

				K. Ebnet, A. Suzuki, S. Ohno, and D. Vestweber Junctional adhesion molecules (JAMs): more molecules with dual functions? J. Cell Sci., January 1, 2004; 117(1): 19 - 29. [Abstract] [Full Text] [PDF]

				M. Bruewer, A. Luegering, T. Kucharzik, C. A. Parkos, J. L. Madara, A. M. Hopkins, and A. Nusrat Proinflammatory Cytokines Disrupt Epithelial Barrier Function by Apoptosis-Independent Mechanisms J. Immunol., December 1, 2003; 171(11): 6164 - 6172. [Abstract] [Full Text] [PDF]

				M. U. Naik, D. Vuppalanchi, and U. P. Naik Essential Role of Junctional Adhesion Molecule-1 in Basic Fibroblast Growth Factor-Induced Endothelial Cell Migration Arterioscler Thromb Vasc Biol, December 1, 2003; 23(12): 2165 - 2171. [Abstract] [Full Text] [PDF]

				J. C. Forrest, J. A. Campbell, P. Schelling, T. Stehle, and T. S. Dermody Structure-Function Analysis of Reovirus Binding to Junctional Adhesion Molecule 1: IMPLICATIONS FOR THE MECHANISM OF REOVIRUS ATTACHMENT J. Biol. Chem., November 28, 2003; 278(48): 48434 - 48444. [Abstract] [Full Text] [PDF]

				K. Ebnet, M. Aurrand-Lions, A. Kuhn, F. Kiefer, S. Butz, K. Zander, M.-K. M. z. Brickwedde, A. Suzuki, B. A. Imhof, and D. Vestweber The junctional adhesion molecule (JAM) family members JAM-2 and JAM-3 associate with the cell polarity protein PAR-3: a possible role for JAMs in endothelial cell polarity J. Cell Sci., October 1, 2003; 116(19): 3879 - 3891. [Abstract] [Full Text] [PDF]

				M. U. Naik, S. A. Mousa, C. A. Parkos, and U. P. Naik Signaling through JAM-1 and {alpha}v{beta}3 is required for the angiogenic action of bFGF: dissociation of the JAM-1 and {alpha}v{beta}3 complex Blood, September 15, 2003; 102(6): 2108 - 2114. [Abstract] [Full Text] [PDF]

				S. Hirabayashi, M. Tajima, I. Yao, W. Nishimura, H. Mori, and Y. Hata JAM4, a Junctional Cell Adhesion Molecule Interacting with a Tight Junction Protein, MAGI-1 Mol. Cell. Biol., June 15, 2003; 23(12): 4267 - 4282. [Abstract] [Full Text] [PDF]

				A. R. Burns, C. W. Smith, and D. C. Walker Unique Structural Features That Influence Neutrophil Emigration Into the Lung Physiol Rev, April 1, 2003; 83(2): 309 - 336. [Abstract] [Full Text] [PDF]

				D. J. Miller, J. J. Eckert, G. Lazzari, V. Duranthon-Richoux, J. Sreenan, D. Morris, C. Galli, J.-P. Renard, and T. P. Fleming Tight Junction Messenger RNA Expression Levels in Bovine Embryos are Dependent upon the Ability to Compact and In Vitro Culture Methods Biol Reprod, April 1, 2003; 68(4): 1394 - 1402. [Abstract] [Full Text] [PDF]

				S. S. Tay, A. McCormack, C. Lawson, and M. L. Rose IFN-{gamma} Reverses the Stop Signal Allowing Migration of Antigen-Specific T Cells into Inflammatory Sites J. Immunol., March 15, 2003; 170(6): 3315 - 3322. [Abstract] [Full Text] [PDF]

				M. K. Y. Siu, W. M. Lee, and C. Y. Cheng The Interplay of Collagen IV, Tumor Necrosis Factor-{alpha}, Gelatinase B (Matrix Metalloprotease-9), and Tissue Inhibitor of Metalloproteases-1 in the Basal Lamina Regulates Sertoli Cell-Tight Junction Dynamics in the Rat Testis Endocrinology, January 1, 2003; 144(1): 371 - 387. [Abstract] [Full Text] [PDF]

				Y. Takai and H. Nakanishi Nectin and afadin: novel organizers of intercellular junctions J. Cell Sci., January 1, 2003; 116(1): 17 - 27. [Abstract] [Full Text] [PDF]

				C. A. Johnson-Leger, M. Aurrand-Lions, N. Beltraminelli, N. Fasel, and B. A. Imhof Junctional adhesion molecule-2 (JAM-2) promotes lymphocyte transendothelial migration Blood, September 18, 2002; 100(7): 2479 - 2486. [Abstract] [Full Text] [PDF]

				S. Santoso, U. J.H. Sachs, H. Kroll, M. Linder, A. Ruf, K. T. Preissner, and T. Chavakis The Junctional Adhesion Molecule 3 (JAM-3) on Human Platelets is a Counterreceptor for the Leukocyte Integrin Mac-1 J. Exp. Med., September 2, 2002; 196(5): 679 - 691. [Abstract] [Full Text] [PDF]

				C. B. Coyne, M. K. Vanhook, T. M. Gambling, J. L. Carson, R. C. Boucher, and L. G. Johnson Regulation of Airway Tight Junctions by Proinflammatory Cytokines Mol. Biol. Cell, September 1, 2002; 13(9): 3218 - 3234. [Abstract] [Full Text] [PDF]

				S. K. Shaw, B. N. Perkins, Y.-C. Lim, Y. Liu, A. Nusrat, F. J. Schnell, C. A. Parkos, and F. W. Luscinskas Reduced Expression of Junctional Adhesion Molecule and Platelet/Endothelial Cell Adhesion Molecule-1 (CD31) at Human Vascular Endothelial Junctions by Cytokines Tumor Necrosis Factor-{alpha} Plus Interferon-{gamma} Does Not Reduce Leukocyte Transmigration Under Flow Am. J. Pathol., December 1, 2001; 159(6): 2281 - 2291. [Abstract] [Full Text] [PDF]

				M. P. Arrate, J. M. Rodriguez, T. M. Tran, T. A. Brock, and S. A. Cunningham Cloning of Human Junctional Adhesion Molecule 3 (JAM3) and Its Identification as the JAM2 Counter-receptor J. Biol. Chem., November 30, 2001; 276(49): 45826 - 45832. [Abstract] [Full Text] [PDF]

				A. Yoshioka, R. Shirakawa, H. Nishioka, A. Tabuchi, T. Higashi, H. Ozaki, A. Yamamoto, T. Kita, and H. Horiuchi Identification of Protein Kinase Calpha as an Essential, but Not Sufficient, Cytosolic Factor for Ca2+-induced alpha - and Dense-core Granule Secretion in Platelets J. Biol. Chem., October 12, 2001; 276(42): 39379 - 39385. [Abstract] [Full Text] [PDF]

				M. Itoh, H. Sasaki, M. Furuse, H. Ozaki, T. Kita, and S. Tsukita Junctional adhesion molecule (JAM) binds to PAR-3: a possible mechanism for the recruitment of PAR-3 to tight junctions J. Cell Biol., August 6, 2001; 154(3): 491 - 498. [Abstract] [Full Text] [PDF]

				U. Naik, M. Naik, K Eckfeld, P Martin-DeLeon, and J Spychala Characterization and chromosomal localization of JAM-1, a platelet receptor for a stimulatory monoclonal antibody J. Cell Sci., January 2, 2001; 114(3): 539 - 547. [Abstract] [PDF]

				T. W. Liang, R. A. DeMarco, R. J. Mrsny, A. Gurney, A. Gray, J. Hooley, H. L. Aaron, A. Huang, T. Klassen, D. B. Tumas, et al. Characterization of huJAM: evidence for involvement in cell-cell contact and tight junction regulation Am J Physiol Cell Physiol, December 1, 2000; 279(6): C1733 - C1743. [Abstract] [Full Text] [PDF]

				A. Nusrat, J. R. Turner, and J. L. Madara Molecular Physiology and Pathophysiology of Tight Junctions: IV. Regulation of tight junctions by extracellular stimuli: nutrients, cytokines, and immune cells Am J Physiol Gastrointest Liver Physiol, November 1, 2000; 279(5): G851 - G857. [Abstract] [Full Text] [PDF]

				M. B. Sobocka, T. Sobocki, P. Banerjee, C. Weiss, J. I. Rushbrook, A. J. Norin, J. Hartwig, M. O. Salifu, M. S. Markell, A. Babinska, et al. Cloning of the human platelet F11 receptor: a cell adhesion molecule member of the immunoglobulin superfamily involved in platelet aggregation Blood, April 15, 2000; 95(8): 2600 - 2609. [Abstract] [Full Text] [PDF]

				Y Liu, A Nusrat, F. Schnell, T. Reaves, S Walsh, M Pochet, and C. Parkos Human junction adhesion molecule regulates tight junction resealing in epithelia J. Cell Sci., January 7, 2000; 113(13): 2363 - 2374. [Abstract] [PDF]

				J Mankertz, S Tavalali, H Schmitz, A Mankertz, E. Riecken, M Fromm, and J. Schulzke Expression from the human occludin promoter is affected by tumor necrosis factor alpha and interferon gamma J. Cell Sci., January 6, 2000; 113(11): 2085 - 2090. [Abstract] [PDF]

				C Johnson-Leger, M Aurrand-Lions, and B. Imhof The parting of the endothelium: miracle, or simply a junctional affair? J. Cell Sci., January 3, 2000; 113(6): 921 - 933. [Abstract] [PDF]

				S. A. Cunningham, M. P. Arrate, J. M. Rodriguez, R. J. Bjercke, P. Vanderslice, A. P. Morris, and T. A. Brock A Novel Protein with Homology to the Junctional Adhesion Molecule. CHARACTERIZATION OF LEUKOCYTE INTERACTIONS J. Biol. Chem., October 27, 2000; 275(44): 34750 - 34756. [Abstract] [Full Text] [PDF]

				D. Palmeri, A. van Zante, C.-C. Huang, S. Hemmerich, and S. D. Rosen Vascular Endothelial Junction-associated Molecule, a Novel Member of the Immunoglobulin Superfamily, Is Localized to Intercellular Boundaries of Endothelial Cells J. Biol. Chem., June 16, 2000; 275(25): 19139 - 19145. [Abstract] [Full Text] [PDF]

				G. Bazzoni, O. M. Martinez-Estrada, F. Mueller, P. Nelboeck, G. Schmid, T. Bartfai, E. Dejana, and M. Brockhaus Homophilic Interaction of Junctional Adhesion Molecule J. Biol. Chem., September 29, 2000; 275(40): 30970 - 30976. [Abstract] [Full Text] [PDF]

				O. M. Martinez-Estrada, A. Villa, F. Breviario, F. Orsenigo, E. Dejana, and G. Bazzoni Association of Junctional Adhesion Molecule with Calcium/calmodulin-dependent Serine Protein Kinase (CASK/LIN-2) in Human Epithelial Caco-2 Cells J. Biol. Chem., March 16, 2001; 276(12): 9291 - 9296. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Alert me when this article is cited Alert me if a correction is posted Citation Map Services Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Ozaki, H. Articles by Kita, T. Search for Related Content PubMed PubMed Citation Articles by Ozaki, H. Articles by Kita, T.