| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Division of Gastroenterology and
Molecular Cardiovascular Research Center, Case Western Reserve University School of Medicine, Cleveland, OH 44106;
First Department of Internal Medicine, Nagoya University School of Medicine, Nagoya, Japan;
§
First Department of Surgery, Tohoku University School of Medicine, Sendai, Japan; and
¶
Department of Medicine, University of Toronto, Toronto, Canada
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
and nitric oxide.
TUNEL+ leukocytes were few in control, CD, and ulcerative
colitis (UC) mucosa, with occasional CD68+ and
myeloperoxidase+, but no CD45RO+, apoptotic
cells. Compared with control and UC, CD T cells grew remarkably more in
response to IL-2 and were significantly more resistant to IL-2
deprivation-induced apoptosis. CD T cells were also more resistant to
Fas- and nitric oxide-mediated apoptosis, whereas TNF- failed to
induce cell death in all groups. Compared with control, CD mucosa
contained similar numbers of Bcl-2+, but fewer
Bax+, cells, while UC mucosa contained fewer
Bcl-2+, but more Bax+, cells. Hence, the
Bcl-2/Bax ratio was significantly higher in CD and lower in UC. These
results indicate that CD may represent a disorder where the rate of T
cell proliferation exceeds that of cell death. Insufficient T cell
apoptosis may interfere with clonal deletion and maintenance of
tolerance, and result in inappropriate T cell accumulation contributing
to chronic inflammation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
(5), and
proliferate more in response to microbial Ags (6).
Compared with UC, mucosal tissue and cells from active CD lesions
contain increased levels of IL-2 and IL-2R mRNA (7, 8),
and CD mucosal mononuclear cells generate significantly greater levels
of IL-2-mediated cytotoxicity (9). Remission of CD has
been reported following the loss of CD4+ T cells
associated with AIDS (10), whereas symptomatic
exacerbations have been observed in patients being treated with
IL-2 (11). Together, these reports strongly suggest
that enhanced T cell activation is a key component in the pathogenesis
of CD. Abnormal T cell activation in CD has been generally viewed as an exceedingly strong response to unknown stimuli (2). This concept should be re-evaluated in light of evidence that immune activation is also regulated by apoptosis, a programmed cell suicidal process fundamental to immune homeostasis (12). Alterations in cell survival have been implicated in several human diseases, including cancer, viral infections, neurodegenerative disorders, AIDS, and autoimmune diseases (13). Defective apoptosis may contribute to autoimmune diseases (14), and an abnormal rate of lymphoid cell death has been described in chronic atopic dermatitis, congenital lymphoproliferative syndrome with autoimmunity, rheumatoid arthritis, and asthma (15, 16, 17, 18).
The intestine is normally in a state of controlled inflammation due to continuous exposure of local immune cells to dietary and microbial Ags. Because programmed cell death controls the life span of cells, a defect in apoptosis could result in an inappropriately long cell survival and a state of uncontrolled inflammation. To test the hypothesis that defective mucosal T cell apoptosis is involved in CD pathogenesis, we investigated three classes of gene products critical to regulation of T cell survival: 1) IL-2, an extrinsic survival factor; 2) the Fas receptor, a specific receptor that can directly mediate cell death; and 3) Bcl-2 family proteins, intrinsic survival gene products (19). In addition, we investigated oxidative stress as a mediator of T cell apoptosis (20). The results show that, compared with control cells, T cells from CD patients are resistant to cell death induced by IL-2 deprivation, Fas Ag ligation, and exposure to NO. These abnormalities are associated with an imbalance of Bcl-2+/Bax+ cells in the mucosa, favoring resistance to apoptosis.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Fifty-seven control patients (36 males and 21 females, ranging from 7 to 88 yr of age; 46 with colonic cancer, five with diverticular disease, four with familial polyposis, one with rectal hemangioma, and one with Hirschsprung’s disease), 41 CD patients (19 males and 22 females, ranging from 17–72 yr of age), and 47 UC patients (24 males and 23 females, ranging from 8 to 66 yr of age) were studied. Among IBD patients, 36 were receiving corticosteroids, 37 corticosteroids and aminosalycilates, seven were receiving only aminosalycilates, and 8 were receiving no specific treatment. All diagnoses were confirmed by clinical, radiological, endoscopic, and histological criteria.
Evaluation of apoptosis
Apoptotic cells were detected by in situ DNA end labeling (TUNEL method) (21) using the ApopTag Plus kit (Oncor, Gaithersburg, MD). Briefly, fixed tissue sections (0.5 x 2–3 cm) from surgically resected control and inflamed colons were deparaffinized by heating for 10 min at 70°C and rehydrated by subsequent exposures to xylene; 100, 95, and 70% ethanol; and PBS. Endogenous peroxidase was inactivated with 100% methanol containing 0.03% hydrogen peroxide for 5 min at room temperature. Sections were then treated with 20 µg/ml proteinase K (Sigma, St. Louis, MO) for 15 min at 37°C, immersed in equilibration buffer, and incubated with TdT, an enzyme that catalyzes the multiple 3'-OH ends generated by DNA fragmentation, and digoxigenin-labeled nucleotides in a humidified atmosphere at 37°C for 60 min. The reaction was terminated with stop/wash buffer, sections were incubated with anti-digoxigenin peroxidase for 30 min at room temperature, and stained with 3,3'-deaminobenzidine tetrahydrochloride (DAB). Apoptotic cells were counted in five random high power fields and expressed as the number of brown-stained nuclei or apoptotic bodies per 1000 methyl green-counterstained cells. Negative controls included sections treated with the TdT buffer solution omitting the TdT enzymes.
To identify the phenotype of the apoptotic cells a double-staining technique was employed in parallel tissue sections to allow for a direct comparison of the TUNEL method (purple color) with immunohistochemistry (brown color) for markers of lymphocytes, macrophages, and neutrophils. After the endogenous peroxidase inactivation step, sections were reacted with the mAb UCHL-1 (anti-CD45RO), PG-M1 (anti-CD68), or the polyclonal anti-myeloperoxidase Ab MPO-7 (all from Dakopatts, Glostrup, Denmark) for 12 h at 4°C and immunostained with DAB for 3–6 min at room temperature. The procedure continued with treatment by proteinase K and exposure to TdT, and thereafter cells were covered with anti-digoxigenin-alkaline phosphatase for 30 min at room temperature and stained with 5-bromo-4-chloro-3-indol phosphate/nitroblue tetrazolium chloride.
Apoptotic death of cell suspensions was monitored using a dye mix containing 100 µg/ml of acridine orange and 100 µg/ml of ethidium bromide (both from Sigma Chemical Co.) in PBS (22). The degree of apoptosis was quantified by an apoptotic index, calculated as the percentage of apoptotic cells divided by the number of total cells. In each culture at least 200 cells were counted by two observers blind to the cell source. Interobserver variation averaged 1%.
Apoptosis was also assessed by DNA fragmentation determined by agarose gel electrophoresis. DNA was prepared from T cells as described with some modification (23). In brief, T cells were washed in PBS; pelleted in Eppendorf tubes; resuspended in 500 µl of lysing buffer consisting of 10 mM EDTA, and 1x SSC, containing sodium lauryl sarkosinate and proteinase K (both from Sigma); and incubated at 50°C for 2 h. The samples were precipitated with ethanol, mixed with dye, and loaded into wells of a 1.5% (w/v) agarose gel containing 5 µg/ml of ethidium bromide in electrophoresis buffer.
Identification of Bcl-2- and Bax-expressing cells
Immunohistochemical staining for Bcl-2 and Bax was performed with an Ag retrieval system as previously reported (24). The tissues derived from normal and actively inflamed colonic mucosa of control and IBD patients, respectively. In brief, dewaxed tissue sections (0.5 x 2–3 cm) from resected inflamed colons were treated with 0.03% hydrogen peroxide in absolute methanol to inhibit peroxidase activity and then heated in a microwave in 10 mM sodium citrate buffer (pH 6.0). After blocking background staining with normal goat serum, sections were incubated overnight with a monoclonal anti-Bcl-2 Ab (1/10 dilution; Dakopatts) or polyclonal anti-Bax Ab (1/500 dilution; PharMingen, San Diego, CA) at 4°C. Color was developed using a streptavidin-biotin detection kit (Dakopatts) with diaminobenzidine as the chromogen, and sections were counterstained with methyl green or hematoxylin. Cells were counted as described for the TUNEL method. As a negative control, the primary Ab was omitted in each sample.
Establishment of T cell lines
Three endoscopic biopsies were obtained from the mucosa of randomly selected patients using the same size biopsy forceps. All biopsies from CD and UC patients were obtained from inflamed mucosa. Biopsies were rinsed and incubated in HBSS with 2.5% penicillin-streptomycin-fungizone mixture for 4–5 h at room temperature to prevent bacterial contamination. Following a previously described protocol (25), each biopsy was cut into four equal pieces, yielding 12 fragments. Each fragment was put into a 24-cluster plate well (Costar, Cambridge, MA) containing 1 ml of RPMI 1640, 20% fetal bovine serum (BioWhittaker, Walkersville, MD), penicillin-streptomycin-fungizone-gentamicin mixture, and 20 U/ml of IL-2 (Chiron, Emeryville, CA). Cultures were fed twice weekly by removing 50% of the volume and replacing it with fresh medium containing 40 U/ml of IL-2. Cell growth was invariably observed by the end of the first week of culture. At 2 wk, residual tissue fragments were removed from each culture, and all cells were pooled, counted using the trypan blue dye exclusion test, adjusted at 106 cells/ml, and transferred to a 12-well plate. Cells were fed with fresh medium and IL-2, and growth was followed at weekly intervals. At the end of each week, cell concentration was adjusted at 106 cells/ml.
Flow cytometric analysis
The cell surface markers of mucosal T cells were determined by
flow cytometry using a Becton Dickinson FACS (Mountain View, CA). The
following murine mAbs were used either as fluorescein or PE conjugates:
anti-CD3 (T cells), CD4 (Th cells), CD8 (cytotoxic T cells), CD14
(monocytes), CD19 (B cells), CD25 (IL-2R -chain), CD45RO
(leukocytes), CD28 (T cells), and CD80 (B7-1), TCR ß, TCR 
(all from Becton Dickinson Immunocytometry Systems, San Jose, CA), and
CD95 (Apo-1/Fas Ag; UB-2, Kamiya Biomedical, Tukwila, WA). The
background level of immunofluorescence was determined by incubating
cells with fluorescein or PE-conjugated mouse Ig.
Induction and modulation of apoptosis
Initial attempts to measure apoptosis of freshly isolated cells
showed that reliable evaluation was impossible due to the presence of
residual dead cells and less than optimal cell purity. Therefore,
experiments were conducted using mucosal T cell lines derived from
mucosal biopsies as detailed above, which were kept in the exponential
growth phase by feeding them with IL-2 twice a week. After 2 wk, at the
time of IL-2 supply, cells were instead washed twice to remove any
residual IL-2 and then incubated in medium alone for up to 48 h.
Under such IL-2 deprivation conditions, T cell apoptosis is readily
induced (26). In some cultures, IL-10 (R & D Systems,
Minneapolis, MN; 10 ng/ml) or CTLA-4Ig fusion protein (10 µg/ml) was
added to modulate apoptosis. In addition to IL-2 deprivation, apoptosis
was induced by anti-Fas Ab, TNF-, and NO. For Fas-mediated
apoptosis, T cells (1 x 106 cell/ml) were
plated in wells of a 48-well cluster plate and incubated with
anti-human Fas Ab (CH-11, Kamiya Biomedical) at 100 ng/ml at
37°C. After 24 h, apoptosis was evaluated by the ethidium
bromide/acridine orange-staining method described above. For TNF-–
and NO-induced apoptosis, cells (1 x 105
cell/100 µl) were plated in wells of a 96-well cluster plate and
incubated with increasing concentrations of TNF- (R & D Systems) or
the NO donor S-nitrosoglutathione (GSNO; Sigma)
(27) at 37°C. After 24 h, viability was evaluated
with the MTS assay (28) by pulsing the cells with 20 µl
of a mixture of MTS (Promega, Madison, WI) with phenazine methosulfate
(Sigma) for the last 4 h of incubation and assessing color change
at 490 nm. Cell viability was calculated according to a standard curve
and exhibited an excellent correlation with that of the ethidium
bromide/acridine orange method. Glutathione and oxidized glutathione
(both from Sigma) were used as non-NO donor controls for
GSNO.
RT-PCR
The presence of B7-1-specific message was determined by PCR of cDNA generated from RT of cellular RNA fractions. PCR reactions (50 µl final volume) were incubated in Taq polymerase buffer (Stratagene, Menasha, WI), containing 20 mM of each dNTP, 100 pmol of the indicated primers, template (cDNA synthesized from 100 ng RNA), and 5 U of Taq polymerase (Stratagene). Reactions were incubated on a thermocycler (Stratagene) for 25 cycles consisting of 30 s at 94°C, 1 min at 55°C, and 1 min at 70°C. The forward and reverse primers for B7-1 DNA amplification were CTGAAGTGACGTTATCAGTC and CTGCGGACACTGTTATACAG, respectively defining a 480-bp DNA fragment (29). PCR products were run on 1% agarose gels, transferred to nylon membranes, and probed with a 32P-labeled human B7-1 cDNA probe (provided by Dr. P. S. Linsley, Bristol-Meyers Squibb, Seattle, WA).
Analysis of data
For the patterns of mucosal T cell growth, the primary outcome
variable was the rate of change in cell count from 2 to 3 wk ((wk
3 - wk 2)/1) (25). The Wilcoxon rank sum test or
signed rank test for paired data were used to test the differences in
slopes for two groups, and the Kruskal-Wallis test was used for
multiple groups. Results of repeated measures ANOVA using the actual
cell counts for each week were consistent with the nonparametric tests,
recognizing potential violations of the assumptions of normality and
equal variance. For the time course of the number of viable or
apoptotic cells (percent viability and apoptotic index, respectively)
in the cell cultures the repeated measures ANOVA was used with SPSS for
Windows 6.1 (SPSS, Chicago, IL). This type of analysis directly
compares the variation of the chosen parameters (percent viability and
apoptotic index) over the entire length of time of each experiment. To
assess the rate of cell death in the suspensions, viable cells in
individual cultures were enumerated over the time course, and the
observations from each culture were fitted the equation
N(t) =
No exp((-)t),
where No is the number of cells suspended
at the start of the experiment, and is the death rate in
h-1 (30). For evaluation of
nonparametric data, the Mann-Whitney rank-sum test was used. For all
other statistical analysis, the paired t and Wilcoxon’s
signed-rank tests, for parametric and nonparametric data, were used,
respectively. All results were expressed as the mean ± SEM.
Statistical significance was inferred when p <
0.05.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Apoptotic cells were infrequent in the lamina propria of control,
CD, and UC tissue sections (four colonic specimens each).
TUNEL+ cells represented 1.32 ± 0.81% in
control, 0.37 ± 0.24% in CD, and 4.55 ± 1.3% in UC of the
total number of leukocytes. The number of apoptotic cells in CD mucosa
was significantly (p < 0.02) smaller than that
in UC mucosa, with no other significant differences observed. When
double staining was conducted to identify the phenotype of apoptotic
cells, they were all either CD68+ or
MPO+ (Fig. 1
,
A and B).
TUNEL+/CD68+ and
TUNEL+/MPO+ cells were more
frequent in UC sections. No apoptotic cells were identified in the
CD45RO+ population of control, CD, or UC sections
(Fig. 1C).
|
To investigate whether intestinal T cells from control, CD, and UC
mucosa had an intrinsically different capacity for growth and
expansion, mucosal biopsies from randomly selected subjects were
cultured with IL-2. Under identical culture conditions, striking
differences were noted among control, CD, and UC cells in regard to
both cell number and growth kinetics. Compared with control, biopsies
from CD mucosa generated more T cells whose growth peaked at 3 wk,
whereas T cells from UC biopsies grew less and peaked at 2 wk (Fig. 2). The number of T cells from UC was
significantly smaller than that from control and CD cells at 2, 3, and
4 wk. Because actively inflamed IBD mucosa contains more T cells than
normal mucosa, we investigated whether the observed differences
depended on the original number of cells in the biopsies or the
adjustment of cell concentration at 106/ml at 2
wk and thereafter. To do so, the slope of each growth curve (between
2–3 wk) was analyzed using the rank-sum method. This revealed that the
slopes of normal, CD, and UC T cells were significantly different
(p < 0.001), indicating that the growth of T
cells in each group varied independently of the number of T cells
originally present in the cultures and the cell concentration
adjustment performed each week. In addition, when the slopes of the
growth curves were compared using repeated measures analysis, the
overall responses of normal, CD, and UC T cells to IL-2 were still
significantly different (p < 0.001). Drug
therapy (corticosteroids or aminosalicylates) had no influence on cell
growth in IBD cultures or cell surface marker expression (see below)
.
|
The marked differences detected in regard to the growth kinetics
of control, CD and UC T cell cultures could be due to the differential
expansion of various subpopulations of mononuclear cells in response to
IL-2. To investigate this possibility, we characterized the phenotype
of T cells after 2 wk in culture using a large panel of surface Ags
(Table I). The phenotype of the T cells
was remarkably similar regardless of diagnosis. All cultures were
essentially pure T cells (CD3+) composed
predominantly by memory (CD45RO+) and helper
(CD3+ CD4+
CD8-) rather than cytotoxic
(CD3+ CD4-CD8+) cells and
were virtually free of monocytes (CD14+) and B
cells (CD19+). The number of cells expressing
activation markers (CD25 and HLA-DR) was also comparable in all
cultures. T cells expressed almost exclusively the TCRß. Finally,
all cultures contained comparably high levels of the Apo-1/Fas Ag at
similar levels of expression.
|
Because the differences observed in the growth of control, CD, and
UC T cells could not be explained by phenotypically diverse cell
populations, we studied their survival in culture by assessing
viability and the rate of apoptosis. After IL-2 was removed from the
cultures, CD T cells displayed no loss in viability for a full 24-h
period, after which a decline started (Fig. 3A). In contrast, control and
UC T cells began dying as early as 3 h and continued to do so
steadily for the remainder of the cultures. The rate of cell death in
the CD cultures ( = 0.0020 ± 0.0004
h-1) was significantly
(p < 0.01) slower than that in the control
cultures ( = 0.0034 ± 0.0003 h-1),
and also slower (p < 0.05) than that in the UC
cultures ( = 0.0034 ± 0.0005 h-1).
The time course of percent viability in CD cultures was significantly
different from that in control (p < 0.001) and
UC cultures (p < 0.001), but the time courses
of percent viability in the control and UC cultures were not different
(p = 0.89). In the same cultures the increase
in the rate of apoptotic index of CD T cells was clearly slower
compared with that in control and UC cultures (Fig. 3B).
This was confirmed by the apoptotic index of CD cells, which was
significantly smaller than that of control (p
< 0.04) and UC (p < 0.006) cells, whereas the
apoptotic indexes of control and UC cells were not different
(p = 0.735). These findings were confirmed by
DNA gel analysis. When tested after 12 h of IL-2 deprivation, DNA
from control and UC cells showed a ladder-like pattern characteristic
of apoptosis, whereas DNA of CD T cells revealed no fragmentation (Fig. 4). At the end of the cultures (48 h) the
degree of DNA fragmentation was comparable in all cultures. These
results were independent of the drugs used by the patients.
|
|
Next, we explored the possibility that the observed differences in
apoptotic rate were due to production of autocrine growth factors, such
as IL-2. When exogenous IL-2 was removed, no endogenous IL-2 was
detected by a sensitive bioassay in any of the cultures
(31). We also investigated whether control, CD, and UC T
cells differed in their ability to respond to cytokines that protect
from apoptosis, such as IL-10 (32). The addition of IL-10
had a protective effect in all cultures, but this varied among control,
CD, and particularly UC cells (Fig. 5).
When cell decay rates were calculated in the absence and the presence
of IL-10, there was a significant (p < 0.005)
effect of diagnosis; the decay rate of CD cultures ( =
0.0021 ± 0.0006 and 0.0011 ± 0.0005
h-1, respectively) was smaller than that of
either control ( = 0.0035 ± 0.006 and 0.0025 ±
0.0007 h-1) or UC ( = 0.0046 ±
0.0001 and 0.0045 ± 0.0012 h-1) cultures.
These results are consistent with the findings above (Fig. 3
A). The effect of IL-10 in slowing the rate of apoptosis
over time was significant (p < 0.001) in each
diagnostic group. Thus, the decreased apoptosis observed in CD cultures
was independent of the effect of IL-10.
|
-, and NO-induced apoptosis of mucosal T cells
To learn whether the decreased apoptosis of CD mucosal T cells was
a phenomenon only observed when essential growth factors were withdrawn
or reflected a global, trigger-independent resistance to apoptosis,
alternate mechanisms of cell death were explored. When apoptosis was
induced by ligation of the Fas Ag with the CH-11 Ab, the apoptotic
index of CD, but not UC, mucosal T cells was significantly lower
(p < 0.006) than that of control cells (Fig. 6). In contrast, ligation of the
Fas-related TNF receptor with TNF- failed to induce death of mucosal
T cells in any group regardless of the dose used (Fig. 7A). Finally, exposure to
GSNO-derived NO induced a dose-dependent loss of viability of all
mucosal T cells, but loss was significantly reduced in CD compared with
control T cells (p < 0.02), while the decrease
in UC T cell viability essentially overlapped with that in control
cells (Fig. 7B). The GSNO-related, non-NO donors glutathione
and oxidized glutathione compounds caused no cell death when used at
the same concentrations of GSNO (data not shown).
|
|
Because the mucosal T cell cultures were free of accessory cells
and endogenous IL-2, other growth stimuli could only derive from the T
cells themselves. One possibility is signaling through the
costimulatory CD28/CTLA-4:B7 pathway, which is known to be expressed on
activated T cells (33). After 2 wk in culture, control and
CD T cells expressed similar proportions of CD28+
and B7-1+ cells, as shown by flow cytometric
analysis (Table II). In contrast, both
markers were expressed by a significantly smaller number of UC than
control or CD cells. The presence of B7-1 on T cells was corroborated
by the detection of specific transcripts in RNA extracts by RT-PCR
(data not shown). To investigate whether the CD28/B7-1 costimulatory
pathway was involved in modulation of mucosal T cell apoptosis, the
CTLA-4Ig fusion protein, which inhibits the interaction of CD28 and
CTLA-4 with B7-1 and B7-2 (34), was added to the cultures
at the beginning of IL-2 deprivation. This resulted in no change in the
apoptotic index of control, CD, or UC cultures.
|
Finally, we investigated whether the resistance of CD mucosal T
cells to apoptosis could be related to some abnormality in the Bcl-2
family of proteins, whose balance is essential to cell death and
survival (35). Mucosal sections were immunohistochemically
stained for the anti-apoptotic Bcl-2 and the pro-apoptotic Bax
proteins, the number of positive cells was counted, and the ratio of
Bcl-2+/Bax+ cells was
calculated. Lamina propria mononuclear cells expressed Bcl-2, while Bax
was expressed by mononuclear and epithelial cells (Fig. 8, A–C). Both the number and
the relative proportion of Bcl-2+ and
Bax+ cells were markedly different in control,
CD, and UC mucosa (Fig. 9,
A–C). The number of Bcl-2+ cells was
similar in control and CD mucosa, but UC mucosa contained significantly
fewer Bcl-2+ cells compared with control
(p < 0.01) and CD (p
< 0.001) mucosa (Fig. 9A). Opposite results were observed
with regard to Bax. Compared with the control, the number of
Bax+ cells was significantly lower in CD
(p < 0.002) and greater in UC
(p < 0.03) mucosa; the difference between CD
and UC was statistically significant (p <
0.001; Fig. 9B). Most importantly, the Bcl-2/Bax ratio was
dramatically and significantly higher in CD compared with both control
(p < 0.002) and UC (p
< 0.001) mucosa (Fig. 9C). In contrast, this ratio was
significantly lower in UC compared with control mucosa
(p < 0.01).
|
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The detection of apoptotic cells in the gastrointestinal tract has been investigated using various techniques, varying from morphological criteria (37), labeling of fragmented nuclear DNA (21), to staining of proteins involved in the regulation of cell death (38). In contrast to these studies, which were directed at the rapidly dividing population of epithelial cells, our study was specifically designed to assess apoptosis in mucosal immune cells. Apoptotic leukocytes were rare in the lamina propria and were exclusively CD68+ and MPO+, indicating a selectivity in the type of cells locally undergoing cell death. The increased number of TUNEL+ cells in UC was largely due to dying neutrophils, a short-lived cell that is abundant in this condition. Somewhat surprising was the absence of apoptotic CD45RO+ memory T cells, even in areas actively involved by IBD. However, the same finding is noted in other tissues involved in chronic inflammation, such as the synovium in rheumatoid arthritis and muscle fibers in inflammatory myopathies (39, 40). Even in T cell-mediated animal models of IBD, such as the trinitrobenzenesulfonic acid-induced colitis in mice, apoptotic lymphocytes are virtually undetectable in actively inflamed mucosa (I. Fuss, unpublished observations). Taken together, these observations suggest that the paucity of apoptotic T cells is a characteristic of immune-mediated chronic inflammatory conditions. The paucity of apoptotic cells in vivo, however, may be deceptive, because detection of apoptotic bodies is a fleeting phenomenon and even a minute number of them indicates a substantial rate of cell turnover (41). This may explain apparent discrepancies between in vivo and in vitro results and underscores the importance of studies that bring out functional differences between normal and diseased T cells and analytical methods measuring cell death over time (30).
The composition of lymphoid cells in normal and IBD mucosa is well known. It does not consist of grossly distinct lymphocyte populations, but, rather, of equivalent proportions of T cells, T cell subsets, B cells, and macrophages (9, 42) with an increased expression of activation markers (3, 4, 8) and a predominant memory phenotype (43, 44). Thus, at the beginning of the cultures all mucosal biopsies contained similar populations of T cells and accessory cells. Furthermore, mucosal T cells were TUNEL-, as demonstrated by the in situ TdT labeling. Phenotypic analysis showed that expansion in IL-2 resulted in pure T cells, devoid of monocytes and B cells in all groups. Differences might have been detected if additional markers were studied. However, we aimed our analysis at demonstrating that possible differences in apoptosis among control, CD, and UC mucosal T cells were not due to contamination by other cell types. This homogeneity eliminates the influence of lymphocyte subsets and costimulation between different cell types that may mask the intrinsic susceptibility of mucosal T cells to apoptosis (45). Mature T cells are susceptible to activation-driven cell death (46), and growth factors such as IL-2 modulate their apoptosis (23, 26). Thus, the greater growth of CD, compared with control and UC, T cells in response to IL-2 does not simply reflect the presence but also the type of inflammation (CD vs UC), confirming our previous findings with mucosal T cells from a pediatric population of IBD patients (25). Moreover, the resistance of CD T cells to apoptosis contrasted with the equal susceptibility of control and UC cells and cannot be explained by differences in IL-2 utilization, since control and IBD lymphocytes consume comparable amounts of this cytokine (31). Resistance to IL-2 deprivation-induced apoptosis is also exhibited by rheumatoid arthritis T cells (47), leading to speculate that this defect may be a characteristic of chronic diseases in which T cells play a major pathogenic role. There is emerging evidence that removal of reactive T cells after Ag engagement is mainly due to passive death caused by growth factor deprivation (36). Loss of this feedback mechanism could lead to T cell overexpansion, particularly in the Ag-rich environment of the gut, a possibility supported by our results.
Because CD mucosal T cells displayed a defective apoptosis upon IL-2 deprivation, other modulators of programmed cell death might also induce a distinct response in this condition. To investigate this possibility, control, CD, and UC T cells were cultured with IL-10, a cytokine that promotes survival of IL-2-dependent T cells destined to die by apoptosis (32). We confirmed that IL-10 has anti-apoptotic activity, but the inhibition of mucosal T cell death varied considerably among cultures. Compared with controls, the protective effect of IL-10 was least evident in CD T cells, as expected by their low death rate. In contrast, UC T cells were most susceptible to the IL-10 protective effect even though their rate of apoptosis was similar to that of control cells.
In addition to cytokines, several other factors determine T cell
survival or death. Among them, the Fas (APO-1/CD95) and Fas ligand
system is particularly relevant to regulation of mucosal immunity
because continuous Ag stimulation renders T cells susceptible to
Fas-mediated apoptosis and induces persistent Fas ligand expression
(36, 48). Continuous Ag exposure is the norm for mucosal T
cells, and probably explains why they routinely express both Fas and
Fas ligand and display a greater degree of Fas-mediated apoptosis than
blood T cells (49, 50). Thus, the decrease in Fas-mediated
apoptosis of T cells in CD becomes especially important to
pathogenesis, because failure of this death pathway can impair both
autocrine and paracrine mechanisms for elimination of activated T cells
(51, 52). Because Fas is member of the TNF receptor family
(53), differences in TNF--mediated apoptosis could be
expected among control, CD, and UC mucosal T cells, but even at very
high concentrations TNF- failed to induced apoptosis. This is
probably due to the fact that the cells we tested were
CD4+ T cells, and TNF- only induces death of
CD8+ T cells (54).
In addition to death mediated by specific receptors, mucosal T cells can also die through nonspecific mechanisms, such as oxidative stress. This form of apoptosis is mediated by either reactive oxygen metabolites or NO (20, 55), whose levels are greatly increased in actively inflamed IBD mucosa (56, 57). Our results showing that CD T cells are significantly resistant to NO-mediated apoptosis further extends the spectrum of death-inducing agents to which CD T cells are less susceptible. This is important because it expands understanding of mechanisms of inflammation in IBD and helps differentiate CD from UC. The decreased susceptibility to apoptosis regardless of the type of death signals implies that T cells may be intrinsically resistant to cell death in CD, a phenomenon apparently not involved in UC pathogenesis.
To investigate other mechanisms contributing to the enhanced proliferation or longer survival of CD T cells, we analyzed the costimulatory CD28/CTLA-4:B7 system. CD28 is constitutively expressed on T cells, while CTLA-4 is induced after activation, and they bind to their respective counter-receptors B7-1 (CD80) and B7-2 (CD86) (58). The high growth and low apoptosis of CD mucosal T cells could be due to an enhanced B7-1 expression, but this was not so based on the results of the phenotypic analysis. In contrast, a significantly smaller number of UC cells expressed CD28 and B7-1 than control and CD T cells. Therefore, while the greater growth and survival of CD mucosal T cells could be due to defective apoptosis, the smaller growth of UC mucosal T cells could be related to limited CD28-B7 costimulation. When the inhibitory protein CTLA-4Ig was used (59), it failed to affect the degree of apoptosis in all cultures. One explanation could be that circulating and mucosal T lymphocytes are differentially regulated at the level of the CD28/CTLA-4:B7 pathway, as CTLA-4Ig does not influence TCR-mediated apoptosis (60).
The results discussed above demonstrate that all pathways of mucosal T cell apoptosis we explored are impaired in CD. The multiplicity of this defect strongly suggests that fundamental regulatory mechanisms controlling T cell death and survival are abnormal in this type of IBD. The family of Bcl-2-related proteins constitutes the most relevant class of apoptosis regulatory gene products (35). More important than the level of expression of individual anti- or pro-apoptotic proteins is the relative proportion of death antagonists to agonists, and this ratio determines how a cell will respond to an apoptotic signal (35). Immunostaining of mononuclear cells for Bcl-2-related proteins showed multiple abnormalities of both Bcl-2 and Bax in CD and UC mucosa. However, the most striking observation was that the Bcl-2/Bax ratio was remarkably increased in CD, skewing the balance in favor of cell survival. We have recently confirmed the existence of this imbalance in CD by flow cytometric studies with purified lamina propria T cells (61). These observations are consistent with similar findings in rheumatoid arthritis T cells (17, 45) and help strengthen the emerging concept that defective T cell apoptosis is a central event in immune-mediated inflammatory diseases.
Suicidal cell death is a complex series of events regulated by the intrinsic propensity of individual cells, cellular environment, cell surface molecules, type and timing of activation, growth factors, and multiple oncogene products (62). Overall, this study suggests that CD represents a disorder of T cell accumulation, in which the rate of cell proliferation exceeds that of cell death (13). Cell death is the physiological response of T cells to high Ag concentrations, and it is aimed at eliminating reactive T cells and attenuating immune reactivity (63). Nowhere in the body is the Ag concentration higher than that in the gut, where a tight control of T cell apoptosis is expected. Mucosal T cells apparently escape this regulatory mechanism in CD, extending the life span of Ag-primed T cells and retaining activated cells otherwise destined to die. This would interfere with clonal deletion and the development of tolerance (64), resulting in an exceedingly strong or prolonged immune response predisposing to chronic mucosal inflammation.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Claudio Fiocchi, Division of Gastroenterology, University Hospitals of Cleveland, Case Western Reserve University School of Medicine (BRB 425), 10900 Euclid Avenue, Cleveland, OH 44106-4952.
3 Abbreviations used in this paper: CD, Crohn’s disease; IBD, inflammatory bowel disease; UC, ulcerative colitis; GSNO, S-nitrosoglutathione.
Received for publication December 3, 1998. Accepted for publication May 6, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß T lymphocytes for apoptosis. Nature 353:858.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S Yarkoni, Y Sagiv, A Kaminitz, and N Askenasy Interleukin 2 targeted therapy in inflammatory bowel disease Gut, December 1, 2009; 58(12): 1705 - 1706. [Full Text] [PDF]
|
|
|
|
|
|
D Roggenbuck, G Hausdorf, L Martinez-Gamboa, D Reinhold, T Buttner, P R Jungblut, T Porstmann, M W Laass, J Henker, C Buning, et al. Identification of GP2, the major zymogen granule membrane glycoprotein, as the autoantigen of pancreatic antibodies in Crohn's disease Gut, December 1, 2009; 58(12): 1620 - 1628. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Weigmann and M. F Neurath Selective targeting of activated T cells in chronic intestinal inflammation Gut, June 1, 2009; 58(6): 747 - 748. [Full Text] [PDF]
|
|
|
|
|
|
S Shteingart, M Rapoport, I Grodzovski, O Sabag, M Lichtenstein, R Eavri, and H Lorberboum-Galski Therapeutic potency of IL2-caspase 3 targeted treatment in a murine experimental model of inflammatory bowel disease Gut, June 1, 2009; 58(6): 790 - 798. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F Caprioli, C Stolfi, R Caruso, D Fina, G Sica, L Biancone, F Pallone, and G Monteleone Transcriptional and post-translational regulation of Flip, an inhibitor of Fas-mediated apoptosis, in human gut inflammation Gut, December 1, 2008; 57(12): 1674 - 1680. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Caprioli, M. Sarra, R. Caruso, C. Stolfi, D. Fina, G. Sica, T. T. MacDonald, F. Pallone, and G. Monteleone Autocrine Regulation of IL-21 Production in Human T Lymphocytes J. Immunol., February 1, 2008; 180(3): 1800 - 1807. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. K. K. Tai, W. K. K. Wu, H. P. S. Wong, E. K. Y. Lam, L. Yu, and C. H. Cho A New Role for Cathelicidin in Ulcerative Colitis in Mice Experimental Biology and Medicine, June 1, 2007; 232(6): 799 - 808. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J M Watson In vivo single-photon emission computed tomography imaging of apoptosis in Crohn's disease and anti-tumour necrosis factor therapy Gut, April 1, 2007; 56(4): 461 - 463. [Full Text] [PDF]
|
|
|
|
|
|
J. M H Van den Brande, T. C Koehler, Z. Zelinkova, R. J Bennink, A. A te Velde, F. J W ten Cate, S. J H van Deventer, M. P Peppelenbosch, and D. W Hommes Prediction of antitumour necrosis factor clinical efficacy by real-time visualisation of apoptosis in patients with Crohn's disease Gut, April 1, 2007; 56(4): 509 - 517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J Mudter and M F Neurath Apoptosis of T cells and the control of inflammatory bowel disease: therapeutic implications Gut, February 1, 2007; 56(2): 293 - 303. [Full Text] [PDF]
|
|
|
|
|
|
X Han, N Benight, B Osuntokun, K Loesch, S J Frank, and L A Denson Tumour necrosis factor {alpha} blockade induces an anti-inflammatory growth hormone signalling pathway in experimental colitis Gut, January 1, 2007; 56(1): 73 - 81. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Carol, N. Borruel, M. Antolin, M. Llopis, F. Casellas, F. Guarner, and J.-R. Malagelada Modulation of apoptosis in intestinal lymphocytes by a probiotic bacteria in Crohn's disease J. Leukoc. Biol., May 1, 2006; 79(5): 917 - 922. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Sodek, A. P. Batista Da Silva, and R. Zohar Osteopontin and Mucosal Protection Journal of Dental Research, May 1, 2006; 85(5): 404 - 415. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Ina, K. Kusugami, Y. Kawano, T. Nishiwaki, Z. Wen, A. Musso, G. A. West, M. Ohta, H. Goto, and C. Fiocchi Intestinal Fibroblast-Derived IL-10 Increases Survival of Mucosal T Cells by Inhibiting Growth Factor Deprivation- and Fas-Mediated Apoptosis J. Immunol., August 1, 2005; 175(3): 2000 - 2009. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. T. MacDonald, A. DiSabatino, and J. N. Gordon Immunopathogenesis of Crohn's Disease JPEN J Parenter Enteral Nutr, July 1, 2005; 29(4_suppl): S118 - S125. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Gassull, J. Mane, E. Pedrosa, and E. Cabre Macronutrients and Bioactive Molecules: Is There a Specific Role in the Management of Inflammatory Bowel Disease? JPEN J Parenter Enteral Nutr, July 1, 2005; 29(4_suppl): S179 - S183. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Quadrilatero and L. Hoffman-Goetz N-acetyl-l-cysteine protects intestinal lymphocytes from apoptotic death after acute exercise in adrenalectomized mice Am J Physiol Regulatory Integrative Comp Physiol, June 1, 2005; 288(6): R1664 - R1672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. A. Clark, R. H. Lane, N. K. MacLennan, H. Holubec, K. Dvorakova, M. D. Halpern, C. S. Williams, C. M. Payne, and B. Dvorak Epidermal growth factor reduces intestinal apoptosis in an experimental model of necrotizing enterocolitis Am J Physiol Gastrointest Liver Physiol, April 1, 2005; 288(4): G755 - G762. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M P Peppelenbosch and S J H van Deventer T cell apoptosis and inflammatory bowel disease Gut, November 1, 2004; 53(11): 1556 - 1558. [Full Text] [PDF]
|
|
|
|
|
|
A Sturm, A Z A Leite, S Danese, K A Krivacic, G A West, S Mohr, J W Jacobberger, and C Fiocchi Divergent cell cycle kinetics underlie the distinct functional capacity of mucosal T cells in Crohn's disease and ulcerative colitis Gut, November 1, 2004; 53(11): 1624 - 1631. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J Doering, B Begue, M J Lentze, F Rieux-Laucat, O Goulet, J Schmitz, N Cerf-Bensussan, and F M Ruemmele Induction of T lymphocyte apoptosis by sulphasalazine in patients with Crohn's disease Gut, November 1, 2004; 53(11): 1632 - 1638. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Sturm, M. Lensch, S. Andre, H. Kaltner, B. Wiedenmann, S. Rosewicz, A. U. Dignass, and H.-J. Gabius Human Galectin-2: Novel Inducer of T Cell Apoptosis with Distinct Profile of Caspase Activation J. Immunol., September 15, 2004; 173(6): 3825 - 3837. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S Zeissig, C Bojarski, N Buergel, J Mankertz, M Zeitz, M Fromm, and J D Schulzke Downregulation of epithelial apoptosis and barrier repair in active Crohn's disease by tumour necrosis factor {alpha} antibody treatment Gut, September 1, 2004; 53(9): 1295 - 1302. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. ten Hove, F. O. The, M. Berkhout, J. P. Bruggeman, F. A. Vyth-Dreese, J. F. M. Slors, S. J. H. van Deventer, and A. A. te Velde Expression of CD45RB functionally distinguishes intestinal T lymphocytes in inflammatory bowel disease J. Leukoc. Biol., June 1, 2004; 75(6): 1010 - 1015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. E. Schade and A. D. Levine Cutting Edge: Extracellular Signal-Regulated Kinases 1/2 Function as Integrators of TCR Signal Strength J. Immunol., May 15, 2004; 172(10): 5828 - 5832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Stallmach, T Marth, B Weiss, B M Wittig, A Hombach, C Schmidt, M Neurath, M Zeitz, S Zeuzem, and H Abken An interleukin 12 p40-IgG2b fusion protein abrogates T cell mediated inflammation: anti-inflammatory activity in Crohn's disease and experimental colitis in vivo Gut, March 1, 2004; 53(3): 339 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Schwarz, E. Tutsch, B. Ludwig, E. C. Schwarz, A. Stallmach, and M. Hoth Ca2+ Signaling in Identified T-lymphocytes from Human Intestinal Mucosa: RELATION TO HYPOREACTIVITY, PROLIFERATION, AND INFLAMMATORY BOWEL DISEASE J. Biol. Chem., February 13, 2004; 279(7): 5641 - 5647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Lu, M. S. Caplan, A. P. Saraf, D. Li, L. Adler, X. Liu, and T. Jilling Platelet-activating factor-induced apoptosis is blocked by Bcl-2 in rat intestinal epithelial cells Am J Physiol Gastrointest Liver Physiol, February 1, 2004; 286(2): G340 - G350. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Di Sabatino, R Ciccocioppo, B Cinque, D Millimaggi, R Morera, L Ricevuti, M G Cifone, and G R Corazza Defective mucosal T cell death is sustainably reverted by infliximab in a caspase dependent pathway in Crohn's disease Gut, January 1, 2004; 53(1): 70 - 77. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Marini, G. Bamias, J. Rivera-Nieves, C. A. Moskaluk, S. B. Hoang, W. G. Ross, T. T. Pizarro, and F. Cominelli TNF-{alpha}neutralization ameliorates the severity of murine Crohn's-like ileitis by abrogation of intestinal epithelial cell apoptosis PNAS, July 8, 2003; 100(14): 8366 - 8371. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N Borruel, M Carol, F Casellas, M Antolin, F de Lara, E Espin, J Naval, F Guarner, and J R Malagelada Increased mucosal tumour necrosis factor {alpha} production in Crohn's disease can be downregulated ex vivo by probiotic bacteria Gut, November 1, 2002; 51(5): 659 - 664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S J H van Deventer Anti-tumour necrosis factor therapy in Crohn's disease: where are we now? Gut, September 1, 2002; 51(3): 362 - 363. [Full Text]
|
|
|
|
|
|
I Monteleone, P Vavassori, L Biancone, G Monteleone, and F Pallone Immunoregulation in the gut: success and failures in human disease Gut, May 1, 2002; 50(90003): iii60 - 64. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A Sturm and C Fiocchi Life and death in the gut: more killing, less Crohn's Gut, February 1, 2002; 50(2): 148 - 149. [Full Text] [PDF]
|
|
|
|
|
|
T ten Hove, C van Montfrans, M P Peppelenbosch, and S J H van Deventer Infliximab treatment induces apoptosis of lamina propria T lymphocytes in Crohn's disease Gut, February 1, 2002; 50(2): 206 - 211. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A DI SABATINO and G R CORAZZA Surviving too long in Crohn's disease Gut, July 1, 2001; 49(1): 6 - 8. [Full Text] [PDF]
|
|
|
|
|
|
J Itoh, C de la Motte, S A Strong, A D Levine, and C Fiocchi Decreased Bax expression by mucosal T cells favours resistance to apoptosis in Crohn's disease Gut, July 1, 2001; 49(1): 35 - 41. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Bu, A. Keshavarzian, D. D. Stone, J. Liu, P. T. Le, S. Fisher, and L. Qiao Apoptosis: One of the Mechanisms That Maintains Unresponsiveness of the Intestinal Mucosal Immune System J. Immunol., May 15, 2001; 166(10): 6399 - 6403. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P DESREUMAUX Specific targeting of IL-6 signalling pathway: a new way to treat IBD? Gut, October 1, 2000; 47(4): 465 - 466. [Full Text] [PDF]
|
|
|
|
|
|
M. J. Pinkoski, T. Brunner, D. R. Green, and T. Lin Fas and Fas ligand in gut and liver Am J Physiol Gastrointest Liver Physiol, March 1, 2000; 278(3): G354 - G366. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
