| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,§,¶
Departments of
*
Pediatrics,
Biological Sciences,
Pathology, and
§
Microbiology and the
¶
Interdisciplinary Program in Immunology, University of Iowa, Iowa City, IA 52242; and
||
Departments of Neurology and Molecular Microbiology and Immunology, University of Southern California School of Medicine, Los Angeles, CA 90033
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Infectious virus can be isolated from MHV-infected mice with chronic demyelination under some experimental conditions (7, 8, 9). Using one such model, we showed previously that the RNA sequence-encoding epitope S-510-518 was mutated in nearly all samples of both infectious virus and total viral RNA harvested from brains and spinal cords of infected mice with chronic demyelination (10). However, no mutations were detected in epitope S-598-605 nor in the regions flanking the T cell epitopes. Mutations in epitope S-510-518 were evident by 10–12 days postinoculation (p.i.), and their presence resulted in significant loss of recognition by CNS-derived CTL in direct ex vivo cytotoxicity assays (10, 11). In addition, infection of naive mice with these CTL escape mutants resulted in decreased virus clearance and increased mortality and morbidity (12).
CTL escape mutants have been detected in several infections of humans and experimental animals, but their selection is not a common phenomenon (1, 13, 14). In the situations in which CTL escape mutants appear to be important (15, 16), the immune response is strongly focused on a single epitope. It has been suggested that CTL escape mutants are selected only in the presence of a monospecific CD8 T cell response characterized by limited TCR diversity (13).
Direct ex vivo analysis of the TCR diversity of Ag-specific T cells has
been facilitated by the recent development of MHC/peptide tetramers
able to differentiate CD8 T cells with differing specificities
(17). Using these reagents, it is possible to determine
directly clonality within the infected CNS. The clonality of the
response is often assessed by analysis of the
complementarity-determining region 3 (CDR3) of the TCR. The TCR is a
heterodimer consisting of an 
- and ß-chain. The great diversity in
the T cell response results from the large number of different V, D,
and J elements in the germline coupled with imprecise joining at the
V-D and D-J junctions (ß-chain) or V-J junction (-chain)
(18). These junctional regions are encompassed by the CDR3
of the - and ß-chains and make direct contact with the MHC/peptide
complex (19). Both the length and sequence of this region
are important in Ag specificity.
In recent analyses of several infections, it has been shown that TCR repertoire diversity is similar during the primary response and in the memory pool (20, 21, 22). This response is usually polyclonal, although there is often striking preferential usage of specific Vß and Jß elements and conservation of length of the CDR3. Furthermore, even relatively small phenotypic and functional changes during secondary responses may result in increased specificity and avidity (22, 23, 24).
CD8 T cells are expanded within a few days of infection with MHV-JHM and are continuously exposed to Ag until clinical disease develops. CTL escape mutants are isolated from MHV-JHM-infected mice several weeks after initial exposure to virus, with wild-type sequence encoding this epitope only rarely detected in mice with chronic demyelination (10). The influence of increasing viral Ag, albeit with mutations abrogating T cell recognition, provides a unique model to study alterations in the TCR repertoire, as stimulation of epitope S-510-518-specific T cells is expected to diminish with the loss of the wild-type epitope sequence. Therefore, this model of chronic demyelination associated with persisting infectious virus was used to analyze changes in TCR expression during progressive disease.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
MHV-seronegative C57BL/6 mice were purchased from The Jackson Laboratory (Bar Harbor, ME) and the National Cancer Institute (Bethesda, MD). To obtain animals with acute encephalitis, 6-wk-old mice were inoculated intranasally with 4 x 104 PFU MHV-JHM. The strain of MHV-JHM used in these studies is highly virulent, and infection of naive C57BL/6 mice with this virus results in a uniformly fatal acute encephalomyelitis. Mice were sacrificed when moribund (6–7 days p.i.). To obtain mice with chronic demyelination, suckling mice were inoculated intranasally with 4 x 104 PFU MHV-JHM and nursed by dams previously immunized with live MHV-JHM as previously described (7). Mice were sacrificed when they developed hind limb paralysis, at times p.i. indicated in the figures and tables.
Viruses
MHV-JHM was grown and titered as previously described (7). A CTL escape mutant (mutated in residue 514 [Asp to Ser] of the S glycoprotein) was isolated and propagated as previously described (12).
Abs
Ab to the Fc receptor (2.4G2), Cy5-conjugated Abs to CD4 (GK1.5), IgM (B76) and Mac-1 (M1/70), and FITC-conjugated anti-CD8 Ab (Lyt-2) were obtained as described previously (25). Biotinylated monoclonal anti-mouse Vß TCR Abs (Vß2, clone B20.6; Vß3, KJ25; Vß4, KT4; Vß5.1, 5.2, MR9-4; Vß6, RR4-7; Vß7 TR310; Vß8.1, 8.2, MR5–2; Vß9, R10-2; Vß10b, B21.5; Vß11, RR3-15; Vß12, MR11-1; Vß13, MR12-3; Vß14, 14-2) were all purchased from PharMingen (San Diego, CA).
Isolation of lymphocytes from the MHV-infected CNS
Lymphocytes were isolated from the infected CNS as previously described (26). In brief, mice were perfused with PBS, and the brains and spinal cords were removed. Tissue was ground between frosted glass slides and triturated by vigorous pipetting in 5 ml of RPMI 1640 medium with 10% FCS. Following thorough tissue dispersion, Percoll (Pharmacia, Uppsala, Sweden) was added to a final concentration of 30%. The lysate was centrifuged at 1300 x g for 30 min at 4°C. The Percoll and lipid layers were aspirated and the cell pellet was washed and resuspended in 5 ml RPMI 1640 medium with 10% FCS. The cells were layered over 2 ml Lympholyte-M (Cedarlane Laboratories, Homby, Ontario, Canada) and centrifuged at 1300 x g for 20 min at room temperature. Cells were removed from the interface, washed, and counted.
Tetramers
Biotinylated MHC class I (H-2Db) monomers complexed with peptide S-510-518 were produced as described previously (27). Biotinylated monomers were tetramerized with avidin-PE (Vector Laboratories, Burlingame, CA).
FACS analysis
The TCR phenotypes of CD8 T lymphocytes from brains infected with MHV-JHM were determined by four-color FACS analysis. Briefly, 100–300,000 cells were first incubated with Ab to the Fc receptor (mAb 2.4G2) in rat serum. This was followed by triple staining with a mixture of Cy5-conjugated Abs to CD4 (GK1.5), IgM (B76) and Mac-1 (M1/70), FITC-conjugated anti-CD8 Ab (Lyt-2), and PE-conjugated S-510-518-specific MHC class I tetramers (tetramer S-510). After extensive washing, cells were incubated with biotinylated monoclonal anti-mouse Vß TCR Abs and were then incubated with Texas red-conjugated streptavidin. Cells were analyzed with an EPICS 753 (Beckman Coulter, Fullerton, CA).
For analysis of sorted cells, cells from the CNS of a single animal were stained as above with the Cy5-conjugated Ab mixture, FITC-conjugated anti-CD8 Ab, and PE-conjugated tetramer S-510. Tetramer S-510-positive CD8 T cells were sorted on an EPICS 753. A total of 4,000–20,000 tetramer S-510-positive CD8 T cells were obtained after sorting.
Isolation of RNA from lymphocytes.
RNA was isolated from lymphocytes using an RNeasy Mini Kit (Qiagen, Valencia, CA) according to the specifications of the manufacturer.
Sequence analysis
In all cases, cDNA was synthesized from 2 µg lymphocyte RNA as previously described (10). For the synthesis of Vß13-specific cDNA clones, a Vß13-specific primer (CCTAAAGGAACTAACTCCACTCT) was used in conjunction with a common Cß reverse primer (GCAATCTCTGCTTTTGATGGCTC) to prepare PCR products. The primers contained GCG clamps and restriction sites (Cß primer, EcoRI site; Vß primer, BamHI site) to facilitate cloning of PCR products into pIBI31 (IBI, New Haven, CT). DNA was prepared from cDNA clones using QIAprep Spin Miniprep Kits (Qiagen) or CONCERT Rapid Plasmid Miniprep Systems (Life Technologies, Gaithersburg, MD). Clones were sequenced using an automated sequencer (ABI 373A Stretch Sequencer; Applied Biosystems, Foster City, CA) with T7 (TAATACGACTCACTATAGGG) and T3 (CTGTAATTAACCCTCACTAAAG) promoter primers.
Estimate of repertoire size
A logarithmic distribution has the form
si =
xi/i (28, 29, 30, 31),
where si is the number of CDR3 expected to
be represented i times, is an index of clonal diversity,
and x is a parameter related to the sample size (number of
cDNA clones sequenced). This distribution is often used to describe
data in which there are a few abundant species and many rare species
(29, 31). In our analyses, a logarithmic series is
characterized by two parameters: S, the total number of
different CDR3 species present in the Vß13 tetramer S-510-positive
CD8 T cell population, and N, the total number of Vß13
tetramer S-510-positive CD8 T cells in the infected CNS. These two are
related by a constant, , which is a measure of diversity
of CDR3 usage: S = ln (1 +
N/). The value of is high if the number of
different CDR3 is high relative to the number of individuals and low if
the number of different CDR3 is low. Logarithmic distributions were fit
to our data using a computer program written in QuickBASIC (version
4.5; Microsoft, Redmond, WA). For each mouse, the goodness-of-fit of
the estimated logarithmic distribution to the data was assessed using a
G test of independence with Williams’ correction (32),
using observed and expected counts for five frequency classes
(sequences represented once, 2–3 times, 4–7 times, 8–15 times, and
16 or more times). SEs for our estimates were obtained following
Krebs (30).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In mice infected i.p. with MHV-JHM, splenocytes expressing a diverse group of Vß elements recognize epitope S-510-518. Sequence analysis of ß-chain CDR3 revealed a polyclonal response (25). These results suggested that CTL escape mutants were selected in the presence of a polyclonal CD8 T cell response. However, as the CNS is the site of infection in mice with disease caused by MHV-JHM, CTL escape mutants likely arise from immune pressure in the CNS and not periphery. Therefore, the polyclonality of CD8 T cells in the CNS was investigated to confirm the broad TCR spectrum observed in peripheral organs.
Soluble MHC class I/peptide S-510-518 tetramers were constructed as
previously described (17) and used to stain lymphocytes
isolated from the CNS of mice with acute encephalitis. Negative
controls included CD8 T cell lines not responsive to epitope S-510-518
and splenocytes from uninfected mice. As a positive control, a CD8 T
cell line recognizing epitope S-510-518 was analyzed. As shown in Fig. 1
A, tetramer S-510 bound
specifically to the epitope S-510-518-specific CD8 T cell line but did
not stain cells harvested from a CD8 T cell line recognizing epitope
S-598-605. Tetramer S-510 bound to 42% (range, 29–60%;
n = 7 groups of three to six mice each) of the CD8 T
cell population from mice with acute encephalitis. Staining was
specific because the reagent did not stain naive splenocytes (Fig. 1C) or CD8 T cells harvested from the CNS of a mouse
infected with a variant expressing a mutation in epitope S-510-518
(CSLWSGPHL) (Fig. 1D). The fraction of CD8 T
cells recognizing epitope S-510-518 in the infected CNS is remarkably
elevated, but consistent with results obtained from analyses of several
human and experimental infections (27, 33, 34).
|
, and the
results are summarized in Table I. TCR
Vß usage by tetramer S-510-positive T cells was very diverse with a
distribution that differed from that found in the tetramer
S-510-negative population and in the naive spleen. Epitope
S-510-518-specific CD8 T cells expressing the Vß13 element were over
represented when compared with TCR usage by naive spleen cells although
both tetramer S-510-positive and tetramer S-510-negative cells
preferentially expressed this element (Fig. 2). As also shown in Fig. 2, cells expressing the Vß8 element were preferentially expressed in
the tetramer S-510-positive population whereas Vß5 expression was
over represented in the tetramer S-510-negative population. These
results are similar to what was observed in previous analyses of
epitope S-510-518-specific splenocytes harvested from mice after i.p.
infection (25).
|
|
).
Sequence analysis of the TCR Vß13-expressing cells from three mice
showed a polyclonal response with diverse Jß usage, although there
was preferential expression of the TCR Jß2 family members. Extensive
variation in CDR3 length was also apparent. The results obtained from
the analysis of 80 cDNA clones derived from a single mouse with acute
encephalitis are shown in Table II.
Twenty-two different CDR3 were detected with 12 identified only in
single clones. Nine different Jß elements were encoded in these cDNA
clones, and CDR3 length varied from 6 to 10 aa. Six of these CDR3 were
also detected in at least one other mouse with acute encephalitis
(Table II). The abundance data from all three mice are summarized in
Table III. In one mouse (acute 3), a
single clonotype comprised 50% of all of the epitope
S-510-518-specific clones, but the remainder of the clones were very
heterogeneous.
|
|
In persistent infections caused by lymphocytic choriomeningitis virus, HIV-1, and EBV, the T cell repertoire is characterized by continuous selection, deletion of Ag-specific T cells, and loss of effector function (21, 35, 36, 37, 38). Next, we determined whether changes in the diversity of the epitope S-510-518-specific TCR repertoire occurred in mice with chronic demyelination.
In the model used in this study, suckling mice were inoculated
intranasally with MHV-JHM, and acute encephalitis was prevented by
nursing by dams previously immunized with virus. A variable percentage
(30–90%) later developed hind limb paralysis. Histological evidence
of inflammatory cell infiltration and demyelination was detected in all
mice with hind limb paralysis but not in mice that remained
asymptomatic (7). Little or no wild-type epitope S-510-518
was detected by the time mice develop hind limb paralysis, and the vast
majority of the virus are CTL escape mutants (10).
However, although the total number of CNS-derived CD8 T cells was
decreased compared with the acute infection, epitope S-510-518-specific
CD8 T cells, detected with tetramer S-510, comprised a significant
proportion in the CNS of mice with hind limb paralysis (34% (range,
18–62%; n = 7 mice)) (Fig. 1E). These
cells recognize the epitope in cytotoxicity assays and secrete IFN-
in response to peptide S-510-518 (data not shown).
Because, in general, only single animals with chronic demyelination
were available at a time, it was not possible to obtain pools of
CNS-derived lymphocytes for flow cytometric analysis of Vß usage.
Rather, we measured the diversity of TCR Vß13 tetramer S-510-positive
CD8 T cells in six mice with chronic demyelination because TCR
Vß13-expressing cells were over-represented in the population of CD8
T cells responding to epitope S-510-518, as in the acutely infected
mice. The data, summarized in Table IV,
revealed a diverse TCR response, although there was greater variability
in the number of clones responding to the epitope than in mice with
acute encephalitis. At present, we cannot correlate this difference in
diversity with any difference in clinical outcome. As in the mice with
acute encephalitis, multiple Jß elements were expressed in the
tetramer S-510-positive T cell population and CDR3 length was
variable.
|
The distribution of spleen-derived Vß13 CD8 T cell cDNA clones
responding to epitope S-510-518 was shown empirically to fit a
logarithmic distribution (25). A value of (a measure
of CDR3 diversity) was calculated for Vß13 tetramer S-510-positive
CD8 T cells for each acutely or chronically animal, as described in
Materials and Methods (Table V). The distributions of observed and
expected abundance of CNS-derived TCR Vß13 cDNA clones for
representative animals are shown in Fig. 3. The logarithmic distribution in each
case underestimated the number of unique sequences and the number of
very common sequences in the CNS, although only in the case of acute
mice 2 and 3 was the difference statistically significant (Table V).
However, analyses based on subsampling our observed distributions
suggest that errors arising from lack of fit to the logarithmic
distribution will be small compared with those arising from sampling
uncertainty (data not shown).
|
|
40,000 Vß13 tetramer S-510-positive CD8 T cells per acutely
infected CNS (1.5 x 106
lymphocytes/infected CNS x 28% CD8 x 42% tetramer
S-510-positive x 23% Vß13) and 6,600 per chronically infected
CNS (5.3 x 105 lymphocytes/infected
CNS x 18% CD8 x 34% tetramer S-510-positive x 20%
Vß13). Using our estimates of (and their SEs), we calculated that
epitope S-510-518 is recognized by a minimum of 73–102 Vß13 CD8 T
cells expressing different TCR ß rearrangements in mice with acute
encephalitis and 18–161 Vß13 CD8 T cells in mice with chronic
demyelination (Table V). To simplify comparison between different
animals, a column showing the number of different cells expressing each
TCR Vß element per 10,000 CD8 T cells is also included in Table V.
From the data in Table V, the total number of different CD8 T
clonotypes responding to epitope S-510-518 can be approximately
calculated. This calculation assumes that the same diversity is present
within each Vß subrepertoire. If CD8 T cells expressing 73–102
different Vß13-positive TCR respond to this epitope and these cells
represent 23% of the total CD8 T cell population (Table I),
300–500 epitope S-510-518-specific cells expressing different
ß-chains are present per mouse with acute encephalitis. In mice with
chronic demyelination, 100–900 different clonotypes recognize
epitope S-510-518. This number is likely to be an underestimate for the
reasons stated above and also because it does not include the
contribution of the TCR -chain to diversity.
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Our results also show that this polyclonality is maintained in mice
with hind limb paralysis, even as the relative abundance of wild-type
epitope S-510-518 diminishes. Similar numbers of clonotypes/10,000
epitope S-510-518-specific CD8 T cells were detected in mice with acute
encephalitis and in those with chronic demyelination (Table V).
However, the total numbers of epitope-specific CD8 T cell clonotypes
were lower in the chronically infected mice, because fewer CD8 T cells
were present in the CNS when compared with mice with acute encephalitis
(Table V). Substantial variation was detected in the size of the TCR
repertoire in the chronically infected mice (Tables IV and V). The
explanation for this variability in repertoire diversity is not clear.
However, it could reflect, in part, intra-animal variability in the
naive repertoire or in the kinetics of maturation of the immune
response. Alternatively, because no information is available about the
specific mutation in epitope S-510-518 selected in each chronically
infected mouse, it is possible that different mutations in the epitope
have a variable effect on the TCR repertoire.
Common clonotypes were detected in mice with acute encephalitis and in those with chronic demyelination with only a few CDR3 sequences not detected in more than one mouse in the latter group (Tables III and IV). With rare exceptions, most of the sequences detected in only a single animal were present at low abundance. These numbers underestimate the amount of overlap between individual mice, because the probability of detecting a certain CDR3 in each mouse would increase if more cDNA clones were sequenced. These results suggest that the TCR repertoire is fairly stable and that T cell clonal deletion does not occur during MHV persistence. Comparison of Tables III and IV suggests that there is narrowing of the TCR repertoire because fewer clones present in only one animal were detected in the chronic samples. Narrowing of the TCR repertoire has been reported previously and shown to be associated with an increase in TCR avidity (20, 23, 24).
The continued presence of epitope S-510-518-specific CD8 T cells in the absence of wild-type epitope was not predictable. Persistence of CTLs in the apparent absence of any nonmutated target epitope has also been documented in chimpanzees infected with hepatitis C (40). Continued detection of epitope-specific CD8 T cells may reflect stimulation by mutated epitope S-510-518. Although this may seem unlikely because most of the common mutations detected in previous studies (11) abrogate or greatly diminish cytolysis by epitope S-510-518-specific CD8 T cells, engagement of TCRs may still be sufficient to elicit other T cell effector function. These cells would then be present in the CNS at times when wild-type epitope has disappeared. Alternatively, although viral RNA encoding wild-type epitope may not be detected in the chronically infected CNS, viral protein expressing this sequence may still be present and able to stimulate epitope S-510-518-specific CD8 T cells. Prolonged retention of Ag within the CNS has been suggested in other studies (41). It is also possible that virus-encoding wild-type sequence persists in the infected CNS at levels below the sensitivity of our assays but sufficient for stimulation of epitope S-510-518-specific CTLs.
The diversity of the T cell response reflects both the number of
different T cell clones and relative abundance of each clone. Because
it is not possible to sequence the and ß CDR3 for every
Ag-specific CD8 T cell clone in a given responding population,
alternative methods to measure the diversity of the TCR response have
been developed. In one method that is commonly used, spectratyping, the
repertoire of T cell clones expressing each Vß element (21 different
TCR Vß elements are expressed in the mouse) is analyzed separately
(42). Using reverse transcription PCR, Jß usage and/or
CDR3 length profiles are determined for T cell populations expressing
each Vß or Vß-Jß subrepertoire. The profile of Vß and Jß
usage as well as length of the CDR3 are skewed in the CD8 T cell
response to many pathogens when compared with similar measurements made
on naive populations of CD8 T cells (21, 22).
Spectratyping tends to focus on the most abundant components of the T
cell response and less so on its diversity.
In this report, a direct sequencing method was used to measure TCR
diversity. We sequenced the CDR3 from 35 to 86 tetramer S-510-positive
CD8 T cell cDNA clones per mouse. This type of analysis has been used
previously (43, 44). It provides information about both
the diversity and abundance of the T cell clones responding to this Ag
and complements analyses using spectratyping (21, 22, 42).
In a preliminary set of analyses using Vß13 T cell clones from mouse
acute 1, we found that the values for , the index of diversity, did
not change significantly as the number of cDNA clones analyzed
increased from 40 to 80. Consequently, we sequenced a reduced number of
clones in subsequent samples.
Naumov et al. (44), using methodology similar to ours,
analyzed 294 Vß17 TCR CD8 T cell cDNA clones harvested from the
peripheral blood of a human responding to an epitope within the matrix
(M1) protein of influenza A (M-58-66). Within these 294 clones, 95
different sequences were identified with 61 detected only once. When
these data were fitted to a logarithmic series, an value of 49.62
( is the index of diversity) was calculated. These data, like the
data that we obtained from samples acute 2 and acute 3 (Fig. 3),
differed significantly from a logarithmic distribution in having more
clones than expected detected only once. With this caveat, we used this
value of to estimate that 264 different sequences would be expected
(95% confidence interval, 218–306) per 10,000 Vß17 CD8 T cell
clones present in this population. This is higher than the equivalent
number calculated for the Vß13 CD8 T cell population in the
MHV-infected CNS. However, most of the CD8 T cells responding to
epitope M-58-66 express the Vß17 element (45), whereas
only a minority of the MHV-specific CD8 T cells express any single TCR
Vß gene segment. This suggests that the total numbers of T cell
clonotypes responding to the two epitopes are similar.
In recent reports, the number of precursor CD8 T cells responsive to a single epitope was calculated to be 600 (46) or 3000 (47). From these calculations, it was not possible to determine how many of these clones contained unique CDR3. Our calculations, based on the number of different Vß13 CD8 T cell clonotypes present in the CNS of infected mice, suggest that the number of different epitope S-510-518-specific T cell clonotypes is as high as 900 although this number is likely to underestimate the true diversity for the reasons described above.
Determination of the diversity of the CD8 T cell response is important in understanding the T cell response to specific Ags, including those present in vaccines. Direct sequencing of cDNA clones is most useful for evaluating the number of different T cell clones responding to an Ag and complements analyses that focus on the most abundant T cell clones in the immune response.
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Stanley Perlman, Department of Pediatrics, University of Iowa, Medical Laboratories 2042, Iowa City, IA 52242. E-mail address:
3 Abbreviations used in this paper: MHV, mouse hepatitis virus; MHV-JHM, mouse hepatitis virus, strain JHM; CDR3, complementarity-determining region 3; S, surface glycoprotein; p.i. postinoculation.
Received for publication July 16, 1999. Accepted for publication September 13, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
ß T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274:209.This article has been cited by other articles:
|
|
 |
|
  K. C. MacNamara, S. J. Bender, M. M. Chua, R. Watson, and S. R. Weiss Priming of CD8+ T Cells during Central Nervous System Infection with a Murine Coronavirus Is Strain Dependent J. Virol., July 1, 2008; 82(13): 6150 - 6160. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. S. Butler, A. Theodossis, A. I. Webb, M. A. Dunstone, R. Nastovska, S. H. Ramarathinam, J. Rossjohn, A. W. Purcell, and S. Perlman Structural and Biological Basis of CTL Escape in Coronavirus-Infected Mice J. Immunol., March 15, 2008; 180(6): 3926 - 3937. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kedzierska, E. B. Day, J. Pi, S. B. Heard, P. C. Doherty, S. J. Turner, and S. Perlman Quantification of Repertoire Diversity of Influenza-Specific Epitopes with Predominant Public or Private TCR Usage J. Immunol., November 15, 2006; 177(10): 6705 - 6712. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. N. Naumov, E. N. Naumova, S. C. Clute, L. B. Watkin, K. Kota, J. Gorski, and L. K. Selin Complex T Cell Memory Repertoires Participate in Recall Responses at Extremes of Antigenic Load J. Immunol., August 1, 2006; 177(3): 2006 - 2014. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. T. Iacono, L. Kazi, and S. R. Weiss Both Spike and Background Genes Contribute to Murine Coronavirus Neurovirulence J. Virol., July 15, 2006; 80(14): 6834 - 6843. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Anghelina, L. Pewe, and S. Perlman Pathogenic Role for Virus-Specific CD4 T Cells in Mice with Coronavirus-Induced Acute Encephalitis Am. J. Pathol., July 1, 2006; 169(1): 209 - 222. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pewe, H. Zhou, J. Netland, C. Tangudu, H. Olivares, L. Shi, D. Look, T. Gallagher, and S. Perlman A Severe Acute Respiratory Syndrome-Associated Coronavirus-Specific Protein Enhances Virulence of an Attenuated Murine Coronavirus J. Virol., September 1, 2005; 79(17): 11335 - 11342. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. C. MacNamara, M. M. Chua, P. T. Nelson, H. Shen, and S. R. Weiss Increased Epitope-Specific CD8+ T Cells Prevent Murine Coronavirus Spread to the Spinal Cord and Subsequent Demyelination J. Virol., March 15, 2005; 79(6): 3370 - 3381. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. L. Pewe, J. M. Netland, S. B. Heard, and S. Perlman Very Diverse CD8 T Cell Clonotypic Responses after Virus Infections J. Immunol., March 1, 2004; 172(5): 3151 - 3156. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Dandekar, D. Anghelina, and S. Perlman Bystander CD8 T-Cell-Mediated Demyelination is Interferon-{gamma}-Dependent in a Coronavirus Model of Multiple Sclerosis Am. J. Pathol., February 1, 2004; 164(2): 363 - 369. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. A. Dandekar and S. Perlman Virus-Induced Demyelination in Nude Mice Is Mediated by {gamma}{delta} T Cells Am. J. Pathol., October 1, 2002; 161(4): 1255 - 1263. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Haring, L. L. Pewe, and S. Perlman Bystander CD8 T Cell-Mediated Demyelination After Viral Infection of the Central Nervous System J. Immunol., August 1, 2002; 169(3): 1550 - 1555. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Pewe and S. Perlman Cutting Edge: CD8 T Cell-Mediated Demyelination Is IFN-{gamma} Dependent in Mice Infected with a Neurotropic Coronavirus J. Immunol., February 15, 2002; 168(4): 1547 - 1551. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Y. Choi, Y. Yoshimura, G. J. Christianson, T. J. Sproule, S. Malarkannan, N. Shastri, S. Joyce, and D. C. Roopenian Quantitative Analysis of the Immune Response to Mouse Non-MHC Transplantation Antigens In Vivo: The H60 Histocompatibility Antigen Dominates Over All Others J. Immunol., April 1, 2001; 166(7): 4370 - 4379. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. S. Haring, L. L. Pewe, and S. Perlman High-Magnitude, Virus-Specific CD4 T-Cell Response in the Central Nervous System of Coronavirus-Infected Mice J. Virol., March 15, 2001; 75(6): 3043 - 3047. [Abstract] [Full Text]
|
|
|
|
|
|
G. F. Wu, A. A. Dandekar, L. Pewe, and S. Perlman CD4 and CD8 T Cells Have Redundant But Not Identical Roles in Virus-Induced Demyelination J. Immunol., August 15, 2000; 165(4): 2278 - 2286. [Abstract] [Full Text] [PDF]
|
|
| ||||||
