|
|
||||||||
,2
*
Department of Microbiology and Immunology and
Howard Hughes Medical Institute, Baylor College of Medicine, Houston, TX 77030
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
ß T cell lineage, the CD4 and
CD8 coreceptor molecules (1). Early intrathymic precursors
are CD4-CD8- double
negative (DN)3 cells
that typically do not express CD3; in these cells, TCRß rearrangement
is ongoing (2). Expression of a functional TCRß-chain
allows thymocytes to mature to the next stage, where both CD4 and CD8
are expressed, as well as low to intermediate levels of CD3. TCR
rearrangements occur in these double positive (DP) thymocytes.
Following productive TCR
rearrangement and selection, thymocytes
become mature single positive (SP) cells, expressing high levels of CD3
and either CD4 or CD8 at the cell surface. The process responsible for TCR rearrangements, V(D)J recombination, can be divided into two steps: DNA cleavage and joining of the broken ends. Cleavage, mediated by the recombination-activating gene products, RAG-1 and RAG-2, produces two kinds of DNA termini: signal ends and coding ends. These intermediates join to form signal and coding joints, respectively. Several double-strand break repair factors are required for joining, including the components of the DNA-dependent protein kinase (DNA-PK). DNA-PK is made up of a catalytic subunit, DNA-PKcs, and two DNA binding subunits, Ku86 and Ku70 (3, 4).
Mice bearing mutations in any of the three genes encoding DNA-PK subunits exhibit defects in the joining phase of V(D)J recombination, resulting in a severe combined immunodeficiency characterized by prematurely arrested development of B and T lymphocytes. This was first demonstrated in the case of the scid mouse, a naturally occurring mutant (5) bearing a point mutation in the DNA-PKcs gene that causes the protein to be prematurely terminated 83 aa from the normal C terminus (6, 7). This truncated protein is expressed in scid thymocytes at about 10% of the levels found in wild-type thymocytes (7) and may possess kinase activity (8).
We and others have shown that treatment of scid mice with low doses of
gamma irradiation partially rescues V(D)J rearrangements at the TCR
,
, and ß loci and promotes thymocyte differentiation to the DP
stage (9, 10, 11, 12, 13). Interestingly, irradiation does not promote
significant rearrangement of TCR
and does not rescue differentiation
or rearrangements in the B cell lineage (9, 10, 11, 12, 13). We have
recently shown that irradiated scid bone marrow cells are capable of
transferring the irradiation rescue effects to unirradiated host mice,
indicating that very early lymphocyte precursors may be the irradiation
targets (14). Irradiation also exerts a profound oncogenic
effect on these animals, as all treated scid mice develop thymic
lymphomas within a few months of treatment (9, 10),
compared with a 15% incidence of spontaneous thymic lymphoma in
nontreated scid mice (15).
The molecular mechanisms of these irradiation effects remain unknown. The completed, in-frame V(D)J rearrangements at the TCRß locus observed in irradiated scid thymocytes are thought to promote thymocyte differentiation and proliferation (9). However, they are not required for these effects of irradiation, as RAG-/- thymocytes proliferate and differentiate to the DP stage in the absence of any TCR rearrangements (16). We proposed that in irradiated scid mice, both rearrangement-dependent and -independent mechanisms might be responsible for the appearance of DP thymocytes (11). In particular, we suggested that activation of a DNA damage response pathway may have two separate effects: 1) providing signals for growth and differentiation of thymocytes, perhaps by mimicking signals normally given through the TCR complex, and 2) facilitating joining of the stalled V(D)J recombination intermediates that accumulate in scid thymocytes (11).
This hypothesis requires two key components: a DNA damage sensor and a mechanism for facilitating the joining of V(D)J recombination intermediates. Because the scid mutation is not a null allele, either or both of these processes may require the presence of residual DNA-PK activity or DNA-PKcs protein. Recent experiments have attempted to address this question by examining the effects of irradiation on mice genetically deficient for another DNA-PK component, Ku86. Interestingly, while irradiation stimulated the appearance of DP thymocytes, no overall increase in thymic cellularity was observed (TCR rearrangements were not examined) (17). Thus, while a full irradiation rescue was not observed in these animals, the results suggest that DNA-PK activity is not required for the transmission of the differentiation signal. However, recent biochemical experiments have shown that DNA-PK activity can be induced by broken DNA ends in the absence of Ku (18, 19). Therefore, we cannot rule out the possibility that irradiation rescue in Ku-deficient mice was mediated by direct activation of DNA-PK.
The absence of irradiation-induced increases in thymic cellularity in the Ku86-deficient mice suggests that thymocyte proliferation may be impaired in the absence of DNA-PK. However, this interpretation is clouded by the observation that Ku is involved in several critical cell growth processes, including telomere length regulation and senescence (20, 21, 22, 23, 24); furthermore, Ku86- and Ku70-deficient mice exhibit dwarfism (22, 25), suggesting a serious problem with cellular growth regulation. None of these are features of scid or DNA-PKcs-null mice (5, 26, 27, 28, 29). Thus, the failure to observe thymocyte proliferation in response to irradiation in Ku86-deficient mice may reflect a specific requirement for Ku, rather than DNA-PK, in this process.
As the preceding discussion indicates, it is now clear that Ku and DNA-PKcs have nonoverlapping activities. Thus, the determination of whether DNA-PKcs is required for the irradiation rescue phenomenon necessitates examination of irradiation responses in DNA-PKcs-deficient mice. The first such model was provided by the slip mouse, in which the DNA-PKcs gene was inactivated by integration of a transgene within the first few hundred nucleotides of the gene, generating mice that fail to express detectable levels of DNA-PKcs mRNA (by RT-PCR) and have no detectable DNA-PK activity (29). More recently, three different targeted alterations of the DNA-PKcs gene have been generated in mice by homologous recombination. All of these mutations have virtually identical effects on V(D)J recombination (26, 27, 28, 30).
While all four DNA-PKcs-deficient mouse lines have essentially the same defect in V(D)J recombination as the classical scid mouse, some differences in the effects of these mutations on thymocyte differentiation have been observed. In two of the knockout lines, thymocyte differentiation is arrested at the DN stage, as in the scid mouse (26, 27). In the other knockout and in the slip mouse, some "leakiness" (progression to the DP stage) is observed (28, 29). This phenotypic variability could be due to effects of genetic background. At present, the interpretation of results from the knockout mice is clouded by the variable admixture of two different genetic backgrounds present in each animal.
Here we use slip mice as a model system to ask whether the irradiation
rescue phenomenon requires the presence of the truncated version of the
DNA-PKcs protein present in scid thymocytes. We found that, as in
Ku86-deficient mice, irradiation rescues some thymocyte differentiation
without substantial increases in thymic cellularity. Surprisingly,
irradiation efficiently rescues rearrangements at the TCR
locus, a
situation not observed in irradiated scid mice. These results provide
the first evidence that residual DNA-PK activity is not required for
irradiation-induced rescue of limited thymocyte differentiation or
V(D)J recombination.
| Materials and Methods |
|---|
|
|
|---|
Slip mice (29) were maintained in the animal facility at Baylor College of Medicine. Newborn mice were irradiated (1 Gy) within 72 h of birth by exposure to a 137Cs source. Mice are reported by age (in days), regardless of treatment. Slip mice used here were generated on an FVB/N background (29). Age-matched BALB/c mice were used as controls.
Thymocyte cell suspensions and flow cytometry
Thymi were homogenized, and the cells were washed and counted. Each sample was subjected to flow cytometry and V(D)J rearrangement analysis (see below). Thymocytes were stained with anti-CD4 (RM4-4), and anti-CD8 (53-6.7) that were conjugated with CyChrome or FITC (PharMingen, San Diego, CA), respectively. Thymocytes were analyzed on an EPICS XL (Coulter, Palo Alto, CA).
DNA preparation and semiquantitative PCR
Thymocyte DNA was prepared as described (31).
V
8-J
49 and Vß7-Jß2 rearrangements (coding joints) were
amplified from genomic DNA in a total volume of 50 µl with 1 U
Taq polymerase (Perkin-Elmer, Norwalk, CT) in sample buffer
supplied by the vendor with 2 mM MgCl2 and 25
pmol of each primer (see below). Thirty cycles of amplification were
performed in a GeneAmp PCR System 9700 (Perkin-Elmer), where one cycle
was 95°C, 55°C, 72°C, each for 30 s. PCR products were
separated on a 6% polyacrylamide gel, electrophoretically transferred
onto GeneScreen Plus membranes (DuPont, Boston, MA), hybridized to
internal oligonucleotide probes that were 32P
end-labeled, and analyzed using a Molecular Dynamics Storm 860
Phosphorimager (Molecular Dynamics, Sunnyvale, CA).
Sequencing and assignment of nucleotides from V(D)J rearrangements
PCR products were ligated into pCR2.1 (Invitrogen, San Diego,
CA). Inserts from plasmid preparations derived from transformed DH5
colonies that hybridized with internal oligonucleotide probes (see
below) were subjected to cycle sequencing (manual sequencing with
ThermoSequenase (USB, Cleveland, OH) detected by 33P-labeled
dideoxynucleotides or automated sequencing (Applied Biosystems, Foster
City, CA) performed by Lark Technologies, Houston, TX). Nucleotides
were assigned based on reported germline sequences for J
49
(EMBL/GenBank accession no. M64239), Jß2 (32), and Dß
(33) gene segments. Germline nucleotides from Vß7 and
V
8 were assigned with a high degree of confidence through sequence
analysis of various cDNAs using these gene segments
(34, 35, 36, 37, 38, 39, 40). Nucleotides were strictly assigned to categories
in the following order: J coding region, J-associated P nucleotides, V
coding region, V-associated P nucleotides, and (in the case of TCRß
rearrangements), D coding region, followed by D-associated P
nucleotides. Ambiguous nucleotides are underlined and represent
junctions that could have used short sequence homologies for joining.
Nucleotides that did not fall into one of these categories were
designated N nucleotides.
Oligonucleotides and sequence source
Oligonucleotides (obtained from Life Technologies, Gaithersburg,
MD) and their respective sequence source are as follows: PCR primers:
V
8, CGCCACTCTCCATAAGAGCAGC (39); J
49,
CATGCCCATCAGTTGGTGTGAAAG (accession no. M64239); Vß7,
GCCATGAAACAATGTACTGGTATCG (34); Jß2.6,
GCCTGGTGCCGGGACCGAAGTA (32); probes: J
49,
GGACTCACTGTGAGCTTTGC (accession no. M64239); Jß2.6,
CCTATGAACAGTACTTCGGTCCCGG (32).
| Results |
|---|
|
|
|---|
Following the protocol established previously for irradiation of
newborn scid mice (9, 11), we administered 1 Gy of gamma
irradiation to newborn slip mice within the first 72 h of life.
Three weeks later, thymocytes were harvested and examined by flow
cytometry for expression of CD4 and CD8. Two color profiles of
unirradiated and irradiated slip thymocytes are shown in Fig. 1
; a wild-type profile is shown for
comparison. While DP thymocytes are present in the unirradiated
control, it is evident that irradiation induces a substantial increase
in the proportion of DP cells. However, in this experiment no increase
in thymic cellularity was observed. Data from a number of experiments
are summarized in Fig. 2
. The proportion
of DP thymocytes in unirradiated slip mice appears to increase with age
from day 10 (roughly 25%) to day 21 (
50%) after birth (Fig. 2
A,
). The presence of DP cells and the frequent
appearance of DP thymic lymphomas in slip mice have been noted
previously (29), raising the possibility that the DP cells
arising spontaneously in unirradiated slip mice represent a
preneoplastic population.
|
|
) in younger animals (up to 14
days of age). In older mice, the spontaneous appearance of DP
thymocytes apparently obscured the irradiation response. Unlike the
situation in irradiated scid mice, no consistent increase in thymic
cellularity was observed in irradiated slip mice compared with
unirradiated controls (Fig. 2Effects of irradiation on TCR rearrangements
To assess the ability of ionizing radiation to rescue V(D)J
recombination, we examined the status of several TCR loci using
semiquantitative PCR assays for rearrangements (12, 30).
We first looked for rearrangements at the TCRß locus, using primers
specific for Vß7-Jß2.6 coding joints. As described previously for
Vß8 rearrangements (9), irradiation of scid mice
substantially rescues Vß7-Jß2.6 coding joints (Fig. 3
A, compare lanes 5
and 6). In thymocytes from three individual unirradiated
slip mice, we observed variable, low levels of spontaneous
Vß7-Jß2.6 rearrangements (lanes 79). These
rearrangements may be related to the appearance of DP thymocytes in
these animals. While low levels of these rearrangements were also
detected in two of three irradiated slip mice (lanes
1012), we failed to observe consistent, robust rescue of
rearrangements as seen in irradiated scid thymocytes. We also examined
TCR V
2-J
1 rearrangements, which are efficiently rescued in
irradiated scid thymocytes (11). In agreement with our
analysis of TCRß rearrangements, spontaneous TCR
rearrangements
were readily detected in thymocytes from three of four slip mice
examined; after irradiation, no consistent increase in the levels of
these rearrangements was observed (data not shown). Thus, unlike
the situation in scid mice, irradiation does not efficiently rescue
TCRß or TCR
rearrangements, an effect that may be related to the
failure of irradiation to stimulate thymocyte proliferation.
|
locus. Previous work has
shown that recombination does not initiate at the TCR
locus in
unirradiated scid mice (11, 12, 13). However, irradiation of
scid mice promotes the appearance of DP thymocytes, which allows TCR
recombination to begin (11, 12, 13). Because DP thymocytes are
already present in unirradiated slip mice, we were interested to see
whether completed rearrangements at TCR
could be detected and
whether these rearrangements could be stimulated by irradiation. We
performed PCR analysis for TCR
rearrangements involving the V
8
and J
49 elements. We previously showed that these gene segments are
frequently rearranged in wild-type thymocytes; moreover, recombination
is initiated at these sites in DP thymocytes from irradiated scid mice
(12). As shown in Fig. 3
8-J
49
rearrangements are not observed in unirradiated scid thymocytes
(lane 5). After irradiation, only very low levels of
TCR
rearrangements are observed (lane 6), in
agreement with previous results (12). With one exception
(lane 8), thymocytes from unirradiated slip mice
showed only trace amounts of V
8-J
49 rearrangements. However,
after irradiation, three of four slip thymi contained high levels of
TCR
coding joints (lanes 1114). Thus, unlike the
situation in scid mice, irradiation efficiently rescues recombination
at the TCR
locus in slip mice. Similar results were observed for
V
8-J
50 rearrangements (data not shown).
Efficient rescue of normal, diverse TCR
rearrangements in
irradiated slip mice
The appearance of abundant TCR
rearrangements after irradiation
could result from efficient joining of broken TCR
V(D)J
recombination intermediates. In this case, we would expect to find a
diverse array of junction sequences in thymus DNA preparations from
individual animals. Alternatively, irradiation might not promote
efficient joining, but, instead, could stimulate proliferation of rare
cells that contain successful joining events. The latter model predicts
that individual thymi will not contain a diverse set of junction
sequences. We were also interested in determining whether irradiation
rescues formation of normal junctions, without the characteristic
features of junctions formed in scid mice, such as excessive P
nucleotide insertions and abnormal deletions (41, 42, 43).
To test these predictions, PCR products resulting from V
8-J
49
joining in several different individual thymi from irradiated and
unirradiated slip mice were cloned and sequenced. Nucleotide sequences
of these junctions are displayed in Fig. 4
along with sequences obtained from an
age-matched wild-type (BALB/c) mouse, which are shown for comparison.
Inspection of these junctions reveals several important features.
First, junctions from unirradiated slip mice display unusually long P
nucleotides, as previously reported in scid mice (42, 43).
These are not observed in junctions from irradiated slip mice. Indeed,
the structural characteristics of the junctions (number of nucleotides
deleted, presence of extra nucleotides, appearance of short sequence
homologies, frequency of junctions in-frame, and CDR3 length) appear
indistinguishable from wild-type controls, indicating that irradiation
stimulates normal joining. Furthermore, a highly diverse set of
junctions is observed after irradiation in individual animals. These
data indicate that irradiation promotes efficient coding joint
formation by a mechanism that appears to be distinct from that
operative in unirradiated slip mice.
|
4-D
1 junctions (13) and absence of D regions in TCR
Vß8-Jß2 junctions (9).
|
| Discussion |
|---|
|
|
|---|
Exposure of scid mice to low doses of ionizing radiation promotes proliferation and differentiation of thymocytes to the DP stage, resulting in a 10- to 20-fold increase in thymic cellularity. Irradiation-induced DNA damage appears to signal these differentiative events, as they are also observed with other DNA damaging agents, such as bleomycin (9). The identities of the proteins that recognize and transmit the DNA damage signal remain unknown. The presence of a truncated form of DNA-PKcs in scid thymocytes, which may retain kinase activity (8), has raised the possibility that DNA-PK itself could be required for transmission of the DNA damage signal or for irradiation-induced rescue of V(D)J rearrangements.
Our results indicate that DNA-PKcs is not required for rescue of limited thymocyte differentiation or V(D)J recombination in response to ionizing radiation. Thus, neither transmission of the DNA damage signal nor rescue of coding joint formation requires DNA-PK activity. These data are in agreement with the observation that irradiation of Ku86-deficient mice results in the appearance of DP cells (17). Together, these results rule out two of the most obvious candidates for the DNA damage sensing function. What, then, are the molecules responsible for signaling? We have shown that irradiation rescue in scid mice requires p53 (11), which can be activated by binding to DNA lesions (45, 46). Thus, p53 itself could be the damage sensor. Alternatively, sensing could be performed by molecules such as ATM, poly(ADP-ribose) polymerase, or other factors.
DNA-PK and thymocyte proliferation
The lack of thymocyte proliferation in response to DNA damage provides the first clear indication that DNA-PKcs may play a critical role in thymocyte proliferation. Previous analysis of Ku86-deficient mice yielded a similar finding (17), but it was not possible to attribute this defect to lack of DNA-PK activity for two reasons: First, DNA-PKcs can be activated in the absence of Ku (18, 19), and second, Ku86-deficiency has several effects on cellular growth regulation (22) that are not observed in scid or DNA-PKcs-deficient mice (27, 28, 29, 30). Thus, our data suggest that DNA-PKcs may play a role in growth control. Possible mechanisms could include effects on transcription, as DNA-PK can phosphorylate a number of transcription factors in vitro (4, 47, 48).
One notable feature of unirradiated slip mice as well as some lines of DNA-PKcs-deficient mice created by gene targeting is the spontaneous appearance of DP thymocytes as the mice age (28, 29). It is not clear why this phenomenon is only observed in some mouse lines. The apparent "leakiness" of some DNA-PK-deficient mouse strains may be due to effects of the genetic background, which in the case of the knockout animals is a variable mixture of the 129 and C57BL/6 strains. Support for this view is provided by our observation that some of the F1 progeny generated by mating scid/scid and slip/slip homozygotes exhibit spontaneous DP thymocytes (M.A.B. and D.B.R., unpublished observations). It will be interesting to see if this is also the case for lymphomas, which appear in virtually all slip mice (29) but are much more rare in scid mice (15) and in at least some lines of DNA-PKcs knockout mice (26). It is possible that the effects of background genes may modify the irradiation response in slip mice. Future experiments using animals that have been extensively backcrossed onto appropriate genetic backgrounds will be required to determine whether this is the case.
Our data show that in the slip mice, spontaneous thymocyte differentiation is accompanied by an increased abundance of completed TCR rearrangements. Appearance of DP thymocytes and completed V(D)J rearrangements has also been noted in Ku70-/- mice (25). It is not clear whether in the absence of DNA-PK activity the ability to bypass the blocks to both thymocyte differentiation and V(D)J recombination reflects a single mechanism or whether these events can occur separately. An increased frequency of productive TCR rearrangements could promote thymocyte differentiation; however, DP thymocytes can develop in the absence of rearrangements (16).
Irradiation-mediated rescue of V(D)J recombination in the absence of DNA-PKcs
Three aspects of the effect of irradiation on TCR rearrangements
in slip mice are particularly striking. First, while irradiation
normalizes several features of TCRß coding joints, as seen in scid
mice (9), the levels of rescued TCRß and TCR
rearrangements are much lower in slip mice than in scid mice. Two
factors may contribute to the relatively small increases in levels of
rearrangements at the ß and
loci after irradiation: the increased
baseline levels of spontaneous rearrangements in unirradiated animals
and the lack of irradiation-induced thymocyte proliferation. The
increased baseline levels seen in the present study are probably due to
the presence of DP thymocytes. It should be noted that in our previous
analysis of TCR rearrangements in unirradiated slip mice, which focused
exclusively on young slip mice lacking significant numbers of DP
thymocytes, very low levels of coding joints were detected
(30). Progression of thymocytes to the DP stage in the
absence of proper TCRß rearrangements may reflect failure of a
DNA-PK-dependent checkpoint that normally functions to prevent
inappropriate developmental progression without productive TCRß
rearrangement (28). This hypothesis is supported by the
fact that <50% of the TCRß sequences from irradiated slip mice are
in frame, compared with >95% in wild-type and irradiated slip mice.
Furthermore, loss of this DNA-PK-dependent checkpoint may be more
evident in slip mice than in scid mice, which could retain partial
DNA-PK function.
A second notable feature of our results is the rescue of abundant,
normal-appearing, diverse TCR
rearrangements. Based on previous
analyses of irradiated scid mice, we did not expect to see rescue of
these rearrangements. We have previously shown that the same TCR
rearrangements studied here are rescued, but only very weakly, by
irradiation of newborn scid mice (12). The basis for the
ability of irradiated slip, but not scid, mice to rescue TCR
rearrangements remains unclear.
A third interesting feature is the differential effect of irradiation
on rescue of rearrangements at the TCR
and ß loci. While
irradiation rescues TCR
rearrangements that appear normal by DNA
sequence analysis, irradiation-induced TCRß rearrangements retain
some abnormal features, in particular excessively long P nucleotides.
Because these extra nucleotides are thought to be derived from hairpin
opening (49, 50), the presence of aberrant P nucleotide
inserts suggests that the hairpin opening reaction may not proceed
normally. One explanation for these differential effects is that
irradiation might affect the two loci in subtly different ways.
Alternatively, differences in the developmental stages of the
thymocytes at the time of irradiation might affect the mechanism of
rescue. For example, substantially more RAG RNA is expressed at the
time of TCR
rearrangement in DP thymocytes than during TCRß
rearrangement in DN thymocytes (51). In agreement with
this finding, we have shown that RAG-1 protein levels are substantially
higher, on a per cell basis, in thymocytes from slip mice than in scid
thymocytes (M. Purugganan and D.B.R., unpublished observations), an
observation that presumably reflects the greater abundance of DP cells
in slip thymi. Conceivably, this could affect the mechanism of rescue,
as recent reports have indicated that the RAG proteins are capable of
opening hairpins in vitro (52).
Although the mechanistic details remain unclear, the observation of a
robust rescue of rearrangements at the TCR
locus in irradiated slip
mice provides firm evidence that the residual DNA-PKcs protein present
in scid thymocytes is not required for rescue of V(D)J recombination.
This information allows further refinement of our understanding of the
irradiation rescue phenomenon, as scenarios involving up-regulation of
weak DNA-PK activity in scid mice can now be discounted.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David B. Roth, Howard Hughes Medical Institute/Baylor College of Medicine Immunology, Room M929/DeBakey, One Baylor Plaza, Houston, TX 77030-3498. E-mail address: ![]()
3 Abbreviations used in this paper: DN, double negative; DP, double positive; SP, single positive; RAG, recombination-activating gene; DNA-PK, DNA-dependent protein kinase; DNA-PKcs, catalytic subunit of DNA-PK; ATM, ataxia telangiectasia mutated. ![]()
Received for publication July 8, 1999. Accepted for publication September 17, 1999.
| References |
|---|
|
|
|---|
locus. Eur. J. Immunol. 26:2859.[Medline]
rearrangement signals. Cell 69:41.[Medline]
and ß chains of the T cell antigen receptor. Eur. J. Immunol. 22:603.[Medline]
gene segments. Nature 317:430.[Medline]
chains and correlation with T-cell function. Immunogenetics 35:224.[Medline]
and J
segments in the mouse. Nucleic Acids Res. 16:11354.
and
gene junctional sequences in scid mice: excessive P nucleotide insertion. J. Exp. Med. 174:769.This article has been cited by other articles:
![]() |
C. J. Williams, I. Grandal, D. J. Vesprini, U. Wojtyra, J. S. Danska, and C. J. Guidos Irradiation Promotes V(D)J Joining and RAG-Dependent Neoplastic Transformation in SCID T-Cell Precursors Mol. Cell. Biol., January 15, 2001; 21(2): 400 - 413. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |