|
|
||||||||


*
Nuffield Department of Medicine, Institute of Molecular Medicine, John Radcliffe Hospital, Headington, Oxford, United Kingdom; and
Division of Immunology, Department of Pathology, Cambridge, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
The identities of the proteases involved in the processing of newly synthesized target proteins are still unclear. Accumulating evidence suggests that a large cytosolic protease, called proteasome, plays an important role in the generation of CTL epitopes. Several reports demonstrate that specific inhibition of the proteasome by either peptidyl aldehydes (2, 3) or lactacystin (4, 5) results in defective Ag presentation of defined CTL epitopes. Furthermore, it was shown that the proteasome is capable of generating optimal length peptides for binding to MHC class I molecules (6, 7, 8). Recent studies suggest that the proteasomal processing pathway is not the only proteolytic activity involved in the generation of antigenic peptides for presentation via the MHC class I pathway (9, 10, 11, 12, 13, 14, 15).
The catalytic core of the proteasome (20S) is a symmetrical structure
made of four stacked heptameric rings. The outer two rings contain
structural (
) subunits, while the inner two rings contain catalytic
(ß) subunits, some of which contain an active amino-terminal
threonine. A stepwise assembly process of the 20S structure ensures
that the catalytic threonines are not exposed before the whole
structure is completed. The ß subunits are synthesized initially with
an amino-terminal prosequence that is cleaved off by an autocatalytic
process during the assembly (16, 17). Mature proteasomes
have a broad proteolytic activity, degrading bonds on the carboxyl side
of basic, hydrophobic, and acidic residues (18). Two
proteasome subunits, called low molecular protein 2
(LMP2)4 and LMP7, are
encoded in the MHC, closely linked to the peptide transporter (TAP)
genes (19, 20, 21). The close association of LMP2 and LMP7
with TAP1 and TAP2 genes and the finding that all four genes can be
up-regulated by IFN-
suggest that products of these genes might be
playing a role in the Ag presentation pathway. Binding of LMP2 and LMP7
to the proteasome displaces two constitutively expressed proteasome
subunits, called MB1 and
(22, 23). It was shown that
displacement of these constitutive proteasome subunits by LMP2 and LMP7
alters the cleavage specificity of purified proteasome
(24, 25, 26, 27, 28, 29, 30), suggesting that their binding to the proteasome
could alter the pool of antigenic peptides presented by MHC class I
molecules.
A role for LMP2 and LMP7 in Ag presentation was initially called into question (31, 32, 33, 34). Additional experiments conducted both with LMP knockout mice (35, 36) and with LMP-deficient human (37) and mouse cells (38) demonstrated that cells lacking LMP2 and/or LMP7 have a defined defect in Ag presentation. This defect is selective for certain epitopes, while other epitopes are efficiently generated. The mechanisms by which LMP products control the generation of certain CTL epitopes is not known.
We here analyzed the processing and presentation of the A2 influenza Matrix epitope in LMP-deficient cells. We previously demonstrated that its presentation was impaired by deletion of the proteasome subunits LMP2 and LMP7. We have now extended these observations and demonstrated that this Ag presentation block can be overcome by either transfecting LMP-deficient cells with a mutated form of LMP7 or by increasing the rate of degradation of the Matrix protein.
| Materials and Methods |
|---|
|
|
|---|
LCL721.45 (.45) and LCL721.174 (.174) cells were described previously (39, 40). Cer-43 CTL clone, which recognizes the A2-restricted influenza Matrix epitope GILGFVFTL (corresponding to residues 5866), was provided by A. Lanzavecchia (Basel Institute for Immunology, Basel, Switzerland). All other CTL clones were generated as described previously (41) .174/TAPs are .174 cells transfected with plasmids containing the TAP1 and TAP2 genes as described previously (37). .174/TAPs/LMP7 (.174/TAPs cells transfected with a plasmid containing the LMP7b gene) were described previously (15). .174/TAPs/LMP7 T1A/T2A are .174/TAPs transfected with plasmid pREP4-LMP7 T1A/T2A.
Mutagenesis of LMP7
Oligonucleotides GCAAGCTTATGGCGCTACTAGATGTA and GAGCGTG-GCGGCGCCATGGGCCAT were used in a primary PCR to amplify the 5' end of LMP7b with the mutation T1A/T2A. The amplified fragment and oligonucleotide GCGGATCCTTATTGATTGGCTTCCCGGTA were used as primers for the secondary PCR, in which the whole of the LMP7 coding sequence was amplified and cloned between the HindIII and BamHI restriction sites of pREP4. The resulting plasmid, pREP4-LMP7 T1A/T2A, was transfected into .174/TAPs, and hygromycin B selection was applied.
Recombinant vaccinia virus
Recombinant viruses were made by homologous recombination into the thymidine kinase gene using the vector pSC1130R.2 as previously described (37). The coding sequence for each fragment was amplified by PCR and from influenza Matrix cDNA cloned into pSC11-mod (42) (provided by J. Yewdel, Bethesda, MD) between the SalI and BglII sites (in the case of 28, 36, 49, and 74 fragments) or pSC11.2R30 (37) between the NcoI and BamHI sites (in the case of 74, 105, 164 fragments and Matrix mutants E2, and E6). Primers are named according to the direction from which they primed and the amino acid residue from which they start (the letter M denotes the presence of an initial methionine that was engineered at the beginning of the coding sequence). The primers used were: 5'-M52 and 3'-78 for 28, 5'-43 and 3'-78 for 36, 5'-M31 and 3'-78 for 49, 5' N-Term and 3'-74 for 74, 5' N-Term and 3-'164 for 164, and 5' N-Term and 3'-105 for 105. The E2 construct was made in two stages. A primary PCR product was generated using the primers 5' N-Term and 3'-E2 and purified by agarose gel electrophoresis. This DNA was used as a 5' primer using the cDNA of Matrix protein as template and 3'-Matrix as the 3' primer. The E6 construct was made in a similar way. 3'-E6 was used in place of 3'-E2, and the template was the E2 mutant of Matrix instead of the wild-type Matrix.
Oligonucleotides
The following oligonucleotides were used: 5'-N-Term, 5'-acg cgt cga cca cca tgt ctc ttc taa ccg agg tcg aaa cgt ac-3'; 3'-74, 5'-ggg gta ccc tat tgc cta tga gac cga tgc tg-3'; 3'-Matrix, 5'-ggg gta cct cac ttg aac cgt tgc at-3'; 5'-164, 5'-ggg gta ccc tat tgc cta tga gac cga tgc tg-3'; 5'-E2, 5'-ccc tgc aaa gac atc ttc ttc tct ctg tgc ttc ctc ggc ttt gag ggg-3'; 5'-E6, 5'-cag gat tgg tct tgt ctt ctc cca ttc ctc ctc aac ctc ctc atc ggt gtt ctt ccc tgc-3'; 5'-M6, 5'-ccc aag ctt cca tgg agg tcg aaa cgt acg ttc tct cta-3'; 5'-M31, 5'-ccc aag ctt cca tgg tct ttg cag gga aga aca ccg at-3'; 5'-43, 5'-ccc aag ctt cca tgg aat ggc taa aga caa gac caa t-3'; 5'-M52, 5'-ccc cca tgg gtc gac cca cca tgc tgt cac ctc tga cta agg gga tt-3'; 3'-78, 5'-gaa gat ctc gag tca gcg tct acg ctg cag tcc tcg-3'; and 3'-105, 5'-gaa gat ctc gag tca cct ctt gag ctt cct ata cag ttt-3'.
Chromium release assay
Target cells were infected with recombinant vaccinia at a multiplicity of infection of five per cell for 90120 min at 37°C. After washing, cells were incubated overnight in R10 (RPMI 1640 with 10% FCS, 2 mM glutamine, 100 µg/ml streptomycin, and 100 U/ml penicillin) at 37°C (puromycin was used at a concentration of 2 mM; it was added for 30 min and then washed twice before the overnight incubation). Cells were then counted, labeled with 51Cr for 120 min, and used as targets. Supernatants were collected after 4 or 7 h.
Lactacystin treatment of target cells
Cells (106) were resuspended in 100 µl of R10 medium containing 100 µM lactacystin for 1 h at 37°C before the addition of 50 µl of vaccinia virus at a multiplicity of infection of five per cell. After 90-min infection at 37°C, cells were washed, resuspended in 5 ml of R10 containing 1 µM lactacystin, and incubated overnight to allow expression of the vaccinia-encoded proteins.
Pulse-chase experiments
Cells were infected with recombinant vaccinia virus at a multiplicity of infection of 10 for 90 min at 37°C, then incubated for 2 h in R10 following a wash in the same medium. Cells were then resuspended at 2 x 107/ml in methionine- and cystine-free R10 for 1 h at 37°C. Promix (143 µCi; 70% [35S]methionine and 30% [35S]cysteine, Amersham, Arlington Heights, IL) was then added, and the mixture was incubated for 30 min at 37°C. Labeled cells were chased with R10 and excess nonlabeled methionine and cystine. At the indicated time points after the chase cells were washed in ice-cold PBS and resuspended in 0.5 ml of lysis buffer (150 mM NaCl, 50 mM Tris-HCl (pH 7.5), 5 mM EDTA, 0.5% Nonidet P-40, 0.5% Mega9, 2 mM PMSF, and 5 mM iodoacetamide), followed by centrifugation to pellet nuclei. Lysates were precleared with Pansorbin overnight at 4°C and immunoprecipitated using anti-Matrix Abs M2 2B3 (J. Yewdell, Bethesda, MD) and protein-A coated Sepharose beads. Following extensive washing, proteins were eluted from the beads using standard SDS-PAGE loading sample buffer and heated at 95°C for 5 min.
Serial immunoprecipitation was performed essentially as described previously (37). Cells were labeled with Promix (Amersham) overnight. Proteasomes were immunoprecipitated with purified MCP21 Ab and protein A-Sepharose beads. Proteasome subunits were extracted from the beads using 2% SDS in lysis buffer and 95°C for 5 min. Ten percent of the sample was removed for SDS-PAGE. The remainder of the samples was cooled and diluted to a 0.1% SDS concentration. MCP21 Abs were precleared with Pansorbin cell extracts, and a second immunoprecipitation was conducted using anti-LMP7 antiserum (17) and protein G-Sepharose beads.
Western blotting
Lysed cells were separated by SDS-PAGE. The gel was blotted onto a Hybond-C membrane and placed overnight in blocking solution (5% powdered milk and 0.2% Tween in PBS) on a rocking platform. Anti-LMP7 antiserum (17) was diluted 1/1000 in blocking solution and incubated with the membrane for 1 h. The membrane was then washed extensively in 0.2% Tween in PBS containing 5% milk proteins. A second 1-h incubation of the membrane in a 1/2000 dilution of HRP-conjugated goat anti-rabbit Ab (P448 Dako) in blocking solution followed. The membrane was then washed as described above and treated with ECL reagents (Amersham) as described by the manufacturer. The gel was then exposed to x-ray film for autofluorography.
| Results |
|---|
|
|
|---|
-inducible proteasome subunit LMP7 in the
presentation of the influenza Matrix A2 epitope
The cell line .174 bears a deletion in the MHC that includes both
TAP1 and TAP2 genes and the LMP2 and LMP7 genes. We have previously
shown that presentation of the influenza Matrix A2-restricted epitope
is defective in .174 cells (39). This Ag presentation
block was not relieved by transfecting the TAP1 and TAP2 genes
(.174/TAPs) (37), leading to the hypothesis that its lack
of presentation was due to the lack of expression of either LMP2 or
LMP7. Consistent with this hypothesis we observed a small, but
significant, effect of vaccinia-encoded LMP7 molecules on the
presentation of the Matrix A2 epitope (37). We have now
extended these results by transfecting LMP7 cDNA into .174/TAP cells
(Fig. 1
D). Transfected LMP7
incorporates into the proteasome, and its amino-terminal pro
sequence is removed, exposing the amino-terminal threonines (Fig. 2
B). Incorporation of LMP7
into the .174/TAPs proteasome restores presentation of the Matrix
A2 epitope (Fig. 1
, AC).
|
|
To establish whether the lack of presentation of the Matrix 5866
epitope by .174/TAPs was due to an active destruction of the epitope by
the proteasome, we studied the effect of the proteasome inhibitor
lactacystin on .174/TAPs cells. It was previously shown that treatment
of the B cells C1R/A2 with the proteasome inhibitor lactacystin was
capable of enhancing the presentation of the Matrix A2 epitope
(43). Our results confirmed these findings, as addition of
the proteasome inhibitor lactacystin to .174/TAPs cells relieved the
block in presentation of the Matrix A2 epitope. Addition of lactacystin
to LMP7-positive B cells (i.e., .45 and .174/TAPs/LMP7) did not have a
further enhancing effect on presentation of the Matrix A2 epitope (Fig. 1
C), possibly because maximum presentation had already been
reached.
Rapid degradation of the full-length Matrix protein overcomes Ag presentation block
The stability of cytosolic proteins may influence their ability to
sensitize target cells for lysis (44, 45, 46) and induce a
stronger immune response (44). It is not known, however,
whether rapid degradation of a cytosolic protein may overcome an Ag
presentation block that is dependent on the presence of
IFN-
-inducible proteasome subunits. Modifications of protein Ags may
result in their rapid degradation by distinct degradation pathways,
leading to a more efficient Ag presentation. To address this
possibility we decided to study whether the lack of presentation of the
Matrix A2 epitope by LMP-negative cells could be overcome by increasing
the rate of degradation of the full-length Matrix protein.
The three-dimensional structure of the first 164 amino-terminal
residues (of 252 residues) of the influenza Matrix protein has been
solved as two domains linked by a flexible hinge (47). The
amino-terminal domain is an antiparallel four-
-helix bundle held
together by a central hydrophobic core. Because hydrophobic
interactions in folded proteins play a major role in holding their
tertiary structure together, we reasoned that mutations disrupting
these interactions may lead to the protein unfolding, resulting in its
rapid degradation (48, 49, 50). This reasoning led to the
analysis of the rate of degradation of the full-length Matrix protein
in which the hydrophobic residues contributing to the hydrophobic core
of the influenza Matrix
helix bundle were mutated. In the mutant E6
(Fig. 3
) the residues isoleucine 24,
leucine 28, leucine 39, leucine 42, methionine 43, and leucine 46 were
replaced by negatively charged glutamic acid residues, while in the
mutant called E2 (Fig. 3
) residues isoleucine 24 and leucine 28 were
replaced by glutamic acid residues.
|
We then addressed the hypothesis of whether a rapidly degraded
full-length Matrix protein was capable of sensitizing
LMP-deficient cells for lysis by A2-restricted
Matrix-specific CTL. The results of these experiments demonstrated that
targeting the full-length Matrix protein for rapid degradation was
capable of relieving the processing block of the LMP-deficient cells,
leading to an efficient presentation of the Matrix A2 epitope (Fig. 3
, A and B).
Presentation of the influenza Matrix A2 epitope contained within shorter fragments
An alternative strategy for destabilizing newly synthesized
proteins is by generating protein fragments. Our earlier results showed
that fragments of the influenza NP were shorter lived than the
full-length NP (45). We sought to address whether the
block in presentation of the LMP7-dependent Matrix A2 epitope could be
overcome by expressing the epitope 5866 contained within shorter
fragments of the influenza Matrix protein. A panel of vaccinia-encoded
Matrix fragments was compared for their ability to sensitize
LMP-negative cells for lysis by A2-restricted Matrix-specific CTL (Fig. 4
, A and B). The
.174/TAP cells were efficiently lysed by Matrix-specific CTL after
infection with recombinant vaccinia viruses expressing fragments of the
influenza Matrix (Fig. 4
B). It is noteworthy that one
fragment, spanning the whole of the first two domains of the Matrix
protein (fragment 1164) (47), failed to sensitize for
lysis the LMP-negative cells, .174/TAP, thus behaving similarly to the
full-length Matrix protein.
|
|
| Discussion |
|---|
|
|
|---|
-inducible proteasome subunits may affect the generation of
viral CTL epitopes. One possibility to account for the positive effect of LMP7 on the generation of the Matrix A2 epitope by .174/TAPs cells is that incorporation of LMP7 into proteasomes introduces a new proteolytic activity, which allows generation of the 5866 epitope. Alternatively, binding of LMP7 to the proteasome may modify the proteasomes structure and/or subunit composition, preventing the destruction of the Matrix A2 epitope. Our results are consistent with the latter possibility. Firstly, we showed that transfection of a mutated LMP7, lacking the threonine catalytic active site, was capable of relieving the block in presentation of the Matrix epitope. Secondly, we observed that the proteasome inhibitor lactacystin enhances the killing of .174/TAPs cells by Matrix-specific CTL. The observation that lactacystin had no effect on the presentation of the Matrix A2 epitope by LMP7-transfected .174/TAPs cells and the parental line .45 could be accounted for by maximum killing of LMP7-positive target cells by Matrix-specific CTL.
These results are consistent with the report by Luckey et al. (43), in which it was shown that treatment of the B cells C1R with lactacystin enhances presentation of the Matrix A2 epitope and that purified proteasomes destroyed the 5866 epitope contained within a larger synthetic peptide. The effect of lactacystin on the generation of the Matrix A2 epitope in .174/TAPs cells is different from the effect that we previously observed using a human melanoma cell line (4), in which presentation of the A2 Matrix epitope was inhibited, rather then enhanced, by lactacystin. It is possible that this discrepancy might be accounted for by a higher sensitivity of the melanoma line to lactacystin, which might have caused a reduced synthesis of the influenza Matrix protein. Although this possibility was not formally ruled out, we considered it unlikely, as the same cells were capable of presenting the HLA-A1 influenza NP epitope if treated with even higher doses of lactacystin (4). An alternative possibility is that distinct processing pathways may dominate proteolysis in different cell types, as shown for the presentation of the HLA-A3 influenza NP epitope by mouse and human cells (54).
Evidence that amino-terminal threonines of proteasomes ß subunits contribute to the activity of the proteasome is compelling (5, 55, 56, 57). Site-directed mutagenesis of mouse LMP 2 (56), yeast (57), and Themoplasma acidophila (55) proteasome subunits demonstrated the importance of amino-terminal threonines in the activity of the ß subunits. Our findings are consistent with this possibility, as shown by failure of LMP7 to remove autocatalytically its amino-terminal pro region. These results suggest that binding of LMP7 to the proteasome, rather than binding of a proteolytically active LMP7, may be of importance for an efficient presentation of the Matrix A2 epitope. It is possible that this effect may be accounted for by a modulation of the proteasome subunit composition, as binding of LMP7 displaces the proteasome subunit MB1 (23).
The identity of the lactacystin-resistant cytosolic proteolytic activity responsible for generation of the Matrix A2 epitope in .174/TAPs B cells remains unclear. The possibility that generation of the Matrix A2 epitope may depend on a proteasome subset that is resistant to lactacystin cannot be ruled out. Proteasomes have at least five distinct peptidase activities, as defined by preference for amino acids in the P1 position of synthetic fluorogenic substrates (58). Lactacystin binds to the proteasome subunit MB1 and LMP7 (59) and inhibits the chymotrypsin-like activity, trypsin-like activity, and peptidylglutamyl activity (5). We have recently demonstrated that proteasome-dependent activity can be modulated in vitro by the addition of lactacystin (60). To date we were not able to inhibit presentation of the Matrix 5866 epitope in LMP7-transfected .174/TAPs cells and its parental line .45. The inhibitors E64, bestatine, amastatine, leupeptin, calpain inhibitor IV (Z-Leu-Leu-Leu-CHO), and the cystein protease inhibitor MKC-442 (13) failed to block presentation of the Matrix A2 epitope (data not shown).
In the second part of this paper we studied whether the block in
presentation of the Matrix 5866 epitope in .174/TAPs cells could be
overcome by modifying the Matrix protein, rather than the cytosolic
proteases. We demonstrated that 1) the block in presentation of the
Matrix 5866 epitope can be overcome by expressing either a rapidly
degraded full-length Matrix protein (Fig. 3
) or defined fragments of
the influenza Matrix; and 2) puromycin treatment of .174/TAPs cells
relieves the block in presentation of the 5866 epitope after
expression of the wild-type full-length Matrix protein (Fig. 5
).
We consider it unlikely that variations in the proteins primary
sequence may account for the ability of shorter lived Matrix protein
and Matrix fragments to be presented by LMP-deficient cells, because
the epitope neighboring residues were conserved in all the full-length
Matrix constructs, and no mutations were introduced in the shorter
Matrix fragments (see Fig. 4
A). It is likely that rapid
degradation of mutated full-length Matrix proteins E2 and E6 may result
from their misfolding, compared with the folding of the full-length
influenza Matrix. Hydrophobic interactions in folded proteins play a
major role in holding their tertiary structure (48, 49, 50).
Hence, introduction of negatively charged residues to the hydrophobic
core of the Matrix helix bundles is likely to destabilize folding of
the full-length Matrix protein. The half-lives of the Matrix fragments
could not be measured, as our Matrix-specific Abs failed to recognize
these fragments in Western blot and immunoprecipitation analysis.
Surprisingly, fragment 164 (see Fig. 4
) failed to sensitize for lysis
LMP-negative cells, .174/TAP, thus behaving similarly to the
full-length Matrix protein. Unlike the influenza Matrix fragments that
were presented by LMP-deficient cells, the fragment 1164 spans two
whole domains of the influenza Matrix. The 1164 fragment seems to be
stable in vitro even after treatment with acidic conditions
(47). It is possible that this fragment is also stable in
vivo and that the inability of the fragment 1164 to sensitize
LMP-negative cells for lysis may have resulted from a longer half-life
than those of the other fragments.
It has been suggested that a proportion of class I binding peptides is derived from the degradation of defective ribosomal products (61). The lack of killing of .174/TAPs cells infected with either influenza virus or Matrix vaccinia suggests that during expression of the full-length Matrix, there is no generation of shorter fragments capable of sensitizing .174/TAPs cells for lysis by Matrix 5866-specific CTL. In contrast, treatment of the same cells with the antibiotic puromycin relieves this blocks and leads to an efficient presentation of the Matrix 5866 epitope. The effect of puromycin on the generation of the Matrix A2 epitope is likely to result from the generation of Matrix premature termination products. However, we cannot rule out the possibility that the puromycin effect may result from other mechanisms, such as inhibition of puromycin-sensitive aminopeptidases (62, 63).
While these results demonstrate that presentation of a LMP7-dependent epitope can be relieved by increasing the rate of degradation of the target protein, we cannot generalize these findings to other LMP2- and/or LMP7-dependent epitopes encoded within short-lived proteins. We previously showed that presentation of the LMP-dependent influenza NP epitope 366374 by H-2 Db molecules cannot be relieved by infecting LMP-deficient cells with a rapidly degraded form of the influenza NP (37). It is becoming clear that the immunogenicity of a protein cannot always be predicted from its degradation rate. Antón et al. demonstrated efficient peptide generation in the presence of doses of proteasome inhibitors sufficient to completely block the target protein degradation (12). An increased rate of degradation of a cytosolic protein would lead to enhanced Ag presentation if the protease(s) responsible for its degradation would also be capable of generating the antigenic peptide. In this respect it is of interest that degradation of the short-lived influenza NP is lactacystin sensitive (4), while degradation of a large proportion of the short-lived form of the Matrix protein is lactacystin resistant (data not shown).
In conclusion, we have investigated the processing events for the
generation of a defined CTL epitope contained within the influenza
Matrix protein. Our results illustrate two main points: firstly, we
show that binding of a mutated form of LMP7 to the proteasome can
relieve a defined block in presentation of an immunodominant viral
epitope; and secondly, we demonstrate that altering the half-life of a
target protein may overcome a block in presentation of an
immunoproteasome-dependent CTL epitope. These observations demonstrate
the importance of the interplay between immunoproteasomes and protein
turnover in the generation of CTL epitopes. Release of IFN-
by
virus- or tumor-specific CTL may result in the modulation of proteasome
subunit composition and may alter the processing patterns of viral and
tumor Ags. Different target cells may optimize Ag presentation by
generating protein fragments that could overcome the lack of expression
of IFN-
-inducible proteasome subunits.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 U.G. and H.T.M.T. contributed equally to this work. ![]()
3 Address correspondence and reprint requests to Dr. Vincenzo Cerundolo, Institute of Molecular Medicine, John Radcliffe Hospital, Oxford, U.K OX3 9DS. E-mail address: ![]()
4 Abbreviations used in this paper: LMP, low molecular protein; NP, nucleoprotein. ![]()
Received for publication June 14, 1999. Accepted for publication September 14, 1999.
| References |
|---|
|
|
|---|
exposes a cryptic cytotoxic T lymphocyte epitope in HIV-1 reverse transcriptase. J. Immunol. 162:7075.
-Interferon and expression of MHC genes regulate peptide hydrolysis by proteasomes [published erratum appears in 1995, Nature 374:290]. Nature 365:264.[Medline]
stimulation modulates the proteolytic activity and cleavage site preference of 20S mouse proteasomes. J. Exp. Med. 179:901.
. Eur. J. Immunol. 25:2605.[Medline]
and major histocompatibility
complex-encoded subunits on peptidase activities of human
multicatalytic proteases [published errata appear in 1995, Proc.
Natl. Acad. Sci. USA 92:3632; and 1995,92:7605].
Proc. Natl. Acad. Sci. USA 92:584.
This article has been cited by other articles:
![]() |
M. J. Palmowski, U. Gileadi, M. Salio, A. Gallimore, M. Millrain, E. James, C. Addey, D. Scott, J. Dyson, E. Simpson, et al. Role of Immunoproteasomes in Cross-Presentation J. Immunol., July 15, 2006; 177(2): 983 - 990. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chapatte, M. Ayyoub, S. Morel, A.-L. Peitrequin, N. Levy, C. Servis, B. J. Van den Eynde, D. Valmori, and F. Levy Processing of Tumor-Associated Antigen by the Proteasomes of Dendritic Cells Controls In vivo T-Cell Responses. Cancer Res., May 15, 2006; 66(10): 5461 - 5468. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Ito, E. Kondo, A. Demachi-Okamura, Y. Akatsuka, K. Tsujimura, M. Tanimoto, Y. Morishima, T. Takahashi, and K. Kuzushima Three Immunoproteasome-Associated Subunits Cooperatively Generate a Cytotoxic T-Lymphocyte Epitope of Epstein-Barr Virus LMP2A by Overcoming Specific Structures Resistant to Epitope Liberation J. Virol., January 15, 2006; 80(2): 883 - 890. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Chapiro, S. Claverol, F. Piette, W. Ma, V. Stroobant, B. Guillaume, J.-E. Gairin, S. Morel, O. Burlet-Schiltz, B. Monsarrat, et al. Destructive Cleavage of Antigenic Peptides Either by the Immunoproteasome or by the Standard Proteasome Results in Differential Antigen Presentation J. Immunol., January 15, 2006; 176(2): 1053 - 1061. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Bruder, A. K. Nussbaum, D. M. Gakamsky, M. Schirle, S. Stevanovic, H. Singh-Jasuja, A. Darji, T. Chakraborty, H. Schild, I. Pecht, et al. Multiple synergizing factors contribute to the strength of the CD8+ T cell response against listeriolysin O Int. Immunol., January 1, 2006; 18(1): 89 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. F. Towne, I. A. York, J. Neijssen, M. L. Karow, A. J. Murphy, D. M. Valenzuela, G. D. Yancopoulos, J. J. Neefjes, and K. L. Rock Leucine Aminopeptidase Is Not Essential for Trimming Peptides in the Cytosol or Generating Epitopes for MHC Class I Antigen Presentation J. Immunol., November 15, 2005; 175(10): 6605 - 6614. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. K. Nussbaum, M. P. Rodriguez-Carreno, N. Benning, J. Botten, and J. L. Whitton Immunoproteasome-Deficient Mice Mount Largely Normal CD8+ T Cell Responses to Lymphocytic Choriomeningitis Virus Infection and DNA Vaccination J. Immunol., July 15, 2005; 175(2): 1153 - 1160. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Nagata, T. Hanagiri, M. Takenoyama, T. Fukuyama, M. Mizukami, T. So, Y. Ichiki, M. Sugaya, K. Sugio, and K. Yasumoto Identification of the HLA-Cw*0702-Restricted Tumor-Associated Antigen Recognized by a CTL Clone from a Lung Cancer Patient Clin. Cancer Res., July 15, 2005; 11(14): 5265 - 5272. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. So, M. Takenoyama, M. Mizukami, Y. Ichiki, M. Sugaya, T. Hanagiri, K. Sugio, and K. Yasumoto Haplotype Loss of HLA Class I Antigen as an Escape Mechanism from Immune Attack in Lung Cancer Cancer Res., July 1, 2005; 65(13): 5945 - 5952. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. N. Golovina, S. E. Morrison, and L. C. Eisenlohr The Impact of Misfolding versus Targeted Degradation on the Efficiency of the MHC Class I-Restricted Antigen Processing J. Immunol., March 1, 2005; 174(5): 2763 - 2769. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Basler, N. Youhnovski, M. van den Broek, M. Przybylski, and M. Groettrup Immunoproteasomes Down-Regulate Presentation of a Subdominant T Cell Epitope from Lymphocytic Choriomeningitis Virus J. Immunol., September 15, 2004; 173(6): 3925 - 3934. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kan-Mitchell, B. Bisikirska, F. Wong-Staal, K. L. Schaubert, M. Bajcz, and M. Bereta The HIV-1 HLA-A2-SLYNTVATL Is a Help-Independent CTL Epitope J. Immunol., May 1, 2004; 172(9): 5249 - 5261. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Lautscham, T. Haigh, S. Mayrhofer, G. Taylor, D. Croom-Carter, A. Leese, S. Gadola, V. Cerundolo, A. Rickinson, and N. Blake Identification of a TAP-Independent, Immunoproteasome-Dependent CD8+ T-Cell Epitope in Epstein-Barr Virus Latent Membrane Protein 2 J. Virol., February 15, 2003; 77(4): 2757 - 2761. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sun, A. J. A. M. Sijts, M. Song, K. Janek, A. K. Nussbaum, S. Kral, M. Schirle, S. Stevanovic, A. Paschen, H. Schild, et al. Expression of the Proteasome Activator PA28 Rescues the Presentation of a Cytotoxic T Lymphocyte Epitope on Melanoma Cells Cancer Res., May 1, 2002; 62(10): 2875 - 2882. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. S. Schultz, J. Chapiro, C. Lurquin, S. Claverol, O. Burlet-Schiltz, G. Warnier, V. Russo, S. Morel, F. Levy, T. Boon, et al. The Production of a New MAGE-3 Peptide Presented to Cytolytic T Lymphocytes by HLA-B40 Requires the Immunoproteasome J. Exp. Med., February 11, 2002; 195(4): 391 - 399. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Khan, M. van den Broek, K. Schwarz, R. de Giuli, P.-A. Diener, and M. Groettrup Immunoproteasomes Largely Replace Constitutive Proteasomes During an Antiviral and Antibacterial Immune Response in the Liver J. Immunol., December 15, 2001; 167(12): 6859 - 6868. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Evans, L. K. Borysiewicz, A. S. Evans, M. Rowe, M. Jones, U. Gileadi, V. Cerundolo, and S. Man Antigen Processing Defects in Cervical Carcinomas Limit the Presentation of a CTL Epitope from Human Papillomavirus 16 E6 J. Immunol., November 1, 2001; 167(9): 5420 - 5428. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.E.M. Toes, A.K. Nussbaum, S. Degermann, M. Schirle, N.P.N. Emmerich, M. Kraft, C. Laplace, A. Zwinderman, T.P. Dick, J. Muller, et al. Discrete Cleavage Motifs of Constitutive and Immunoproteasomes Revealed by Quantitative Analysis of Cleavage Products J. Exp. Med., June 25, 2001; 194(1): 1 - 12. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Karanikas, D. Colau, J.-F. Baurain, R. Chiari, J. Thonnard, I. Gutierrez-Roelens, C. Goffinet, E. V. Schaftingen, P. Weynants, T. Boon, et al. High Frequency of Cytolytic T Lymphocytes Directed against a Tumor-specific Mutated Antigen Detectable with HLA Tetramers in the Blood of a Lung Carcinoma Patient with Long Survival Cancer Res., May 1, 2001; 61(9): 3718 - 3724. [Abstract] [Full Text] |
||||
![]() |
K. Schwarz, M. van den Broek, S. Kostka, R. Kraft, A. Soza, G. Schmidtke, P.-M. Kloetzel, and M. Groettrup Overexpression of the Proteasome Subunits LMP2, LMP7, and MECL-1, But Not PA28{alpha}/{beta}, Enhances the Presentation of an Immunodominant Lymphocytic Choriomeningitis Virus T Cell Epitope J. Immunol., July 15, 2000; 165(2): 768 - 778. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-L. Chen, P. R. Dunbar, U. Gileadi, E. Jager, S. Gnjatic, Y. Nagata, E. Stockert, D. L. Panicali, Y.-T. Chen, A. Knuth, et al. Identification of NY-ESO-1 Peptide Analogues Capable of Improved Stimulation of Tumor-Reactive CTL J. Immunol., July 15, 2000; 165(2): 948 - 955. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |