The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, M. P.
Right arrow Articles by Dorshkind, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, M. P.
Right arrow Articles by Dorshkind, K.
The Journal of Immunology, 1999, 163: 5883-5890.
Copyright © 1999 by The American Association of Immunologists

Proliferation of Bone Marrow Pro-B Cells Is Dependent on Stimulation by the Pituitary/Thyroid Axis1

Melanie P. Foster, Encarnacion Montecino-Rodriguez and Kenneth Dorshkind3

Department of Pathology and Laboratory Medicine and Jonsson Comprehensive Cancer Center, School of Medicine, University of California, Los Angeles, CA 90095


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The frequency and absolute number of pro-B, pre-B, and B cells in the bone marrow of the hypothyroid strain of mice are significantly reduced compared with those of their normal littermates. To investigate why this is the case, various B cell developmental processes were examined in the thyroid hormone-deficient mice. These studies revealed that the frequency of pro-B cells in the S-G2/M phase of the cell cycle was significantly reduced in hypothyroid mice. That thyroid hormone deficiency was responsible for this proliferation defect was established by demonstrating that treatment of hypothyroid mice with thyroxine resulted in a specific increase in the frequency and total number of cycling pro-B cells. The latter effect was paralleled by increases in the frequency and number of bone marrow B lineage cells. Additional in vitro experiments revealed that at least some thyroid hormone effects were directly mediated on the bone marrow. Taken together, these data demonstrate that thyroid hormones are required for normal B cell production in the bone marrow through regulation of pro-B cell proliferation and establish a role for the pituitary/thyroid axis in B cell development.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B lymphocytes, like all hemopoietic cells, arise from pluripotent hemopoietic stem cells (1, 2) within the medullary cavity of the bone marrow (3, 4). As committed B cell precursors differentiate, they express various cell surface determinants (5, 6) and rearrange their Ig heavy and light chain genes (7, 8). Although the phenotypic stages of B lymphopoiesis are increasingly well defined, the extracellular signals regulating the production of B lineage cells remain incompletely characterized. Stimuli derived from the bone marrow microenvironment, such as direct cell contact with stromal cells and secreted growth factors, are one source of these signals (3, 4, 9, 10). For example, stromal cell-derived IL-7 (11) acts as a pro-B cell proliferation and differentiation signal (12), and additional stromal cell-derived factors have been shown to synergize with IL-7 to stimulate proliferation of B cell progenitors (10).

It is becoming increasingly apparent that signals of extramedullary origin also affect normal B cell development, and hormones derived from various endocrine tissues are important in this regard (13). For example, B cell development in pregnant mice is suppressed by elevated estrogen levels (14). Conversely, other studies have revealed that hormones produced by the thyroid gland act as obligate, positive regulators of primary B lymphopoiesis (15, 16). This latter conclusion is based on the examination of B lymphopoiesis in several strains of mice deficient in the production of one or more anterior pituitary-derived hormones due to naturally occurring or induced genetic defects (16, 17). These studies revealed that, whereas B lymphopoiesis is normal in animals with defective production of growth hormone, insulin-like growth factor-I, or prolactin, the frequency and absolute number of B lineage cells is significantly decreased only in thyroid hormone-deficient strains. For example, hypothyroid (hyt/hyt) mice produce ~10% of normal thyroid hormone levels due to the inability of thyroid epithelial cells to bind thyroid-stimulating hormone (18, 19, 20). The frequency of B lineage cells was reduced by up to 70% in hyt/hyt mice, and this deficiency could be completely corrected by administration of thyroxine (T4) (16). These hemopoietic defects in thyroid hormone-deficient mice only affect cell production in the B lineage, given that no significant differences in myeloid cell frequencies or numbers were observed (16).

The mechanism(s) responsible for the specific decrease in the production of B lineage cells in hyt/hyt mice has not been defined. Thyroid hormones have been shown to regulate cell proliferation, differentiation, and death during embryogenesis and postnatal life (reviewed in 21), and normal B cell development is dependent on the coordination of all of these processes. For example, the most immature B cell precursors, referred to as pro-B cells, proliferate extensively in the bone marrow to maintain the size of the pro-B cell pool and to generate progeny that will differentiate into Ig-expressing cells (6, 22, 23). The latter event is dependent on the successful recombination of genes that encode the Ig molecule, and those B lineage precursors that are not successful at doing so undergo apoptosis and are eliminated from the bone marrow. Thus, the ultimate production of a B lymphocyte is a dynamic process involving cell growth, cell maturation, and cell death (5, 8, 24, 25, 26), and the tempo of any one of these events could be negatively impacted by the absence of thyroid hormones.

To determine how thyroid hormones affect B lymphopoiesis, various B cell developmental processes were examined in hyt/hyt mice. The results of these analyses indicate that the frequency of proliferating pro-B cells is reduced in that strain and that treatment of the mice with thyroxine increased both the frequency and total number of cycling pro-B cells. Taken together with the results of additional in vitro assays demonstrating that the number of B lineage cells is increased in the presence of thyroid hormones, these data suggest that products of the pituitary/thyroid axis regulate the proliferative potential of developing B cell precursors.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Mice

BALB/c BJ (BALB/c), C.RF-hyt/hyt, and C.RF-+/? (which are either hyt/+ or +/+) mice were obtained from The Jackson Laboratory (Bar Harbor, ME). The hyt/hyt mice were 8 to 12 wk of age and had been removed from normal littermates for at least 2 wk before the experiment to eliminate potential hormonal effects transferred to them. All of the mice were housed in microisolator cages under laminar flow conditions in the Division of Laboratory Animal Medicine vivarium at UCLA.

In some experiments, mice received an i.v. injection of 150 mg/kg 5-fluorouracil (5-FU,2 Sigma, St. Louis, MO (2, 27)) 8 days before analysis. In addition, some of the 5-FU-treated animals received a daily s.c. injection of 2 µg of DL-thyroxine (T4; T-0881; Sigma) or saline for 8 days. T4 was used for these studies because it is more stable and has a longer duration of in vivo activity than triiodothyronine (T3) (28).

Preparation of cell suspensions

Mice were killed by cervical dislocation. A single-cell suspension of bone marrow cells was obtained by flushing femurs and tibiae with 3 ml {alpha}-MEM (Life Technologies, Grand Island, NY). Cells were counted in a hemacytometer, and cell viability, determined by eosin dye exclusion, always exceeded 95%.

Immunofluorescence

Bone marrow cells were incubated with the following Abs: FITC-conjugated anti-IgM (Southern Biotechnology, Birmingham, AL), FITC-conjugated heat-stable Ag (HSA), PE-conjugated anti-CD45R (B220, clone RA3-6B2), biotin-conjugated anti-CD43 (clone S7), or FITC-conjugated anti-CD25 (clone 7D4; PharMingen, San Diego, CA). Biotinylated Abs were revealed with FITC-conjugated streptavidin (Southern Biotechnology). After RBC lysis by osmotic shock, samples were incubated with an anti-murine Fc{gamma}II and III receptor Ab (CD16/32, clone 2.4G2, PharMingen) to reduce nonspecific labeling before the addition of one or more of the above Abs. All stainings were conducted in Ca2+-, Mg2+-free PBS (Life Technologies) on ice. After the last wash, 104 cells from each sample were analyzed on a FACScan (Becton Dickinson, San Jose, CA) with CELL Quest software (Becton Dickinson).

Enrichment of CD45R+ cells

Bone marrow CD45R+ cells were enriched by using a magnetic activated cell sorter column (Miltenyi Biotec, Auburn, CA) according to the manufacturer’s protocol. Briefly, after incubation with anti-CD32/CD16 Ab, cells were incubated with anti-murine CD45R-conjugated superparamagnetic beads in Ca2+-, Mg2+-free PBS, 5 mM EDTA, 0.5% BSA, pH 7.2 (all from Sigma) for 25 min at 6–8°C under constant agitation. The cells were then washed and loaded on the magnetic activated cell sorter column placed in its magnetic support. The column was rinsed with 3 to 4 times the column volume to remove the negative cells, and the positive fraction was eluted from the column after its removal from the magnetic support. CD45R+ cell enrichment ranged from 60 to 95% depending on the experiment.

In some experiments, CD45R+sIgM- cells were purified on a FACStarPlus cell sorter (Becton Dickinson) after incubations with FITC-anti-IgM and PE-anti-CD45R Abs.

Incubation with anti-murine CD45R-conjugated superparamagnetic beads or fluorochromes did not interfere with subsequent immunofluorescence analysis or in vitro culture experiments (data not shown).

Cell cycle analysis

Cells were fixed in 0.5% paraformaldehyde for 15 min at room temperature. The cells were then permeabilized with 70% ethanol and resuspended in Ca2+-, Mg2+-free PBS supplemented with 1 µg/ml 7-amino actinomycin D (7-AAD) (Calbiochem, San Diego, CA). At least 3 x 104 cells were acquired with a FACScan, and their cycling status was estimated using Modfit LT software (Verity Software House, Topsham, ME). The coefficient of variation for the G0/G1 peak obtained during these analyses was on average <5%.

Detection of apoptotic cells

Apoptotic cells were detected by their increased permeability to the DNA dye 7-AAD (29). After immunostaining for CD45R, CD43, and/or IgM expression, 5 x 105 CD45R+ or cultured bone marrow cells were incubated with 1 µg/ml 7-AAD in Ca2+, Mg2+ free PBS. Following 15–30 min incubation, cells were analyzed on a FACScan equipped with a double discrimination module. Gates were set on the basis of staining with secondary reagent alone. Dead cells were excluded based on their forward and side scatter profile. Apoptosis was analyzed with CELL Quest software (Becton Dickinson).

Apoptotic cells were also detected by annexin V staining (R&D Systems, Minneapolis, MN). Following immunostaining for CD45R expression, 3 x 105 cells were resuspended in binding buffer (10 mM HEPES/NaOH, pH 7.4, 140 mM NaCl, and 2.5 mM CaCl2) and incubated with FITC-conjugated annexin V for 15 min at room temperature in the dark according to the manufacturer’s instructions.

Long term bone marrow cultures

Long term myeloid cultures were established as described (30). After 4 wk, these cultures were switched to B lymphoid-permissive conditions (31, 32). At the time of switch and at each weekly feeding thereafter, the culture medium was supplemented with 10-8 M T3 or saline. T3 was used in these studies because it was not clear that all the requirements for conversion of T4 to T3, the most active form of the hormone (28), would be present in the cultures. Cells harvested from at least three cultures per condition were analyzed weekly for emergence of CD45R+sIgM- and sIgM+ cells by immunofluorescence.

RT-PCR and Southern blot analysis

Subpopulations of bone marrow B lineage cells from BALB/c mice were purified into fraction A (HSA-, CD45R+, CD43+), fraction B + C (HSA+, CD45R+, CD43+), fraction D (CD45R+, CD43-, sIgM-), and Fraction E + F (CD45R+, CD43-, sIgM+) based on the protocol described by Hardy et al. (6) on a FACSadvantage in the UCLA flow cytometry core facility. After sorting, mRNA was prepared according to the manufacturer’s directions (Pharmacia Biotech, Piscataway, NJ) and was reverse-transcribed into cDNA with the use of the same number of cells from each sorted fraction. The cDNA was amplified with the following primers. thyroid hormone receptor (TR) {alpha} gene common 5'-primer, CGCAAGCTGATTGAGCAGAAC; TR{alpha}1, 3'-AGCCACTTCCGTGTCATCCAG (549 bp). TR{alpha}2, 3'-AGCAGCTCCAGGAGACGCTGC TGC (933 bp). TRß gene common 3'-primer, ACAGAGCTCATCTTTGTCTAAATAG (33); TRß1, 5'-GGTGGTACCAAGTTCCACACATG (410 bp). TRß2, 5'-GGTTATTCATCCCCTCTCTTGTTTCATGTGTATG (480 bp). GAPDH primers 5'-CCATGGAGAAGGCTGGGG and 3'-CAAAGTTGTCATGGATGACC (200 bp) were also used to ensure DNA integrity.

PCR amplification was performed in a final volume of 100 µl containing 10 mM Tris-HCl (pH 8.3); 2.5 mM, 1.5 mM, and 3.5 mM MgCl2 for TR{alpha}1, TR{alpha}2, and TRß1/2, respectively; 600 µM concentrations each of the dATP, dGTP, dUTP, and TTP; 1.0 µM concentrations of the primers; 50 mM KCl; and 2.5 U Taq polymerase (Perkin-Elmer Cetus, Norwalk, CT). Cycles, repeated 30–35 times, consisted of 1 min of denaturation at 94°C; 1 min annealing at 59°C for TR{alpha}1, TRß1, TRß2, and GAPDH and at 63°C for TR{alpha}2; and 1 min of polymerization at 72°C. The final polymerization step was extended an additional 15 min. A Perkin-Elmer Thermal Cycler was used for all reactions. PCR fragments were transferred to nylon membranes as described (34) and detected with murine TR{alpha}1, TR{alpha}2, TRß1, and TRß2 radioactive probes.

Proliferation assay

Sorted CD45R+sIgM- cells (105/well) were distributed in 96-well plates, either over irradiated confluent S17 stromal cells (35) or without stroma, in Iscove’s medium (Life Technologies) supplemented with 5% FBS and L-glutamine (Life Technologies) and incubated for 3 days in a humidified incubator at 37°C and 5% CO2/air. Some wells were additionally supplemented with 10-8 M T3 and/or 50 U/ml recombinant murine IL-7 (Biosource International, Camarillo, CA). A parallel set of cultures was also established with FBS from which 85% of the T3 and 92% of T4 had been depleted (36), as confirmed by RIA performed in the UCLA Department of Pathology Clinical Laboratories (data not shown). Cultures were then pulsed with 1 µCi/well [methyl-3H]thymidine during the last 16 h of culture, and specific incorporation by the cells was determined.

Statistics

Data were analyzed using a single-tailed Student t test.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B cell development is suppressed in thyroid hormone-deficient mice

The data in Fig. 1Go show, in agreement with previously published results (16), that the frequency of CD45R+ IgM- pro/pre-B and surface IgM+ B cells is lower in hyt/hyt mice than in their normal +/? littermates. The absolute number of B lineage cells is also lower in the hormone-deficient mice (Ref. 16 and data not shown).



View larger version (28K):
[in this window]
[in a new window]
 
FIGURE 1. B lymphopoiesis in hyt/hyt mice. FACScan profiles of B lineage cells in the bone marrow of (A) +/? and (B) hyt/hyt mice. Representative data from one of three experiments are shown.

 
B lineage cells in hyt/hyt mice do not have an increased rate of apoptosis

An increased rate of apoptosis could explain the decreased number and frequency of B lineage cells in hyt/hyt mice. To investigate this possibility, the frequency of apoptotic hyt/hyt and +/? bone marrow B lineage cells was determined by measuring membrane permeability to 7-AAD. Attempts were made in initial experiments to assess the frequency of apoptosis in B lineage cells in unfractionated hyt/hyt bone marrow, but the low numbers of pro-B/pre-B cells in that strain made this analysis difficult. Therefore, CD45R+ cells from the bone marrow of hyt/hyt mice were enriched on a magnetic column before analysis in subsequent experiments.

Large CD45R+sIgM- cells are the B lineage population with the highest incidence of apoptosis (37). Because cells with these physical and phenotypic characteristics are included in the CD45R+CD43+ pro-B cell population (38), initial experiments focused on defining the frequency of apoptotic cells in that compartment. As shown in Table IGo, the frequency of apoptotic CD45R+CD43+ pro-B cells in hyt/hyt and +/? mice was comparable. A similar conclusion was reached when the analysis was performed on sIgM+ B cells, which have the next highest incidence of apoptosis (37), and CD45R+sIgM- cells or when the same analyses were repeated using propidium iodide staining to detect hypodiploid DNA (data not shown).


View this table:
[in this window]
[in a new window]
 
Table I. Pro-B cells in the bone marrow of hyt/hyt mice do not have an increased rate of apoptosisa

 
Because apoptotic cells are rapidly deleted from the bone marrow, the number detectable at any one time is low (37). Therefore, a short term culture system described by Lu and Osmond (37) that allows the accumulation and enumeration of apoptotic cells was used. Bone marrow cells from both hyt/hyt and +/? mice were incubated for up to 6 h, and apoptosis was examined by both membrane permeability and annexin V staining. The frequency of apoptotic B lineage cells from both hyt/hyt and +/? mice was similar in this assay (data not shown).

Bone marrow B lineage cells from hyt/hyt mice show a reduced proliferative capacity

To determine whether thyroid hormone deficiency affects the proliferative status of B lineage cells in hyt/hyt mice, their cycling status was examined. Similar to what was encountered in the apoptosis studies, attempts to assess the frequency of S-G2/M phase B lineage cells in unfractionated hyt/hyt bone marrow were unsuccessful due to the low numbers of pro-B/pre-B cells (data not shown). Because most cycling B lineage cells are found in the pro-B cell compartment (6, 22), in subsequent studies hyt/hyt and +/? bone marrow cells were labeled with a combination of Abs that would permit the cycling status of enriched CD45R+CD43+ pro-B cells to be assessed.

The data in Table IIGo show results from three experiments in which the cell cycle status of these enriched CD45R+CD43+ pro-B cells from hyt/hyt mice and their +/? littermates was compared. A consistent finding in all three experiments was that the frequency of pro-B cells in the S-G2/M phase of the cell cycle was significantly lower in hyt/hyt mice than in their +/? littermates. In agreement with Hardy et al. (6), the frequency of S-G2/M phase CD45R+ CD43- pre-B and B cells was comparatively lower, and no significant differences were observed in the cycling status of these populations in hyt/hyt and +/? mice. For example, in one representative study, 5.9% of hyt/hyt and 4.8% of +/? CD45R+CD43- cells were in the S-G2/M phase of the cell cycle.


View this table:
[in this window]
[in a new window]
 
Table II. Frequency of cycling pro-B cells in the bone marrow of hyt/hyt mice is reduceda

 
The CD25 cell surface determinant can be used to identify cells at the late pro-B (fraction C') to pre-B cell (fraction D) stages of development (39). To define further the pro-B cell stage at which the proliferation defect is manifest, additional studies examined CD45R+CD25+ bone marrow cells from both hyt/hyt mice and their +/? littermates. The data demonstrate that there was no difference in the frequency of proliferating large or small CD45R+CD25+ bone marrow cells between hyt/hyt mice and their +/? littermates (data not shown).

Bone marrow pro-B cells from 5-FU-treated hyt/hyt mice show a reduced proliferative capacity

The above results strongly suggest that the proliferative potential of pro-B cells is compromised in hyt/hyt mice. To accentuate this defect, de novo pro-B cell proliferation was induced by treating the mice with the cytostatic drug 5-FU. After treatment, cycling bone marrow cells are eliminated (27, 40), and resting immature hemopoietic progenitors are driven into cell cycle to replenish the myeloid and lymphoid compartments in the marrow. Whether or not hyt/hyt mice would also show a pro-B cell proliferation defect in this model was thus investigated.

Fig. 2Go shows a representative experiment demonstrating that the frequency of cycling CD45R+CD43+ pro-B cells in 5-FU-treated hyt/hyt mice (84.5%) was significantly lower than in their +/? littermates (96.2%) 8 days after 5-FU treatment. The latter time point was chosen based on a report showing that at 8 days post-5-FU treatment, immature hemopoietic progenitors are actively cycling (41), and preliminary experiments in which the cell cycle status of bone marrow from 5-FU-treated mice was examined at different times after drug injection (data not shown). Similar results were also obtained in two additional experiments (Table IIIGo).



View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 2. Cell cycle status of bone marrow B lineage cells from hyt/hyt and +/? mice. FACScan profiles of B lineage cells and cell cycle histograms of pro-B cells in the bone marrow of +/? (A) and hyt/hyt (B) mice after treatment with 5-FU. Data are representative of one of three experiments using a total of 2–4 mice per group and were analyzed using ModFit LT software.

 

View this table:
[in this window]
[in a new window]
 
Table III. Effect of 5-FU on the frequency and cell cycle status of pro-B cells in the bone marrow of hyt/hyt and +/? micea

 
The data in Table IIIGo further demonstrate that the absolute number of cycling pro-B cells in hyt/hyt mice was lower than in their +/? littermates and that, consistent with previous findings (16), hyt/hyt mice had a significantly lower frequency and a reduced absolute number of CD45R+CD43+ pro-B cells.

Thyroxine treatment increases the number of cycling pro-B cells in hyt/hyt mice

To determine whether thyroid hormones could increase the frequency of cycling pro-B cells in hyt/hyt mice, animals were treated daily with either T4 or saline for 8 days after 5-FU injection. As shown in Table IVGo, T4 treatment increased the frequency of cycling CD45R+CD43+ cells in 5-FU-treated hyt/hyt mice by up to 10%. In one experiment (Fig. 3Go), 70.8% of CD45R+CD43+ cells were in cycle in the saline-treated mice, whereas 81% of the pro-B cells were in S-G2/M in the T4-treated group. In addition to the increase in the frequency of S-G2/M pro-B cells, T4 treatment also resulted in a significant increase in the absolute number of cycling pro-B cells. This effect was paralleled by increases in the frequency and absolute number of total pro-B cells (Table IVGo).


View this table:
[in this window]
[in a new window]
 
Table IV. Effect of T4 on the cycling status of pro-B cells in 5-FU-treated hyt/hyt micea

 


View larger version (40K):
[in this window]
[in a new window]
 
FIGURE 3. Cell cycle status of bone marrow B lineage cells from hyt/hyt mice after T4 treatment. FACScan profiles of B lineage cells and cell cycle histograms of pro-B cells in the bone marrow of hyt/hyt mice that received a daily injection of either saline (A) or T4 (B) after 5-FU treatment. Data are representative of two identical studies using a total of 3–4 mice per group and were analyzed using ModFit LT software.

 
Concomitant with the increase in B lineage cells in the T4-treated animals, there was a significant (p < 0.05) decline in the frequency of non-B lineage cells. For example, in experiment 1, 88.4% of bone marrow cells were CD45R- in 5-FU/saline-treated hyt/hyt mice, whereas only 73.4% were CD45R- in the 5-FU/T4-treated group (data not shown).

Thyroid hormones have direct effects on the bone marrow

To examine whether thyroid hormones can directly affect the bone marrow, the biologically active form of thyroid hormone, T3, was added to myeloid long term bone marrow cultures at the time of their transfer to B lymphoid-permissive conditions (32). In this system, myelopoiesis declines and B lymphopoiesis initiates and plateaus at 4 wk after transfer to the lymphoid culture conditions. As shown in Fig. 4Go, the kinetics of when B lineage cells emerge in the cultures was not affected by the addition of T3 to the cultures. However, between weeks 1 and 3, the period during which the transition from myelopoiesis to B lymphopoiesis occurs, the frequency and absolute number of CD45R+sIgM- cells were significantly increased in the T3-supplemented cultures (Fig. 4Go and Table VGo).



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 4. Effects of T3 on B lymphopoiesis in long term bone marrow cultures. The frequency of CD45R+sIgM- ({square}, {blacksquare}) and CD45R+sIgM+ ({circ}, •) cells in cultures supplemented with 10-8 M T3 (•, {blacksquare}) or medium only ({circ}, {square}) is shown. *, p < 0.001, and **, p < 0.0025, indicates a significant difference between cultures with and without T3. Each time point is based on analyzing 3 to 5 cultures. Results are representative of three experiments.

 

View this table:
[in this window]
[in a new window]
 
Table V. Effect of T3 on production of CD45R+ sIgM- cells in long term bone marrow culturesa

 
TRs are expressed throughout B cell development

In view of the ability of thyroid hormones to affect bone marrow B lymphopoiesis, the expression of TRs was examined on subpopulations of bone marrow B lineage cells by RT-PCR and Southern blot analysis. TRs are expressed from two genes, {alpha} and ß, and both produce different isoforms due to alternative splicing events (42, 43, 44). As shown in Fig. 5Go, TR{alpha}1 and TRß1 were constitutively expressed throughout B cell development, whereas TRß2 was not detected. On the other hand, TR{alpha}2 was detected in fractions A–C, down-regulated in fraction D, and up-regulated in fraction E + F.



View larger version (62K):
[in this window]
[in a new window]
 
FIGURE 5. TR expression during B cell development. The expression of TR{alpha}1, TR{alpha}2, TRß1, and TRß2 was determined on bone marrow B lineage cells sorted into Hardy fractions A, B + C, D, and E + F by RT-PCR and Southern blot analysis. Results are representative of one of three experiments.

 
Thyroid hormones do not function as pro-B cell mitogens or proliferation cofactors

The expression of the TR on bone marrow pro-B cells provided the rationale for assessing whether or not thyroid hormones had direct effects on cells in that compartment. Purified CD45R+sIgM- bone marrow cells from hyt/hyt mice were cultured with 10-8 M T3 for 72 h. Because hyt/hyt cells were "maintained" in a thyroid hormone-deficient environment, it was reasoned that hormone effects would be more demonstrable on these targets than on similar cell populations from normal animals. As shown in Fig. 6Go, T3 did not stimulate proliferation of CD45R+sIgM- cells in medium containing FBS or thyroid hormone-depleted FBS in cultures analyzed at 3 and 7 (data not shown) days postinitiation. However, cells cultured in either of these conditions exhibited vigorous proliferation in response to the pro-B cell growth factor IL-7. No proliferative effects of T3 were noted when cultures were examined at 24 and 48 h (data not shown).



View larger version (21K):
[in this window]
[in a new window]
 
FIGURE 6. Effect of T3 on the proliferation of hyt/hyt CD45R+sIgM- bone marrow cells. Proliferation was measured in medium containing FBS ({blacksquare}) or thyroid hormone-depleted FBS () supplemented with 10-8 M T3, IL-7, or T3 + IL-7. Data based on analysis of three wells per condition.

 
A class of proliferation cofactors, that includes flk2/flt3 ligand and c-kit ligand, has been described (10). Cytokines in this category do not act alone to stimulate pro/pre-B cell proliferation but can synergize with IL-7. To determine whether thyroid hormones function in this manner, the proliferative response of CD45R+sIgM- cells to IL-7 and IL-7 + thyroid hormones was compared. The data in Fig. 6Go further show that 3 days after initiation of cultures, the proliferative response of cells under these two combinations was comparable. A similar conclusion was reached when in repeat experiments the culture time was extended to 7 days (data not shown).

Finally, additional experiments were performed in which sorted CD45R+sIgM- cells from hyt/hyt mice were seeded over irradiated S17 stromal cells in the presence of IL-7 alone, T3 alone, or IL-7 + T3 for 1–3 days. T3 again had no effect on cell proliferation under these conditions (data not shown).


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B lymphocyte development in the bone marrow is regulated by a variety of extracellular signals that affect the differentiation, survival, and proliferation of developing B lineage cells (3, 4, 5, 9). Although many of these stimuli are produced by the bone marrow microenvironment, there is growing evidence that factors of extramedullary origin also affect primary B lymphopoiesis. In this regard, recent reports from this laboratory in which mice with defects of the pituitary/thyroid axis were studied revealed that thyroid hormones are obligate, positive regulators of B cell differentiation (16). For example, the absolute number and frequency of B lineage cells are reduced in hyt/hyt mice compared with their normal littermate controls. However, although the initial evaluation of this strain clearly documented a role for thyroid hormones in B cell development (16), how they mediate their effect(s) was not determined. Accordingly, the aim of the present study was to determine how thyroid hormone affect B lymphopoiesis.

Reduced concentrations of thyroid hormones in hyt/hyt mice could compromise B lymphopoiesis through effects on the differentiation, survival, and/or proliferation of B lineage cells. Although the actions of thyroid hormones on the differentiation of B cell progenitors cannot be excluded, such an effect seems unlikely because all stages of B lymphopoiesis are present in hyt/hyt mice. Furthermore, the frequency of the most immature, committed CD45R+CD43+HSA- B cell precursors (Hardy fraction A) is comparable in hyt/hyt mice and their +/? littermates (16), suggesting that the differentiation of pluripotential stem cells and/or lymphoid stem cells into the B cell lineage is not compromised. Therefore, it was logical to propose that the deficiency of B lineage cells in the absence of thyroid hormone was caused by a decrease in survival or proliferation of committed B cell precursors. No evidence to support a role for thyroid hormones in the survival of B lineage cells was obtained in this study. Even though multiple techniques allowing detection of cells at early and late stages of apoptosis were used, no differences in the frequency of apoptotic B lineage cells between hyt/hyt mice and their normal littermates were revealed. Therefore, subsequent experiments focused on whether or not thyroid hormones could affect the proliferation of B cell progenitors.

In the first set of experiments, the cell cycle status of CD45R+CD43+ pro-B cells in hyt/hyt mice was compared with that in their +/? littermates. The pro-B cell compartment was the focus of these studies because B cell progenitors with the highest rate of proliferation are included in it (6), and no differences in the frequency of cycling CD45R+CD43- (pre-B and B) cells in hyt/hyt and +/? mice were observed. The data demonstrated a requirement for thyroid hormones in pro-B cell proliferation. On average, 23.8% of CD45R+CD43+ cells in hyt/hyt mice were in cycle, whereas in the +/? littermates 29% were in the S-G2/M phase of the cell cycle. The expression of the CD25 cell surface determinant was used to delineate at which pro-B cell stage the proliferative defect in hyt/hyt mice occurred. The results showed that there was no difference in the frequency of proliferating CD25+ pro-B cells between hyt/hyt mice and their normal littermates, suggesting that fractions A, B, and early C were affected by the absence of thyroid hormone. The pro-B cell compartment is estimated to contain ~1 million cells (45) that are capable of both differentiation into pre-B cells and self-renewal and that, together, maintain the pro B-cells pool at a constant size. The decreased proliferation of pro-B cells in hyt/hyt mice apparently has profound consequences over time, as substantiated by the significantly lower frequency and absolute numbers of cells in that compartment and on the size of more mature, downstream populations.

This working hypothesis is consistent with the results of Arpin and colleagues who have shown that mice with a targeted disruption of the {alpha} TR also have a defect in pro/pre-B cell proliferation (C. Arpin and J. Marvel, unpublished observations). Thus, whereas the data herein document a pro-B cell proliferation defect in animals with deficient production of thyroid hormones (the ligand), a similar deficiency has been observed in mice with aberrant receptor expression.

To make the requirement for thyroid hormones in pro-B cell proliferation more evident, subsequent experiments in which mice were treated with 5-FU were conducted. In general, the frequency of CD45R+CD43+ bone marrow pro-B cells in the 5-FU-treated hyt/hyt and +/? mice was markedly higher than in their respective saline treated controls or in unmanipulated mice. This result is likely due to the fact that few mature cells are present in the marrow 8 days after 5-FU treatment; there is thus a relative increase in the frequency, and possibly the absolute number, of the pro-B cells. In any case, this model provides a regenerative challenge to which B cell progenitors would not normally be subjected. As expected, the 5-FU treatment accentuated the proliferative deficiency of B lineage cells in hyt/hyt mice, because the average frequency of pro-B cells in the S-G2/M phases of the cell cycle was ~10% lower than in their +/? littermates.

To confirm that the lower frequency of cycling cells in the 5-FU-treated hyt/hyt mice was a result of thyroid hormone deficiency, additional groups of mice were treated with T4 after 5-FU administration. Consistent with its proposed role as a regulator of pro-B cell proliferation, the frequency of cycling CD45R+CD43+ pro-B cells in T4-treated hyt/hyt mice was on average 8% above that in saline-treated hyt/hyt animals. Additionally, the absolute number of cycling pro-B cells in hyt/hyt mice treated with T4 was significantly higher than that in saline-treated mice. These results appear to explain why the frequency of B lineage cells was significantly increased in the T4-treated mice.

The increase in the frequency and absolute number of B lineage cells in the 5-FU/T4-treated hyt/hyt mice was accompanied by a decline in the frequency of CD45R- cells. In one of these experiments, this decline in the frequency of CD45R- cells was paralleled by a lower frequency of proliferating CD45R- cells, which are presumably myeloid (data not shown). There is a well-established, reciprocal relationship between B lymphopoiesis and myelopoiesis (46), so these results are not surprising. Thus, as the number of B lineage cells increased as a result of T4 treatment, there was a proportionate decline in the number of myeloid cells. One possible explanation for this observation is that thyroid hormones might act, not by stimulating B lymphopoiesis, but by inhibiting the growth and/or differentiation of myeloid cells. This seems unlikely for two reasons. First, the addition of T3 to myeloid long term bone marrow cultures had no effect on cell production (data not shown). Additionally, exogenous thyroid hormone had no effect on the number of myeloid colonies generated in response to GM-CSF (data not shown). Taken together, these observations strongly suggest that the decline in the frequency and cycling status of CD45R- cells in T4-treated hyt/hyt mice is not due to direct suppressive effects of thyroid hormones on non-B lineage cells.

To determine the potential for thyroid hormones to affect B lymphopoiesis through direct effects on the bone marrow, T3 was added to long term bone marrow cultures. In these experiments, the kinetics of the emergence of pre-B and B cells in the cultures was not affected. This result is consistent with the previous suggestion that thyroid hormones do not affect pro-B cell differentiation. However, the frequency and absolute number of B lineage cells were significantly higher in T3-supplemented cultures. Although these results do not exclude extramedullary actions of thyroid hormones, the data clearly demonstrated that at least some effects of thyroid hormones are directly mediated on the bone marrow. In addition, they support the observation that thyroid hormone stimulates proliferation of B lineage cells.

In view of these results, further studies were conducted to determine whether or not thyroid hormone affected B lineage cells directly. Initial experiments assessed whether or not the TR was expressed during B lymphopoiesis. TRs are members of a family of ligand-dependent, zinc-finger transcription factors (47, 48). They are encoded by two genes, {alpha} and ß, and alternative splicing produces receptor isoforms. All TRs have DNA-binding domains, and except for TR{alpha}2, ligand-binding domains (49). Upon binding ligand, the receptor/ligand complex then binds DNA and activates gene expression. On the other hand, TR{alpha}2 cannot bind thyroid hormone, but it can still bind DNA and thus acts as a dominant-negative form of the receptor (50). Additionally, TR{alpha}2 has been shown to interfere with transcription activation of the active ligand-binding forms of the receptor (51, 52).

Published results have shown that TR{alpha} mRNA is expressed in chicken bone marrow cells (53) and murine B cell lines (54), but there have been no reports detailing TR expression during each stage of B lymphopoiesis. RT-PCR and Southern blot analysis showed that TR{alpha}1 and TRß1 were constitutively expressed throughout B cell development, whereas TRß2 was not detected. The absence of TRß2 expression was not surprising because it has only been detected in the anterior pituitary and the brain (55, 56). The most striking result of this experiment was the differential regulation of TR{alpha}2 during B lymphopoiesis. The results show that TR{alpha}2 is expressed in fractions A–C, down-regulated at fraction D, and then up-regulated at fraction E + F. Interestingly, thyroid hormone-deficient mice have the greatest decrease in cell frequency and absolute number in fraction D (15). Whether the down-regulation of TR{alpha}2 during the fraction C to D transition is relevant to the dramatic cell loss at fraction D in thyroid hormone-deficient mice is currently being investigated.

The results of the long term culture experiments and the data showing that pro-B cells express TRs {alpha} and ß provided a rationale for experiments to demonstrate a direct effect of T3 on B lineage cells. However, attempts to do so were unsuccessful. T3 did not stimulate the proliferation of sorted CD45R+sIgM- B lineage cells in vitro, nor did it act as an IL-7 proliferation cofactor. Taken together, the inabilities to demonstrate direct growth-promoting effects or IL-7 cofactor activity suggest that thyroid hormones regulate the size of the pro-B cell compartment in an as yet uncharacterized manner.

The challenge will be to determine at the molecular level how thyroid hormones regulate pro-B cell growth. Thyroid hormone acts through its TRs to regulate gene expression (28). In the ligand-bound form, the TRs can activate transcription, whereas in the unbound form, they can repress it (57). Reduced levels of thyroid hormone could thus affect gene regulation by down-regulating expression of thyroid hormone-responsive genes. If these included genes that encoded cyclins and/or cyclin-dependent kinases in early B precursors, their proliferation could be compromised. Alternatively, the TR/thyroid hormone complex may control expression of regulatory proteins that in turn modulate the expression of molecules that inhibit the function of cell cycle proteins. For example, studies have shown that depletion of thyroid hormone inhibited proliferation of human glioblastoma cells and arrested them in G1 through up-regulation of p21, an inhibitor of cyclin-dependent kinases (58). Further studies will be needed to investigate whether a similar effect occurs in pro-B cells. Nevertheless, the data in this report provide an explanation for the decreased frequency of B lineage cells observed in thyroid hormone-deficient mice and further establish a role of the pituitary/thyroid axis in B cell development.


    Acknowledgments
 
We thank Drs. J. Marvel and C. Arpin for critical review of the manuscript.


    Footnotes
 
1 This work was supported by Grant AI21256 from the National Institutes of Health. The Flow Cytometry Core at UCLA is supported in part by Grant CA16042 from the National Institutes of Health. Back

2 Abbreviations used in this paper: 5-FU, 5-fluorouracil; T4, DL-thyroxine; T3, triiodothyronine; HSA, heat-stable Ag; TR, thyroid hormone receptor; 7-AAD, 7-amino actinomycin D. Back

3 Address correspondence and reprint requests to Dr. Kenneth Dorshkind, Division of Pathology and Laboratory Medicine-173216, University of California, Los Angeles, 10833 Le Conte Avenue, Los Angeles, CA 90095. E-mail address: Back

Received for publication March 29, 1999. Accepted for publication July 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Abramson, S., R. G. Miller, R. A. Phillips. 1977. The identification in adult bone marrow of pluripotent and restricted stem cells of the myeloid and lymphoid systems. J. Exp. Med. 145:1567.[Abstract/Free Full Text]
  2. Keller, G., C. Paige, E. Gilboa, E. F. Wagner. 1985. Expression of a foreign gene in myeloid and lymphoid cells derived from multipotent haematopoietic precursors. Nature 318:149.[Medline]
  3. Dorshkind, K.. 1990. Regulation of hematopoiesis by bone marrow stromal cells and their products. Annu. Rev. Immunol. 8:111.[Medline]
  4. Kincade, P. W.. 1987. Experimental models for understanding B lymphocyte formation. Adv. Immunol. 41:145.
  5. Rolink, A., F. Melchers. 1993. B lymphopoiesis in the mouse. Adv. Immunol. 53:123.[Medline]
  6. Hardy, R. R., C. E. Carmack, S. A. Shinton, J. D. Kemp, K. Hayakawa. 1991. Resolution and characterization of pro-B and pre-pro-B cell stages in normal mouse bone marrow. J. Exp. Med. 173:1213.[Abstract/Free Full Text]
  7. Alt, F. W., G. D. Yancopoulos, T. K. Blackwell, C. Wood, E. Thomas, M. Boss, R. Coffman, N. Rosenberg, S. Tonegawa, D. Baltimore. 1984. Ordered rearrangement of immunoglobulin heavy chain variable region segments. EMBO J. 3:1209.[Medline]
  8. Schatz, D. G., M. A Oettinger, M. S. Schlissel. 1992. V(D)J recombination: molecular biology and regulation. Annu. Rev. Immunol. 10:359.[Medline]
  9. Kincade, P. W., G. Lee, C. E. Pietrangeli, S. Hayashi, J. M. Gimble. 1989. Cells and molecules that regulate B lymphopoiesis in bone marrow. Annu. Rev. Immunol. 7:111.[Medline]
  10. Montecino-Rodriguez, E., K. Dorshkind. 1998. Regulation of lymphocyte development by microenvironmental and systemic factors. J. G. Monroe, and E. V. Rothenberg, eds. Molecular Biology of B- and T-Cell Development 197. Humana, Totowa, NJ.
  11. Namen, A. E., S. Lupton, K. Hjerrild, J. Wignall, D. Y. Mochizuki, A. Schmierer, B. Mosley, C. J. March, D. Urdal, S. Gillis, D. Cosman, R. G. Goodwin. 1988. Stimulation of B-cell progenitors by cloned murine interleukin-7. Nature 333:571.[Medline]
  12. Corcoran, A. E., F. M. Smart, R. J. Cowing, T. Crompton, M. J. Owen, A. R. Venkitaraman. 1996. The interleukin-7 receptor {alpha} chain transmits distinct signals for proliferation and differentiation during B lymphopoiesis. EMBO J. 15:1924.[Medline]
  13. Clark, R.. 1997. The somatogenic hormones and insulin-like growth factor-1: stimulators of lymphopoiesis and immune function. Endocr. Rev. 18:157.[Abstract/Free Full Text]
  14. Kincade, P. W., K. L. Medina, G. Smithson. 1994. Sex hormones as negative regulators of lymphopoiesis. Immunol Rev. 137:119.[Medline]
  15. Montecino-Rodriguez, E., R. Clark, A. Johnson, L. Collins, K. Dorshkind. 1996. Defective B cell development in Snell dwarf (dw/dw) mice can be corrected by thryoxine treatment. J. Immunol. 157:3334.[Abstract]
  16. Montecino-Rodriguez, E., R. G. Clark, L. Powell-Braxton, K. Dorshkind. 1997. Primary B cell development is impaired in mice with defects of the pituitary/thyroid axis. J. Immunol. 159:2712.[Abstract]
  17. Horseman, N. D., W. Zhao, E. Montecino-Rodriguez, M. Tanaka, K. Nakashima, S. J. Engle, F. Smith, E. Markoff, K. Dorshkind. 1997. Defective mammopoiesis, but normal hematopoiesis, in mice with a targeted disruption of the prolactin gene. EMBO J. 16:6926.[Medline]
  18. Beamer, W. J., E. M. Eicher, L. J. Maltais, J. L. Southard. 1981. Inherited primary hypothyroidism in mice. Science 212:61.[Abstract/Free Full Text]
  19. Gu, W. X., G. G. Du, P. Kopp, A. Rentoumis, C. Albanese, L. D. Kohn, L. P. Madison, J. L. Jameson. 1995. The thyrotropin (TSH) receptor transmembrane domain mutation (Pro 556-Leu) in the hypothyroid hyt/hyt mouse results in plasma membrane targeting but defective TSH binding. Endocrinology 136:3146.[Abstract]
  20. Stein, S. A., E. L. Oates, C. R. Hall, R. M. Grumbles, L. M. Fernandez, N. A. Taylor, D. Puett, S. Jin. 1994. Identification of a point mutation in the thyrotropin receptor of the hyt/hyt mouse. Mol. Endocrinol. 8:129.[Abstract/Free Full Text]
  21. Fraichard, A., O. Chassande, M. Plateroti, J. P. Roux, J. Trouillas, C. Dehay, C. Legrand, K. Gauthier, M. Kedinger, L. Malaval, B. Rousset, J. Samarut. 1997. The T3R{alpha} gene encoding a thyroid hormone receptor is essential for post-natal development and thyroid hormone production. EMBO J. 16:4412.[Medline]
  22. Landreth, K. S., C. Rosse, J. Clagett. 1981. Myelogenous production and maturation of B lymphocytes in the mouse. J. Immunol. 127:2027.[Abstract]
  23. Osmond, D. G.. 1993. The turnover of B-cell populations. Immunol. Today 14:34.[Medline]
  24. Osmond, D. G.. 1986. Population dynamics of bone marrow B lymphocytes. Immunol. Rev. 93:103.[Medline]
  25. Osmond, D., S. Rico-Vargas, H. Calenzona, L. Fauteux, L. Liu, R. Janai, L. Lu, K. Jacobson. 1994. Apoptosis and macrophage-mediated cell deletion in the regulation of B lymphopoiesis in mouse bone marrow. Immunol. Rev. 142:209.[Medline]
  26. Borghesi, L. A., G. Smithson, P. W. Kincade. 1997. Stromal cell modulation of negative regulatory signals that influence apoptosis and proliferation of B lineage lymphocytes. J. Immunol. 159:4171.[Abstract]
  27. Vetvicka, V., P. W. Kincade, P. L. Witte. 1986. Effects of 5-fluorouracil on B lymphocyte lineage cells. J. Immunol. 137:2405.[Abstract]
  28. Brent, G. A.. 1994. The molecular basis of thyroid hormone action. N. Engl. J. Med. 331:847.[Free Full Text]
  29. Schmid, I., C. H. Uittenbogaart, B. Keld, J. V. Giorgi. 1994. A rapid method for measuring apoptosis and dual-color immunofluorescence by single laser flow cytometry. J. Immunol. Methods 170:145.[Medline]
  30. Dexter, T. M., T. D. Allen, L. G. Lajtha. 1987. Conditions controlling the proliferation of haemopoietic stem cells in vitro. J. Cell. Physiol. 91:335.
  31. Whitlock, C. A., O. N. Witte. 1982. Long-term culture of B lymphocytes and their precursors from murine bone marrow. Proc. Natl. Acad. Sci. USA 79:3608.[Abstract/Free Full Text]
  32. Dorshkind, K.. 1986. In vitro differentiation of B lymphocytes from immature hematopoietic precursors present in long term bone marrow cultures. J. Immunol. 136:422.[Abstract]
  33. Wood, W. M., K. W. Ocran, D. F. Gordon, E. C. Ridgway. 1991. Isolation and characterization of mouse complementary DNAs encoding {alpha} and ß thyroid hormone receptors from thyrotrope cells: the mouse pituitary-specific ß2 isoform differs at the amino terminus from the corresponding species from rat pituitary tumor cells. Mol. Endocrinol. 5:1049.[Abstract/Free Full Text]
  34. Henderson, A. J., R. Narayanan, L. Collins, K. Dorshkind. 1992. Status of {kappa}L chain gene rearrangements and c-kit and IL-7 receptor expression in stromal cell-dependent pre-B cells. J. Immunol. 149:1973.[Abstract]
  35. Collins, L., K. Dorshkind. 1987. A stromal cell line from myeloid long-term bone marrow cultures can support myelopoiesis and B lymphopoiesis. J. Immunol. 138:1082.[Abstract/Free Full Text]
  36. Samuels, H. H., F. Stanley, J. Casanova. 1979. Depletion of L-3,5,3'-triiodothyronine and L-thyroxine in euthyroid calf serum for use in cell culture studies of the action of thyroid hormone. Endocrinology 105:80.[Abstract/Free Full Text]
  37. Lu, L., D. G. Osmond. 1998. Apoptosis during B lymphopoiesis in mouse bone marrow. J. Immunol. 158:5136.[Abstract]
  38. Lu, L., G. Smithson, P. W. Kincade, D. G. Osmond. 1998. Two models of murine B lymphopoiesis: a correlation. Eur. J. Immunol. 28:1755.[Medline]
  39. Rolink, A., U. Grawunder, T. H. Winkler, H. Karasuyama, F. Melchers. 1994. IL-2 receptor {alpha} chain (CD25, TAC) expression defines a crucial stage in pre-B cell development. Int. Immunol. 6:1257.[Abstract/Free Full Text]
  40. Hodgson, G. S., T. R. Bradley. 1979. Properties of haematopoietic stems cells surviving 5-fluorouracil treatment: evidence for a pre-CFU-S stem cell?. Nature 281:381.[Medline]
  41. Fleming, W. H., E. J. Alpern, N. Uchida, K. Ikuta, G. J. Spangrude, I. L. Weissman. 1993. Functional heterogeneity is associated with the cell cycle status of murine hematopoietic stem cells. J. Cell Biol. 122:897.[Abstract/Free Full Text]
  42. Sap, J., A. Munoz, K. Damm, Y. Goldberg, J. Ghysdael, A. Letuz, H. Beug, B. Vennstrom. 1986. The c-erbA protein is a high-affinity receptor for thyroid hormone. Nature 324:635.[Medline]
  43. Weinberger, C., C. C. Thompson, E. S. Ong, R. Lebo, D. J. Gruol, R. M. Evans. 1986. The c-erb-A gene encodes a thyroid hormone receptor. Nature 324:641.[Medline]
  44. Sjoberg, M., B. Vennstrom, D. Forrest. 1992. Thyroid hormone receptors in chick retinal development: differential expression of mRNAs for {alpha} and N-terminal variant ß receptors. Development 114:39.[Abstract]
  45. Melchers, F., H. Karasuyama, D. Haasner, S. Bauer, A. Kudo, N. Sakaguchi, B. Jameson, A. Rolink. 1993. The surrogate light chain in B-cell development. Immunol. Today 14:60.[Medline]
  46. Dorshkind, K.. 1991. In vivo administration of recombinant granulocyte-macrophage colony-stimulating factor results in a reversible inhibition of primary B lymphopoiesis. J. Immunol. 146:4204.[Abstract]
  47. Lazar, M. A.. 1993. Thyroid hormone receptors: multiple forms, multiple possibilities. Endocrinol. Rev. 14:184.[Abstract/Free Full Text]
  48. Forrest, D.. 1994. The erbA/thyroid hormone receptor genes in development of the central nervous system. Semin. Cancer Biol. 5:167.[Medline]
  49. Lazar, M. A., R. A. Hodin, D. S. Darling, W. W. Chin. 1988. Identification of a rat c-erbA{alpha}-related protein which binds deoxyribonucleic acid but does not bind thyroid hormone. Mol. Endocrinol. 2:893.[Abstract/Free Full Text]
  50. Yang, Y. Z., M. Burgos-Trinidad, Y. Wu, R. J. Koenig. 1996. Thyroid hormone receptor variant {alpha}2: role of the ninth heptad in DNA binding, heterodimerization with retinoid X receptors, and dominant negative activity. J. Biol. Chem. 271:28235.[Abstract/Free Full Text]
  51. Koenig, R. J., J. A. Lazar, R. A. Hodin, G. A. Brent, P. R. Larsen, W. W. Chin, D. D. Moore. 1989. Inhibition of thyroid hormone action by a non-hormone binding c-erbA protein generated by alternative mRNA splicing. Nature 337:659.[Medline]
  52. Lazar, M. A., R. A. Hodin, W. W. Chin. 1989. Human carboxyl-terminal variant of {alpha}-type c-erbA inhibits trans-activation by thyroid hormone receptors without binding thyroid hormone. Proc. Natl. Acad. Sci USA 86:7771.[Abstract/Free Full Text]
  53. Forrest, D., M. Sjoberg, B. Vennstrom. 1990. Contrasting developmental and tissue-specific expression of {alpha} and ß thyroid hormone receptor genes. EMBO J. 9:1519.[Medline]
  54. Hastings, M. L., C. Milcarek, K. Martincic, M. L. Peterson, S. H. Munroe. 1997. Expression of the thyroid hormone receptor gene, erbA{alpha}, in B lymphocytes: alternative mRNA processing is independent of differentiation but correlates with antisense RNA levels. Nucleic Acids Res. 25:4296.[Abstract/Free Full Text]
  55. Bradley, D. J., III W. S. Young, C. Weinberger. 1989. Differential expression of {alpha} and ß thyroid hormone receptor genes in rat brain and pituitary. Proc. Natl. Acad. Sci USA 86:7250.[Abstract/Free Full Text]
  56. Hodin, R. A., M. A. Lazar, B. I. Wintman, D. S. Darling, R. J. Koenig, P. R. Larsen, D. D. Moore, W. W. Chin. 1989. Identification of a thyroid hormone receptor that is pituitary-specific. Science 244:76.[Abstract/Free Full Text]
  57. Fondell, J. D., H. Ge, R. G. Roeder. 1996. Ligand induction of a transcriptionally active thyroid hormone receptor coactivator complex. Proc. Natl. Acad. Sci. USA 943:8329.
  58. Toms, S. A., A. Hercbergs, J. Liu, S. Kondo, G. H. Barnett, G. Casey, B. P. Barna. 1998. Thyroid hormone depletion inhibits astrocytoma proliferation via a p53-independent induction of p21 (WAF1/CIP1). Anticancer Res. 18:289.[Medline]



This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
J. R. Klein
The immune system as a regulator of thyroid hormone activity.
Experimental Biology and Medicine, March 1, 2006; 231(3): 229 - 236.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
O. Jacenko, D. W. Roberts, M. R. Campbell, P. M. McManus, C. J. Gress, and Z. Tao
Linking Hematopoiesis to Endochondral Skeletogenesis through Analysis of Mice Transgenic for Collagen X
Am. J. Pathol., June 1, 2002; 160(6): 2019 - 2034.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. Montecino-Rodriguez, H. Leathers, and K. Dorshkind
Expression of connexin 43 (Cx43) is critical for normal hematopoiesis
Blood, August 1, 2000; 96(3): 917 - 924.
[Abstract] [Full Text] [PDF]


Home page
Endocr. Rev.Home page
K. Dorshkind and N. D. Horseman
The Roles of Prolactin, Growth Hormone, Insulin-Like Growth Factor-I, and Thyroid Hormones in Lymphocyte Development and Function: Insights from Genetic Models of Hormone and Hormone Receptor Deficiency
Endocr. Rev., June 1, 2000; 21(3): 292 - 312.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Foster, M. P.
Right arrow Articles by Dorshkind, K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Foster, M. P.
Right arrow Articles by Dorshkind, K.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS