The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Höhn, H.
Right arrow Articles by Maeurer, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Höhn, H.
Right arrow Articles by Maeurer, M. J.
The Journal of Immunology, 1999, 163: 5715-5722.
Copyright © 1999 by The American Association of Immunologists

CD4+ Tumor-Infiltrating Lymphocytes in Cervical Cancer Recognize HLA-DR-Restricted Peptides Provided by Human Papillomavirus-E7

Hanni Höhn*, Henryk Pilch{dagger}, Susanne Günzel{dagger}, Claudia Neukirch*, Christine Hilmes{ddagger}, Andreas Kaufmann§, Barbara Seliger{ddagger} and Markus J. Maeurer*

Departments of * Medical Microbiology and {dagger} Gynecology and {ddagger} Third Medical Clinic, Johannes Gutenberg University, Mainz, Germany; and § Department of Gynecology, University of Jena, Jena, Germany


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human papillomavirus (HPV)-encoded proteins may provide targets for CD8+ or CD4+ T lymphocytes infiltrating into cervical cancer. We established an MHC class II-restricted CD4+ T cell line from a patient with cervical cancer that recognizes autologous (HPV35+, HPV59+) cervical cancer cells and the HLA-DR4-matched cervical cancer cell line Me180 (HPV68+) as determined by TNF-{alpha} secretion. Expression of different HPV-E7 genes in autologous B cells revealed that this T cell line defines a DR4-presented T cell epitope that is shared among the E7 genes of HPV59 and HPV68. MHC class II-presented peptides may be implemented to augment T cell responses directed against autologous tumor cells, particularly if cancer cells lack MHC class I expression, which is a frequent event in the evolution of cervical cancer.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human papillomavirus (HPV)3-encoded proteins represent attractive targets for T cell-based immunotherapy for patients with cervical cancer. T cell epitopes provided by HPV may also be implemented to induce or augment T cell responses to prevent progression or recurrence of HPV-positive lesions (1). The significance of MHC class I-restricted and HPV-specific CD8+ CTL in HLA-A*0201-positive individuals with an HPV16-positive tumor has recently been examined in tumor-infiltrating lymphocytes (TIL) (2) obtained from patients with cervical cancer. From a therapeutic standpoint, dendritic cells plus HPV-E7 may represent a promising approach to elicit cellular immune responses directed against autologous cervical cancer cells (3). However, targeting MHC class I-presented HPV epitopes may be limited, since functions and expression of TAP or MHC class I alleles may be reduced or down-regulated in cervical cancer lesions (4, 5, 6). Thus, MHC class II molecules expressed by cervical cancer cells may serve as restricting molecules to present HPV-derived epitopes. Here, we demonstrate that autologous CD4+ T cells infiltrating into cervical cancer recognize an MHC class II-restricted epitope provided by HPV.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Tumor cells and peptides

Tumor samples were isolated after surgery from patients suffering from cervical cancer. TIL were generated by culturing small tumor pieces in 48-well plates (Nunc, Wiesbaden, Germany) in AIM-V medium supplemented with 100 IU/ml IL-2 (Chiron, Ratingen, Germany) and 100 ng/ml IL-7 provided by Dr. N. Vita (Sanofi, Labege, France). TIL were not restimulated with autologous tumor cells during in vitro expansion. Single-cell suspensions of tumor cells were generated and frozen in liquid nitrogen until used in cytokine release assays. Peptides, purchased from MWG Biotech (Ebersberg, Germany), were synthesized on solid phase using F-moc for transient NH2-terminal protection and were characterized by amino acid analysis. The purity and identity of each peptide were confirmed by mass spectrometry.

Gene transfer

The full-length E7 gene from either HPV16 was amplified from the cell line Caski, HPV59 was amplified from the autologous tumor CCA1, HPV68 was amplified from the cell line Me180, and the entire E7 gene from HPV35 was provided by Dr. Attila Lörincz (Digene, Silver Spring, MD), and subcloned into the TA expression vector (Invitrogen, San Diego, CA) under a CMV promotor with the selectable marker for geneticin resistance. For transfection of EBV-transformed B cells from the patient CCA1, DNA was coupled to gold beads and delivered by a bioballistic approach using the gene gun device Accell provided by Dr. Jim Timmins (Auragen, Middleton, WI), into the recipient target cell line as described previously (7). Transfected cells were tested after 2 wk of selection in 1200 µg of geneticin/ml for T cell recognition.

Cytokine release assays

For peptide pulsing assays, synthetic peptides (100 ng) were added in a total volume of 10 µl/well to autologous B cells (106 cells/ml). Control wells received 10 µl of CM without peptide. One hundred microliters of this single-cell suspension was added to individual wells and incubated for 2 h at room temperature. One hundred microliters of TIL (20 x 106 cells/ml) in AIM-V was added to assay plates. Tumor cell lines of different histologies were tested for T cell recognition. HPV status and MHC class I and class II alleles for each tumor cell line are listed in Table IGo. Target cells were stimulated with 1000 IU of IFN-{gamma} 72 before assay to ensure MHC cell surface expression as determined by staining with the mAb W6/32 (anti-MHC class I) and L243 (anti-HLA-DR) by flow cytometry (Fig. 1Go). For blocking experiments, tumor cells or TIL were incubated at 4°C for 30 min with 5 µg of the respective Ab, as indicated. The anti-MHC class I (W6/32) and the anti-HLA-DR-directed mAb (L243) were prepared from culture supernatants by fast protein liquid chromatography using protein-A Sepharose. The mAb anti-TCR VB5.1, clone Immu 157, the mAb anti-TCR VB14.1, clone CASI.13, or isotype controls were obtained from Coulter/Beckman (Krefeld, Germany). After incubation at 37°C for 24 h, supernatants were harvested and stored at -20°C until assayed for IFN-{gamma}, IL-4, and TNF-{alpha} by ELISA (R & D Systems, Wiesbaden, Germany) according to the manufacturer’s instructions. A 4-h 51Cr release assay was performed as described previously (7).


View this table:
[in this window]
[in a new window]
 
Table I. HPV status and MHC alleles of target cells1

 


View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 1. MHC expression by autologous tumor cells. CCAI tumor cells were tested for constitutive MHC class I (mean fluorescence channel (MFC), 6) and MHC class II (MFC, 1) cell surface expression by flow cytometry (top panel). IFN-{gamma} augmented class I (MFC, 15.8) and class II (MFC, 10.9) (bottom panel) expression. Murine IgG served as a control (MFC, 0.4 and 0.5).

 
Determination of the TCR repertoire by DNA fragment analysis

PBL were segregated into CD4+ and CD8+ T cell populations before RNA extraction using immunomagnetic beads obtained from Miltenyi (Bergisch Gladbach, Germany). Aliquots of cDNA corresponding to 50 ng of total RNA were amplified in 20-µl reactions with 29 individual primers specific for the variable (V) TCR {alpha}-chain (8) and with 24 individual primers specific for the TCR ß-chain (9) as previously described (10). Aliquots (2 µl) of the 24 unlabeled Vß and the 29 V{alpha} amplicons were further subjected to three to six cycles of a run-off reaction using a fluorophore-labeled TCR C-{alpha}-specific (5'-ATACACATCAGAATCC TTACTTTG) or C-ß-chain-specific primer (5'-GTGCACCTCCTTCCCATTCACC). The reaction volume was 10 µl, and the final concentrations of deoxynucleoside triphosphates were 0.2 and 1.5 mM MgCl2 with 0.5 U Taq polymerase. Labeled products were analyzed by DNA fragment analysis using a 310 ABI sequencer and Genescan software from ABI (Weiterstadt, Germany). Single peaks in individual TCR variable chain families, suggesting clonality, were further analyzed by direct sequencing of the PCR products using the primer (5'-3') GTCACTGGATTTAGAGAGTCT for the TCR {alpha}-chain and the primer CACAGCGACCTCGGGTGGG for the variable TCR ß-chain on a 310A DNA sequencer (ABI). Of note, single peaks obtained by DNA fragment analysis may indicate a monoclonal TCR transcript or, alternatively, different TCRs exhibiting the identical TCR CDR3 length but multiple nucleotide sequences. Thus, TCR VA or VB transcripts are termed oligoclonal if one or two peaks are detected in the CDR length analysis and/or several individual TCR transcripts are present within a single peak. TCRs are considered monoclonal if direct sequencing of the PCR product or all individual clones after subcloning of the respective PCR amplicon revealed a single TCR transcript.

Flow cytometry

Three-color flow cytometry was performed on an EPICS XL obtained from Coulter/Beckman. All Abs (anti-CD3-PE, clone UCHT1; anti-CD4-PE, clone 13B8.2; anti-CD8-FITC, clone B9.11; anti-CD28-FITC, clone CD28.2; anti-TCR{alpha}ß, clone BMA031; anti-TCR{gamma}{delta}, clone Immu510; anti-CD45RA-FITC, clone 2H4; anti-CD45RO-FITC, clone UCHL1) or isotype controls were obtained from Coulter/Beckman. Anti-MHC class I (W6/32)- or anti-MHC class II (DR) (L243)-directed mAbs were obtained from the American Type Culture Collection (Manassas, VA) and prepared from culture supernatants.

Immunohistochemistry

Tissues were snap-frozen, stored at -70°C, and embedded in Tissue-Tek OCT compound (Miles, Elkhart, IN) before cutting. Cryostat sections (5–6 µm thick) of tissues were cut, air-dried, fixed with precooled acetone for 10 min, and stained by a three-stage immunoperoxidase procedure. Endogenous peroxidase was blocked with 0.3% H2O2. Anti-CD4, anti-CD8, or anti-CD3 mAbs were purchased from DAKO (Glastrup, Denmark), and optimal working dilutions of the Abs (1/50 for both primary Abs) were determined in titration experiments performed with human tonsils. IgG1 isotype Abs were used as negative controls. Secondary Abs, which were biotinylated and included in the LSAB2 kit from DAKO, were used to perform the avidin-biotin procedure. Staining was developed with peroxidase and amino-9-ethylcarbazole. Slides were counterstained with hematoxylin and mounted, using a glycerol-based mounting medium.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Characterization of TIL

Immunohistological examination of the tumor tissue from patient CCA1 revealed a dominant CD4+ T cell infiltrate (Fig. 2Go) and the presence of oligoclonal TCR transcripts in the VA2,7,8,15,16,19,28, VB8,16, and VB18 families (Table IIGo). No monoclonal TCR transcripts could be detected. TIL were expanded over a 2-mo period and exhibited up to 90% CD4+ TCR{alpha}ß+ staining cells determined by flow cytometry (Fig. 3Go). This T cell population showed a stable CD4+, CD28+, CD45RO+ phenotype over time (data not shown). We presume that the initial outgrowth of predominantly CD4+ T cells from tumor tissue is not a culture artifact, since serial sections of the cervical cancer of this patient exhibited only a minor CD8+ and a predominant CD4+ T cell infiltrate. DNA fragment analysis of individual TCR VA and VB families in TIL revealed monoclonal TCR transcripts in the TCR VA3, VA7, and TCR VB14 families (Fig. 4Go, A and B, and Tables II and III). Of note, the dominant peak in the oligoclonal TCR VA7 transcript present in the tumor (Table IIGo and Fig. 4GoA) turned out to represent a monoclonal TCR transcript in TIL (Table IIGo and Fig. 5Go). For comparative analysis, PBL from patient CCA1 were segregated into CD4+ and CD8+ T cell subsets, and TCR CDR3 length analysis was performed. The CD4+ T cell population did not exhibit clonal or oligoclonal TCR VA transcripts (Fig. 4GoC), but two monoclonal (VB11 and VB16) TCR transcripts could be detected in CD8+ T cells (Tables II and III).



View larger version (75K):
[in this window]
[in a new window]
 
FIGURE 2. The tumor CCA1 is predominantly infiltrated with CD4+ T cells. Serial cryostat sections of tumor tissue were analyzed for CD3+, CD4+, and CD8+ T cells by immunohistochemistry and counterstained with hematoxylin. The representative section exhibits a strong CD3+ and CD4+ infiltrate and only a few CD8+-staining cells.

 

View this table:
[in this window]
[in a new window]
 
Table II. Detection of monoclonal TCR1

 


View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Phenotypic analysis of TIL-CCA1 expanded in the presence of autologous tumor cells. TIL exhibit a CD4+, TCR{alpha}ß+ phenotype.

 


View larger version (44K):
[in this window]
[in a new window]
 
FIGURE 4. Analysis of the TCR VA (A) and VB (B) repertoire diversity in TIL CCA1 determined by DNA fragment analysis. Each peak suggesting monoclonality was subjected to DNA sequence analysis. Exclusively the TCR VA3, VA7, and VB14 families revealed the monoclonal TCR transcripts listed in Tables II and III. TCR repertoire analysis was performed after 2 mo of in vitro culture. No monoclonal or oligoclonal TCR VA (C) or VB transcripts could be detected in CD4+ T cells obtained from PBL.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. Comparison of the TCR VA7 CDR3 length analysis in freshly isolated tumor tissue and in TIL. TCR VA7 was considered oligoclonal, with a predominant transcript measuring 356 bp in tumor tissue (top panel). A peak of similar size was detected in TIL (bottom panel), which contained a monoclonal TCR transcript listed in Table IIIGo.

 
CD4+ TIL recognize common epitopes provided by the E7 gene product from HPV59 or HPV68

TIL were examined for recognition of cervical cancer cell lines and tumor cell lines of alternate histology defined by cytotoxicity and by cytokine release, including IFN-{gamma}, TNF-{alpha}, and IL-4 (Table IVGo). TIL-CCA1 secreted exclusively TNF-{alpha}, but not IFN-{gamma} or IL-4, in response to autologous tumor cells (HPV35+, HPV59+) or the allogeneic cervical cancer cell line Me180 (HPV68+). Other tumor cell lines, listed in Table IVGo, including K562 and Daudi, or autologous fibroblasts were not recognized by TIL CCA1 as determined by cytotoxicity and TNF-{alpha}, IFN-{gamma}, or IL-4 release assays. TNF-{alpha} secretion in response to tumor cells could be significantly reduced by preincubation of target cells with the anti-HLA-DR-directed mAb L243, but not with the mAb W6/32 directed against a monomorphic determinant on MHC class I (Fig. 6Go). Next, we tested whether TIL CCA1 recognizes a target(s) provided by the HPV-E7 gene product. The E7 gene from HPV16 (control), HPV35, HPV59 (present in the autologous tumor), or HPV68 (present in the cervical cancer cell line Me180) was expressed in autologous B cells from patient CCA1. TIL secreted TNF-{alpha} in response to B cells transfected with the E7 gene from HPV59 or from HPV68, but not from HPV16 or HPV35 or in response to nontransfected B cells (Table VGo).


View this table:
[in this window]
[in a new window]
 
Table IV. The CD4+ TIL line recognizes the autologous tumor and the cervical cancer cell line Me1801

 


View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 6. TIL derived from the patient CCA1 recognize exclusively autologous tumor cells (HPV35+, HPV59+) or the cervical cancer cell line Me180 (HPV68+) as defined by TNF-{alpha} secretion. T cell recognition could by blocked with an mAb directed against MHC class II (anti-HLA-DR, mAb L243), but not with the anti-MHC class I-directed mAb W6/32. Control IgG did not inhibit T cell recognition and autologous fibroblasts did not lead to significant TNF-{alpha} secretion.

 

View this table:
[in this window]
[in a new window]
 
Table V. TIL-CCA1 recognized the E7 gene product from HPV59 or HPV681

 
TIL-CCA1 recognize peptides derived from HPV59 and HPV68

The peptides HPV59 aa 91–103 (LFMDTLSFVCPLC) and HPV68 aa 93–105 (LFMDSLNFVCPWC) exhibiting the ability to bind to DR4 (18, 19) and showing the highest degree of homology between HPV68 and -59 were tested for T cell recognition (Table VIGo). TIL CCA1 secreted significant amounts of TNF-{alpha} in response to both peptides loaded onto autologous B cells. A control tetanus toxin peptide (aa 830–843, QYIKANSKFIGITE) was not recognized. Peptide recognition could be significantly reduced by preincubation of TIL with an mAb directed against the TCR VB14 chain, but not with irrelevant control Abs. This indicates that the monoclonal TCR VB14+ T cell population present in TIL after in vitro expansion represents the prominent T cell population mediating DR-restricted and HPV-specific T cell recognition. This idea is underscored by the observation that preincubation of TIL with the anti-TCR VB14 mAb, but not with a control mAb, leads to a significant reduction in TNF-{alpha} secretion in response to Me180 cervical cancer cells (Table VIIGo). We conclude that the CD4+ TIL line CCA1 and particularly T cells expressing the TCR VB14 chain define a peptide epitope provided by HPV59 (or HPV68) presented by HLA-DR4 molecules.


View this table:
[in this window]
[in a new window]
 
Table VI. Recognition of HPV-E7-derived peptides by TIL-CCA11

 

View this table:
[in this window]
[in a new window]
 
Table VII. TCR VB14+ TIL mediate recognition of tumor cells1

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The idea that CD4+ T cells infiltrate into cervical cancer lesions has been observed in earlier studies. Of note, HLA-DR expression by tumor cells appears to be correlated with enhanced TIL infiltration (5), and increased CD4+ T cell reactivity directed against HPV-associated epitopes has been correlated with viral persistence and disease progression (11). Characterization of the local immune responses in cervical cancer suggests a Th2-type cytokine secretion pattern in CD4+ T cells infiltrating high grade squamous intraepithelial lesions (12). Indirect evidence that CD4+ T cells may indeed be important in mediating or augmenting anti-tumor immune responses stems from observations that regression of genital warts is associated with increased CD4+ T cell numbers in situ (13) and that women with invasive or preinvasive cervical cancer lesions are at higher risk to ultimately develop progressing disease if they exhibit impaired or decreased CD4+ peripheral T lymphocytes (14, 15). The observation that TIL from a patient with cervical cancer recognize the autologous tumor in an MHC class II-restricted fashion is novel; however, previous studies indicated that MHC class II-restricted T lymphocytes responding to an immunogenic region in the carboxyl terminus of the HPV16-E7 protein (11, 16) or to HPV16 L1-derived peptides (17) may be present in the periphery of women suffering from cervical cancer.

Gauging the in situ cellular immune response to cancer cells by using TIL may be misleading, since the in vitro expanded T cell population may not necessarily reflect the original T cell infiltrate. At first glance, the pattern of monoclonal TCR transcripts present in the native tumor tissue is not identical with the pattern obtained in in vitro expanded TIL (Table IIGo). However, we have been able to show in previous studies that T lymphocytes have to be segregated into CD4+ and CD8+ T cells to describe the TCR transcripts in each T cell subset. Of course, this is possible in PBL or TIL, but it may be difficult to dissect the tumor tissue appropriately (10) according to the CD4/CD8 staining pattern. However, a more detailed analysis of individual TCR transcripts, for instance TCR VA7 (Fig. 5Go) suggests that the CD4+ TIL population may at least partially resemble the in situ TCR pattern.

HLA-DR has been demonstrated to present a variety of immunogenic peptides to anti-tumor-directed CD4+ T cells. Tyrosinase was the first nonmutated melanoma-associated Ag that provides at least two different DR*0401-restricted epitopes to CD4+ T cells (20). Other DR alleles, including DR11, present nonmutated MAGE-3 epitopes to CD4+ cytotoxic T cells (21), and HLA-DR-1 has recently been shown to present a peptide from the mutated glycolytic enyzme triosephosphate isomerase (22) to melanoma-specific CD4+ T cells. Thus, CD4+ T cells may not only be responsible for providing regulatory signals for CD8+ effector T cells or providing help for anti-tumor Ag-reactive B cells, but may also be able to mediate tumor regression (23, 24). Up to this end, the exact mechanism(s) of tumor rejection mediated by CD4 T cells has not been clearly defined. CD4+ T cells may be able to directly recognize MHC class II-expressing cancer cells. In this report both the HLA-DR*0401 and the HLA-DR*0407 allele may be capable of presenting the peptide epitope shared between HPV59 and HPV68, leading to recognition of both tumor cell lines CCA1 (DR*0407) and Me180 (DR*0401) by TIL.

Not mutually exclusive, immunity to class II epitopes can indeed elicit protection against class II-negative tumors (23). MHC class I- or class II-negative tumor cells can be eliminated through CD4+ T cells, which, in turn, may activate macrophages and/or eosinophils capable of delivering the final, nonspecific lytic step.

Consequently, if tumor cells express MHC class II, they may be able to provide targets recognized by CD4+ T cells. Up-regulated MHC class II expression has been identified on dysplastic epithelial cells and on cervical cancer cells by immunohistochemistry in paraffin-embedded tissue sections (25, 26, 27). Infection of keratinocytes with HPV appears to be associated with lesional MHC class II expression (26). These changes may directly impact on the immune surveillance of HPV-infected cells. Other reports suggested that specific MHC class II haplotypes may modulate the nature of the immune response to specific HPV-encoded epitopes and ultimately the risk of developing neoplasia (28). Future studies may address whether this association is reflected by quantitatively or qualitatively different cellular immune responses directed against cancer cells.

In addition to these data, we could demonstrate in this report that anti-tumor reactive and MHC class II-restricted T cells are present in situ in a patient with cervical cancer. Of note, these TIL have been cultured initially in the presence of autologous tumor cells, but have never been restimulated with peptides. However, the HPV59 and HPV68 target epitopes defined by the CD4+ T cell line CCA,1 presumably presented by HLA-DR*0401 and DR*0407, are rather uncommon in patients with cervical cancer (29). Nevertheless, these data indicate that identification of MHC class II-presented T cell epitopes provided by the more prevalent HPV16 or HPV18 in cervical cancer may represent attractive targets to drive effective and long-lasting cellular immune responses directed against tumor cells.


View this table:
[in this window]
[in a new window]
 
Table III. Deduced amino acid sequence of the CDR3 region of monoclonal TCR transcripts1

 

    Acknowledgments
 
We thank Edgar Hilmes, Central Bloodbank, University of Mainz, for HLA-DR4 subtyping, and Kirsten Freitag for performing flow cytometry.


    Footnotes
 
1 This work was supported by the Deutsche Forschungsgemeinschaft (SFB 432/A9).<./> Back

2 Address correspondence and reprint requests to Dr. Markus J. Maeurer, Hochhaus am Augustusplatz, D-55101 Mainz, Germany. E-mail address: Back

3 Abbreviations used in this paper: HPV, human papillomavirus; CDR3, complementarity-determining region 3; TIL, tumor-infiltrating lymphocytes, VA, variable {alpha}-chain, VB variable ß-chain. Back

Received for publication May 24, 1999. Accepted for publication September 2, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Feltkamp, M., H. Smits, M. Vierboom, R. P. Minnar, B. M. de Jongh, J. W. Drijfhout, J. ter Schegget, C. J. M. Melief, W. M. Kast. 1993. Vaccination with cytotoxic T lymphocyte epitope-containing peptide protects against a tumor induced by human papillomavirus type 16-transformed cells. Eur. J. Immunol. 23:2242.[Medline]
  2. Evans, E. M., S. Man, A. S. Evans, L. K. Borysiewicz. 1997. Infiltration of cervical cancer tissue with human papillomavirus-specific cytotoxic T-lymphocytes. Cancer Res. 57:2943.[Abstract/Free Full Text]
  3. DeBruijn, M. L., D. H. Schuurhuis, M. P. Vierboom, H. Vermeulen, K. A. de Cock, M. E. Ooms, M. E. Ressing, M. Toebes, K. L. Franken, J. W. Drijfhout, et al 1998. Immunization with human papillomavirus type 16 (HPV 16) oncoprotein-loaded dendritic cells as well as protein in adjuvant induces MHC class I-restricted protection to HPV 16-induced tumor cells. Cancer Res. 58:724.[Abstract/Free Full Text]
  4. Breitburd, F., N. Ramoz, J. Salmon, J., and G. Orth. 1996. HLA control in the progression of human papillomavirus infections. Semin. Cancer Biol. 7:359.
  5. Hilders, C. G., J. G. Houbiers, H. H. van Ravensway Claasen, R. W. Veldhuizen, G. J. Fleuren. 1993. Association between HLA-expression and infiltration of immune cells in cervical carcinoma. Lab. Invest. 69:651.[Medline]
  6. Cromme, F. V., J. Airey, M. T. Heemels, H. L. Ploegh, P. J. Keating, P. I. Stern, C. J. Meijer, J. M. Walboomers. 1994. Loss of transporter protein, encoded by the TAP-1 gene, is highly correlated with loss of HLA expression in cervical carcinomas. J. Exp. Med. 179:335.[Abstract/Free Full Text]
  7. Maeurer, M. J., S. M. Gollin, D. Martin, W. Swaney, J. Bryant, C. Castelli, P. Robbins, G. Parmiani, W. Storkus, M. T. Lotze. 1996. Tumor escape from immune recognition: lethal recurrent melanoma in a patient associated with downregulation of the peptide transporter protein TAP-1 and loss of expression of the immunodominant MART-1/Melan-A antigen. J. Clin. Invest. 98:1633.[Medline]
  8. Genevee, C., A. Diu, J. Nierat, A. Caignard, P. Y. Dietrich, L. Ferrradini, S. Roman-Roman, F. Triebel, T. Hercend. 1992. An experimentally validated panel of subfamily-specific oligonucleotide primers (V{alpha} l-w29/Vß1-w24) for study of human T cell receptor variable V gene segment usage by polymerase chain reaction. Eur. J. Immunol. 22:1261.[Medline]
  9. Pusieux, I., J. Even, C. Pannetier, F. Jotereaux, M. Favrot, P. Kourilsky. 1994. Oligoclonality of tumor-infiltrating lymphocytes from human melanomas. J. Immunol. 153:2807.[Abstract]
  10. Hoehn, H., T. Reichert, C. Neukirch, H. Pilch, M. J. Maeurer. 1999. Monoclonal TCR mRNA transcripts are preferentially detected in the TCR variable a chain in CD8+ T-lymphocytes: implications for immunomonitoring. Int. J. Mol. Med. 3:139.[Medline]
  11. De Gruijl, T. D., H. J. Bontkes, J. M. Walboomers, M. J. Stukart, F. S. Doekhie, A. J. Remmink, T. J. Helmerhorst, R. H. Verheijen, M. F. Duggan-Keen, P. L. Stern, et al 1998. Differential T helper cell responses to human papillomavirus type 16 E7 related to viral clearance or persistence in patients with cervical neoplasia: a longitudinal study. Cancer Res. 58:1700.[Abstract/Free Full Text]
  12. Al-Saleh, W., S. L. Giannini, N. Jacobs, M. Moutschen, J. Doyen, J. Boniver, P. Delvenne. 1998. Correlation of T helper secretory differentiation and types of antigen-presenting cells in squamous intraepithelial lesions of the uterine cervix. J. Pathol. 184:283.[Medline]
  13. Coleman, N., H. D. Birley, A. M. Renton, N. F. Hanna, B. K. Ryait, M. Byrne, D. Taylor-Robinson, M. A. Stanley. 1998. Immunological events in regressing genital warts. Am. J. Clin. Pathol. 102:768.
  14. Gemignani, M., M. Maiman, R. G. Fruchter, C. D. Arrastia, D. Gibbon, T. Ellison. 1995. CD4 lymphocytes in women with invasive and preinvasive cervical neoplasia. Gynecol. Oncol. 59:364.[Medline]
  15. Heard, I., V. Schmitz, D. Costagliola, G. Orth, M. D. Kazatchkine. 1998. Early regression of cervical lesions in HIV-seropositive women receiving highly active antiretroviral therapy. AIDS 12:1459.[Medline]
  16. Altmann, A., I. Jochmus-Kudielka, R. Frank, H. Gausepohl, U. Moebius, L. Gissmann, S. C. Meuer. 1992. Definition of immunogenic determinants of the human papillomavirus type 16 nucleoprotein E7. Eur. J. Cancer 28:326.
  17. Shepherd, P. S., A. J. Rowe, J. C. Cridland, T. Coletart, P. Wilson, J. C. Luxton. 1996. Proliferative T cell responses to human papillomavirus type 16 L1 peptides in patients with cervical dysplasia. J. Gen. Virol. 77:593.[Abstract/Free Full Text]
  18. Sette, A., J. Sydney, C. Oseroff, M. F. del Guercio, S. Southwood, T. Arrhenius, M. F. Powell, S. M. Colon, F. C. Gaeta, H. M. Grey. 1993. HLA DR4w4-binding motifs illustrate the biochemical basis of degeneracy and specificity in peptide-DR interactions. J. Immunol. 151:3163.[Abstract]
  19. Hammer, J., P. Valsasnini, K. Tolba, D. Bolin, J. Higelin, B. Takacs, F. Sinigaglia. 1993. Promiscuous and allele-specific anchors in HLA-DR binding peptides. Cell 74:197.[Medline]
  20. Topalian, S. L., M. I. Gonzales, M. Parkhurst, Y. F. Li, S. Southwood, A. Sette, S. A. Rosenberg, P. F. Robbins. 1996. Melanoma-specific CD4+ T cellsrecognize nonmutated HLA-DR-restricted tyrosinase epitopes. J. Exp. Med. 183:1965.[Abstract/Free Full Text]
  21. Mancini, S., T. Sturniolo, M. A. Imro, J. Hammer, F. Sinigaglia, C. Noppen, G. Spagnoli, B. Mazzi, M. Bellone, P. Dellabona, et al 1999. Melanoma cells present a MAGE-3 epitope to CD4+ cytotoxic T cells in association with histocompatibility leukocyte antigen DR11. J. Exp. Med. 189:871.[Abstract/Free Full Text]
  22. Pieper, R., R. E. Christian, M. I. Gonzales, M. I. Nishimura, G. Gupta, R. E. Settlage, J. Shabanowitz, S. A. Rosenberg, D. F. Hunt, S. L. Topalian. 1999. Biochemical identification of a mutated human melanoma antigen recognized by CD4+ T cells. J. Exp. Med. 189:757.[Abstract/Free Full Text]
  23. Toes, R. E. M., F. Ossendorf, R. Offringa, C. J. M. Melief. 1999. CD4 T cells and their role in antitumor immune responses. J. Exp. Med. 189:753.[Free Full Text]
  24. Greenberg, P. D.. 1991. Adoptive T cell therapy of tumors: mechanisms operative in the recognition and elimination of tumor cells. Adv. Immunol. 49:281.[Medline]
  25. Cromme, F. V., C. J. Meijer, P. J. Snijders, A. Uyterlinde, P. Kenemans, T. Helmerhorst, P. L. Stern, A. J. van den Brule, J. M. Walboomers. 1993. Analysis of MHC class I and II expression in relation to presence of HPV genotypes in premalignant and malignant cervical lesions. Br. J. Cancer 67:1372.[Medline]
  26. Glew, S. S., M. E. Connor, P. J. Snijders, C. M. Stanbridge, C. H. Buckley, J. M. Walboomers, C. J. Meijer, P. L. Stern. 1993. HLA expression in pre-invasive cervical neoplasia in relation to human papilloma virus infection. Eur. J. Cancer 29A:1963.
  27. Glass, S. S., M. Duggan-Keen, T. Cabrera, P. L. Stern. 1992. HLA class II antigen expression in human papillomavirus-associated cervical cancer. Cancer Res. 52:4009.[Abstract/Free Full Text]
  28. Apple, R. J., H. A. Erlich, W. Klitz, M. M. Manos, T. M. Becker, C. M. Wheeler. 1994. HLA DR-DQ associations with cervical carcinoma show papillomavirus-type specificity. Nat. Genet. 6:157.[Medline]
  29. Meyer, T., R. Arndt, E. Christophers, E. R. Beckmann, S. Schroder, L. Gissmann, E. Stockfleth. 1998. Association of rare human papillomavirus types with genital premalignant and malignant lesions. J. Infect. Dis. 178:252.[Medline]



This article has been cited by other articles:


Home page
Cancer Res.Home page
S. J. Piersma, E. S. Jordanova, M. I.E. van Poelgeest, K. M.C. Kwappenberg, J. M. van der Hulst, J. W. Drijfhout, C. J.M. Melief, G. G. Kenter, G. J. Fleuren, R. Offringa, et al.
High Number of Intraepithelial CD8+ Tumor-Infiltrating Lymphocytes Is Associated with the Absence of Lymph Node Metastases in Patients with Large Early-Stage Cervical Cancer
Cancer Res., January 1, 2007; 67(1): 354 - 361.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. G. Meyer, C. M. Britten, D. Wehler, K. Bender, G. Hess, A. Konur, U. F. Hartwig, T. C. Wehler, A. J. Ullmann, C. Gentilini, et al.
Prophylactic transfer of CD8-depleted donor lymphocytes after T-cell-depleted reduced-intensity transplantation
Blood, January 1, 2007; 109(1): 374 - 382.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
H. Pilch, H. Hohn, C. Neukirch, K. Freitag, P. G. Knapstein, B. Tanner, and M. J. Maeurer
Antigen-Driven T-Cell Selection in Patients with Cervical Cancer as Evidenced by T-Cell Receptor Analysis and Recognition of Autologous Tumor
Clin. Vaccine Immunol., March 1, 2002; 9(2): 267 - 278.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
M. Scott, M. Nakagawa, and A.-B. Moscicki
Cell-Mediated Immune Response to Human Papillomavirus Infection
Clin. Vaccine Immunol., March 1, 2001; 8(2): 209 - 220.
[Full Text] [PDF]


Home page
Cancer Res.Home page
P.-Y. Dietrich, P. R. Walker, A.-L. Quiquerez, G. Perrin, V. Dutoit, D. Liénard, P. Guillaume, J.-C. Cerottini, P. Romero, and D. Valmori
Melanoma Patients Respond to a Cytotoxic T Lymphocyte-defined Self-Peptide with Diverse and Nonoverlapping T-Cell Receptor Repertoires
Cancer Res., March 1, 2001; 61(5): 2047 - 2054.
[Abstract] [Full Text]


Home page
J. Virol.Home page
H. Höhn, H. Pilch, S. Günzel, C. Neukirch, K. Freitag, A. Necker, and M. J. Maeurer
Human Papillomavirus Type 33 E7 Peptides Presented by HLA-DR*0402 to Tumor-Infiltrating T Cells in Cervical Cancer
J. Virol., July 15, 2000; 74(14): 6632 - 6636.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Höhn, H.
Right arrow Articles by Maeurer, M. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Höhn, H.
Right arrow Articles by Maeurer, M. J.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS