| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Immunology Group, Cell and Molecular Biology, Lund University, Lund, Sweden
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5 (15, 16, 17), and VpreB (15, 18). These genes encode the Ig-associated 
- and ß-chains
(19, 20) of the pre-B and B cell receptors (pre-BCR, BCR)
and the surrogate light chains of the pre-BCR (21, 22).
This suggests that EBF has a role in the regulation of several genes
encoding components of the pre-BCR. This receptor is composed of a
functionally rearranged IgH, the surrogate light chains 5 and VpreB,
and appears to be important for the progression of the pre-B cell stage
and initiation of Ig light chain (IgL) gene recombination
(23). The pre-BCR also contains the Ig-associated and
ß proteins that together with the B lymphoid kinase (Blk) transduce
signals through the receptor (24). Blk is a Src family
kinase expressed throughout B cell development with the exception of
the plasma cell stage (25, 26, 27). The Blk gene is under the
control of a weak promoter (26, 28) containing a
functionally important binding site for the paired domain transcription
factor B cell-specific activator protein (BSAP; Pax-5) (28, 29). Furthermore, ectopic expression of BSAP activates the
promoter in B and plasma cell lines (30), supporting the
idea that BSAP participate in the regulation of the Blk
promoter. The BSAP binding site overlaps with a binding site for
NF-
B transcription factor complexes, and induction of NF-B has
also been shown to correlate with induction of the endogenuos Blk gene
(30). The expression of Blk and BSAP are largely
overlapping (28), further supporting that BSAP is a
regulator of Blk expression. However, mice carrying a homologous
disruption of the BSAP-encoding Pax-5 gene still develop pre-B cells
expressing Blk transcripts (31, 32). This implies that
other yet unidentified transcription factors have the ability to
compensate for BSAP in the function of the Blk promoter in
early B cell development. One such candidate could be EBF, expressed in
pre-B cells from BSAP-deficient mice (31, 32). We here present data proposing that EBF interacts with the Blk promoter in vivo as well as in vitro and has the ability to activate the promoter in nonlymphoid HeLa cells. We also show data indicating that the EBF binding site is important for full function of the Blk promoter in pre-B cell lines. Furthermore, coexpression of EBF and BSAP in HeLa cells resulted in a more than additive effect on the activation of the Blk promoter, suggesting that BSAP and EBF cooperate. These results imply that EBF is involved in the regulation of the Blk gene, which offers a possible explanation to the finding that the Blk gene is active in BSAP-deficient mice and defines a genetic target for EBF.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
All cells were grown in RPMI 1640 medium supplemented with 7.5% FCS, 10 mM HEPES, 2 mM pyruvate, 50 µM 2-ME, and 50 µg gentamicin per ml (complete RPMI 1640 media) (all purchased from Life Technologies, Täby, Sweden) at 37°C and 5% CO2.
In vivo footprinting analysis
In vivo footprinting analysis was based on a modified
linker-mediated PCR (33, 34). Briefly, 50 million cells
were incubated in 1 ml RPMI 1640 medium supplemented with 0.1%
dimethyl sulfate for 5 min, after which 25 ml of ice-cold medium was
added. The cells were then washed, and DNA was extracted and boiled in
piperidine. The denatured DNA was annealed to Blk
anti-sense oligo 1, and dsDNA was synthesized by extension with
Klenow enzyme. The sample was then ligated to a double stranded linker
of oligo T1 and B1. The ligated DNA was then amplified by PCR using
oligo T1 and Blk anti-sense 2, and the PCR product was
labeled by linear PCR with [
-32P]ATP-labeled
oligo Blk anti-sense 3. The labeled sample was then
separated on a 6% sequencing gel. A detailed protocol is available
upon request.
Oligonucleotides used for in vivo footprinting analysis included the following: Blk anti-sense 1 (5'-CCGCCATGAACAGCCCTAAGAAGC), T1 (5'-GCGGTGACCCGGGAGATCTGAATTC), B1 (5'-GAATTCAGATC), Blk anti-sense 2 (5'-AGGTGTTTCTGAGGAAGTTTCATG), and Blk anti-sense 3 (5'-GTTTCATGGGCACCTGACCTTCAGCC).
Transient transfections and luciferase assays
A total of 250.000 HeLa cells were grown overnight in 1 ml of complete RPMI 1640 medium in a 24-well plate. The cells were washed once with serum-free medium (OPTIMEM; Life Technologies), and 800 µl of the serum free-medium was added for transfection. Then, 5 µl of lipofectin (Life Technologies) was diluted in 100 µl of serum free-medium, incubated for 45 min at room temperature, and mixed with the DNA diluted in 100 µl of serum-free medium. The mixture was incubated for 25 min, and the combined volume of 200 µl was added to the HeLa cells. The cells were then incubated in a CO2 incubator at 37°C for 6 h, after which the transfection medium was removed and replaced by complete RPMI 1640 medium. The cells were harvested after 40 h, and protein extracts were prepared directly in the 24-well plates using 80 µl of cell lysis buffer (Promega, Falkenberg, Sweden). This procedure result in protein extracts of even quality, reducing the need to normalize for the protein content in the extracts by cotransfection of a ß-galactosidase reporter (M.S., unpublished observation). Luciferase assays were then conducted with 20 µl of the obtained extracts and 200 µl of luciferase assay reagent (Promega).
All other cell lines were washed twice in TBS (140 mM NaCl, 5 mM KCl, 25 mM Tris, pH 7.4, 0.6 mM phosphate, 0.5 mM MgCl2, 0.7 mM CaCl2), and 2,5 x 106 cells were transfected with 2 µg reporter gene construct in 0.65 ml TBS with 0.7 mg DEAE-dextran (Pharmacia, Uppsala, Sweden) per ml for 30 min at 20°C. After a single wash in TBS, the transfected cells were cultured in 5 ml of complete RPMI 1640 medium in six-well plates for 48 h. Preparation of protein extracts and luciferase assays were performed with a luciferase assay kit (Promega) using 20% of the total protein extract. The obtained luciferase activity was normalized against the activity of a cotransfected CMV-controlled ß-galactosidas (ß-gal) reporter gene. ß-Gal activity was measured by incubation of 20% of the protein extracts with colorless (o-nitrophenyl-ß-D-galactopyranosid) (Promega), which is hydrolysed to yellow o-nitrophenol by ß-gal. The OD was then measured in a spectrophotometer at 405 nm.
Protein extracts, EMSA, and methylation interference
Nuclear extracts were prepared according to Schreiber et al.
(35). DNA probes were labeled with
[-32P]ATP by incubation with T4
polynucleotide kinase (Boehringer Mannheim, Mannheim, Germany),
annealed, and purified on a 5% polyacrylamide Tris-borate-EDTA (TBE)
gel. The Blk probe used in Fig. 5
was generated by PCR
amplification of the Blk promoter cloned in pGL3 in the
3'-5' orientation (see below) by using the Blk EBF
anti-sense oligonucleotide together with a GL primer 2 (Promega).
This PCR product includes the EBF and BSAP binding sites (-85 to -7)
and was HindIII digested and fill-in labeled with
[-32P]dCTP by incubation with Kleenow
fragment. The PCR-generated probe was purified on a 5% polyacrylamide
TBE gel. Nuclear extract or in vitro-transcribed/translated protein was
incubated with labeled probe (20,000 cpm, 3 fmol) for 30 min at room
temperature in binding buffer (10 mM HEPES, pH 7.9, 70 mM KCl, 1 mM
DTT, 1 mM EDTA, 2.5 mM MgCl2) with 0.75 µg
poly(dI/dC) (Pharmacia). DNA competitors were added 10 min before the
addition of the DNA probe. The samples were separated on a 6%
polyacrylamide TBE gel, which was dried and subjected to
autoradiography. Competitors were added at molar excesses indicated in
the respective figures.
|
Oligonucleotides used for EMSAs were as follows: Blk EBF sense (5'-AACCAAAACCCATGAGAAAACTTTG), Blk EBF anti-sense (5'-CAAAGTTTTCTCATGGGTTTTGGTT), mb-1 EBF sense (5'-GAGAGAGACTCAAGGGAATTGTGG), mb-1 EBF anti-sense (5'-CCACAATTCCCTTGAGTCTCTCTC), OCT sense (5'TTCATTGATTTGCATCGCATGAGACGCTAACATCGTACGTTC), and OCT anti-sense (5'GAACGTACGATGTTAGCGTCTCATGCGATGCAAATCAATGAA).
Plasmids and constructs
The EBF expression plasmid (15) was based on the
eukaryotic expression vector cDNA3 (Invitrogen, Leek, The Netherlands),
which places the inserted cDNA under the control of a CMV promoter. The
full-length Blk promoter (-85 to +152) was generated by PCR
using the Blk sense and anti-sense primers with genomic
mouse DNA as template. The resulting PCR product was cloned blunt in
the SmaI site of the luciferase reporter vector pGL3 basic
(Promega). The Blk promoter with mutated EBF site (Blk-EBFM)
was constructed by using Blk-EBFM PCR primer (see Fig. 2),
together with the Blk antisense primer. The Blk
promoter cloned in pGL3 was used as template. The resulting
Blk -EBFM promoter mutant was cloned blunt into the
SmaI site of pGL3 basic reporter vector. The Blk promoters
with mutations in the BSAP binding site (Blk-BSAPM), mutation B
according to references (28, 30), was constructed using
Blk-BSAPM and Blk anti-sense primers with the
Blk promoter cloned in pGL3 basic as the template. The EBF BSAP double
mutant Blk promoter (Blk-EBM) was also constructed using
Blk-BSAPM and Blk anti-sense primers but with
the Blk-EBFM promoter cloned in pGL3 basic as the template. Both
Blk-BSAPM and the double mutant Blk-EBM were cloned blunt
into SmaI site of pGL3. A 0.7-kb EcoRI to
XbaI fragment of the Igµ intron enhancer (Eµ) was cloned
in the BamHI 3'of the reporter gene to increase the
luciferase activity of the Blk promoters. All constructs
were verified by sequencing.
|
In vitro transcription and translation
Recombinant proteins were generated by coupled in vitro transcription-translation by using a reticulocyte lysate kit (Promega). Then, 0.5 µl of a 25-µl reaction mix was used for EMSAs.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Inspection of the minimal Blk promoter region
(26, 28) identified a potential binding site for EBF 15 bp
upstream the most 5' transcription initiation site (Fig. 1A). This site had one
mismatch as compared with the consensus EBF core DNA binding site
(11), in a position suggested to be variable in other
naturally occurring binding sites for the factor (13, 15, 37). This potential EBF binding site is also present in the
human Blk promoter (38) suggesting that the
site is conserved between mouse and man. To examine whether this
potential EBF binding site was occupied in vivo, we made an in vivo
footprinting analysis of the sense strand of the Blk
promoter in 18–81 pre-B cells (Fig. 1B). The in
vitro-methylated DNA yielded a complete G ladder while the in
vivo-methylated DNA generated a G ladder devoid of two G residues,
indicated by black dots in Fig. 1, A and B,
within the potential EBF binding site. This suggested that these
residues were protected from methylation in vivo, indicating that the
potential EBF binding site was occupied. In contrast, no clear
methylation protection could be detected within the BSAP binding site.
To investigate if EBF could interact with the site in vitro, we
synthesized an oligonucleotide spanning the region between -32 and -7
of the Blk promoter and used this as a binding site for
recombinant in vitro-translated mouse EBF in an EMSA (Fig. 1C). Even though two bands could be detected when large
amounts of unprogrammed reticulocyte lysate was included, the use of
EBF-programmed lysate resulted in one prominent complex that was not
present in unprogrammed reticulocyte lysate. This suggests that
recombinant EBF has the ability to interact with the Blk
promoter. To further examine the formed complex, we competed for the
formation of the Blk promoter/EBF complex by addition of
duplex oligonucleotides spanning either the Blk (Blk-EBF) or
mb-1 (mb-1-EBF) promoter EBF sites or a consensus octamer
site (OCT). Both the Blk and the mb-1 EBF binding
sites competed for EBF binding but the affinity of the former appeared
to be about 5-fold lower than that of the mb-1 promoter. The
octamer-containing oligonucleotide did not compete for binding
proposing that the interactions were specific. These data indicate that
the Blk promoter contains an EBF binding site occupied in
vivo in a pre-B cell line.
|
To define the EBF binding site in the context of the intact
promoter and to generate an EBF mutant Blk promoter (Fig. 2
A), we used PCR to generate
wild-type (-85 to +152) or EBF-mutated Blk promoters. This
237-bp region has been shown to contain transcription initiation sites
and the majority of the functional activity of the Blk
promoter (26, 28). The wild-type (Blk) and EBF-mutated
Blk (Blk-EBFM) promoters or the 5 promoter
(15) were then used as competitors for binding of
recombinant EBF to the Blk EBF site in an EMSA (Fig. 2B). Both the wild-type Blk and the
5 promoters competed efficiently for binding of
recombinant EBF, while the Blk promoter containing point
mutations in the EBF site competed for EBF binding with a reduced
affinity (Fig. 2B). The fact that an EBF site-mutated
Blk promoter still competed weakly for EBF binding indicates
that other, low-affinity EBF binding sites may be present in the
promoter. One potential site could be found in position +61 to +74
(Fig. 1A), but the location and the low affinity discouraged
us to investigate this second potential EBF binding site any further.
To examine whether the Blk promoter EBF binding site was
able to confer EBF-induced functional activity, we made transient
transfections, into nonlymphoid HeLa cells, with luciferase reporter
constructs controlled by either the wild-type or the EBF-mutated
Blk promoter. (Fig. 2C). The reporter plasmids
were cotransfected with either empty expression vector (cDNA3) or with
the same vector containing an EBF-encoding cDNA. Inclusion of EBF
expression plasmid resulted in a 9-fold induction of the wild-type
Blk promoter (Blk), while the same amount of EBF expression
plasmid only resulted in a 2.5-fold induction of the EBF site-mutated
Blk promoter (Blk-EBFM). A fos basal promoter was
induced 1.5-fold, and a 5 promoter was induced 16- fold
in the same experiment (data not shown). This indicates that the
interaction of EBF with the defined binding site in the Blk
promoter induce functional activity of the promoter in nonlymphoid
cells.
The Blk promoter EBF site interacts with EBF-like proteins in nuclear extracts from pre-B cell lines
To examine if EBF interacted with the Blk promoter in
pre-B cells, we used EMSA to study the factors bound to a
Blk promoter EBF site (-32 to -7) in a 230–238 pre-B cell
nuclear extract (Fig. 3A).
This resulted in two bands of which that with the lowest mobility (C1)
was competed for binding by the Blk EBF site (Blk-EBF) as
well as by the mb-1 promoter EBF site (mb-1 EBF), but not by
the octamer (OCT) containing control oligonucleotide. The high-mobility
complex (C2) was only competed efficiently for binding by the
Blk EBF site, suggesting that this complex is unrelated to
EBF. The band with the lowest mobility was also efficiently competed
for binding by the full-length Blk (Blk) and the
5 promoters but not by the Blk promoter
carrying a mutation in the EBF site (Blk-EBFM). The faster migrating
complex was competed for binding by both the wild-type and the
EBF-mutated Blk promoter but not by the 5
promoter, suggesting that this complex was formed by protein
interaction with a region distinct from the EBF binding site. To
confirm this, and to more carefully examine if the low-mobility complex
indeed was identical with EBF, we made methylation interference
experiments with the Blk promoter EBF binding site and
recombinant in vitro-translated EBF (rEBF) or nuclear extracts from
230–238 pre-B cells (Fig. 3B). Unbound DNA generated the
expected G ladder while recombinant EBF and C1 as well as C2 appeared
to be sensitive to methylation in the two central G residues in the
sense strand. A different pattern of interaction was obtained using the
anti-sense strand where both binding of recombinant EBF and C1 was
sensitive to methylation of three of the G residues within the defined
EBF site, while this was not the case for the unidentified low-mobility
complex C2. To further characterize the two complexes formed by
interaction of nuclear factors with the Blk promoter, we
performed EMSA using the oligonucleotide covering the region -7 to
-32 as above (Fig. 4) and nuclear
extracts from a panel of cell lines. An octamer containing
oligonucleotide was used as a control for protein quality, and an EBF
biding site from the mb-1 promoter was used as an indicator
for the presence of EBF in the different cell lines. In
vitro-translated EBF interacted both with the mb-1 and the Blk-EBF
sites. Nuclear extract from the pro-B cell Ba/F3, not expressing Blk
(25, 26) or EBF (15), contained OCT proteins
and a complex resembling C2, but no complex resembling EBF (C1). The
pre-B cell lines 230–238, 18–81, and 70Z/3 all contained OCT
proteins, factors (EBF) bound to the mb-1 promoter EBF site,
and proteins forming complex C1 and C2 with the Blk promoter
EBF site. The C1 complex migrated with mobility comparable to
recombinant EBF, further supporting that C1 was formed due to
interaction of nuclear EBF with the Blk promoter. Protein
extracts from the B cell line A20 contained OCT proteins, and complexes
were formed on both the mb-1 and Blk promoter EBF
binding sites. However, none of these complexes comigrated with
recombinant EBF, indicating that EBF may be modified or expressed at
lower levels in the A20 B cells as compared with the pre-B cells
(6, 13). In contrast, complex C2 was detected at levels
comparable to those found in extracts from pre-B cells. OCT proteins
and complex C2 was also detected in nuclear extracts from 2017 pre-T
cells and WEHI-3 macrophages, while no mb-1 promoter
EBF or Blk promoter C1 complexes were formed.
J558 plasmacytoma cells and epitheloid HeLa cells contained OCT
proteins but neither mb-1 promoter site EBF complexes nor
Blk C1, C2 complexes. Even though we cannot exclude the involvement of
another factor, these findings suggest that the C1 complex is formed by
the interaction of nuclear EBF with the Blk promoter and
that the introduced mutation specifically inhibits EBF binding.
|
|
To investigate the importance of an intact EBF binding site for
the function of the Blk promoter in cells of the B lineage,
we introduced mutations in the EBF and/or BSAP binding sites. The
introduced BSAP mutation was identical with the mutation B suggested to
have the most dramatic effect on Blk promoter function
(30) in B cells and to prevent binding of BSAP to the
defined BSAP binding site (28, 30). To examine the effects
of the introduced mutations on protein binding, we used EMSA with a
probe spanning a region between -85 to -7 of the Blk
promoter that includes both the BSAP and the EBF binding site and
nuclear extracts from 230–238 pre-B cells. This resulted in three
major complexes of which the one with lowest mobility was competed for
binding by both the Blk (Blk-EBF) and the mb-1
EBF (mb-1 EBF) binding sites but not by the BSAP binding site from the
human CD19 promoter (CD19-BSAP) (39) (Fig. 5A). The complex with
intermediate mobility was only competed for binding by the
CD19 BSAP binding site while the fastest migrating complex
was competed for binding only by the Blk EBF binding site.
This suggests that the low-mobility complex was formed due to
interaction of the Blk promoter with EBF, the
medium-mobility complex was formed due to interaction with BSAP, and
the fastest-migrating complex was formed due to interaction with factor
C2 (Fig. 3). All three observed complexes were competed for binding by
a full-length wild-type Blk promoter (Blk), while the
low-mobility complex was not competed for binding by a EBF-mutated
Blk promoter (Blk-EBFM) (Fig. 5B). The
Blk promoter containing the BSAP mutation (Blk-BSAPM) showed
only marginally reduced BSAP binding, suggesting the existence of other
BSAP binding sites in the Blk promoter. The promoter
carrying mutations in both the EBF and BSAP binding site (Blk-EBM)
competed with a slightly reduced efficiency for BSAP and a dramatically
reduced efficiency for EBF. Both the low- and intermediate- but not the
high-mobility complexes competed for binding by the 5
promoter, known to interact with both EBF (15) and BSAP
(40). This suggests that in pre-B cells, both EBF and BSAP
interact independently with the Blk promoter. To investigate
the function of the EBF binding site in the Blk promoter, we
made transient transfections of reporter constructs controlled by
either a wild-type or the mutated Blk promoters into cells
of the B lineage. The activities of these constructs were low
(26, 30) (data not shown), which led us to introduce an
IgH intron enhancer (Eµ) 3' of the luciferase gene. This resulted in
an increase of activity, which allowed us to analyze the promoter
function in the pre-B cell lines 18–81 and 230–238 and in the B cell
line A20 (Fig. 5C). The introduction of a mutation in the
EBF binding site (Blk-EBFM) resulted in a reduction of the functional
activity to 25–30% of that of the wild-type Blk promoter
(Blk) in pre-B cell lines, while no significant effect of this mutation
could be observed in the A20 B cells. Furthermore, the EBF binding site
mutation did not effect the basal function of the promoter in the
non-EBF expressing S194 plasmacytoma cell line or in HeLa cells (data
not shown). The opposite was observed after mutation in the BSAP site
(Blk-BSAPM), which had only a marginal effect on the function of the
Blk promoter in the pre-B cells but resulted in a 50%
reduction of activity in the A20 B cells. Introduction of mutations in
both sites (Blk-EBM) did not reduce the functional activity of the
promoter below the level observed with an EBF mutation in the pre-B
cells, while a marginal effect could be observed in the A20 cells. This
suggests that a functional EBF binding site is important for the full
activity of the Blk promoter in pre-B cells but not in more
mature A20 B cells.
EBF and BSAP activate the Blk promoter cooperatively
The ability of the Blk promoter to interact with both
EBF and BSAP is shared by a large number of genes expressed early in
the B cell lineage (13, 15, 16, 18, 40, 41, 42). This opens
the possibility that cooperative activation by EBF and BSAP may be a
common theme in B cell-specific gene regulation. Because the mutation
of the defined BSAP binding site did not significantly effect the
binding of BSAP to the intact Blk promoter, we decided to do
reconstitution experiments to investigate a potential cooperation
between EBF and BSAP. Thus we made transient transfections of
Blk promoter controlled reporter constructs, together with
expression plasmids encoding either EBF or BSAP or the combination of
the two plasmids into HeLa cells (Fig. 6). Transfection of the Blk
promoter-controlled reporter construct with increasing amounts (50–200
ng) of BSAP expression plasmid resulted in up to a 10-fold increase of
reporter activity, while 400 ng of EBF expression plasmid resulted in a
9-fold increase of promoter activity. Transfection of 50, 100, or 200
ng BSAP expression vector together with 400 ng EBF expression plasmid
resulted in a 12-, 18-, or 35-fold induction of reporter activity. This
effect could not be explained by alterations in levels of the
transcription factors because EMSA analysis from single- and
double-transfected cells suggested that they expressed equal amounts of
EBF and BSAP (data not shown). The importance of a functional EBF
binding site for the cooperative action of EBF and BSAP was
investigated by transfection of a reporter gene under control of an EBF
binding site-mutated Blk promoter (Blk-EBFM; Fig. 2) and
expression plasmids encoding EBF or BSAP. Inclusion of 200 ng BSAP
expression plasmid induced the reporter gene 7.5-fold (Fig. 6), while
the combination of 200 ng BSAP and 400 ng EBF expression plasmids
increased the reporter activity 12-fold (Fig. 6). Transfection of a
minimal TATA box controlled reporter gene together with 400 ng EBF and
200 ng of BSAP expression plasmid resulted in a 2.4-fold up-regulation
of promoter activity (data not shown). These data suggest that both EBF
and BSAP interact with, and has the ability to activate, the
Blk promoter independently, but that the presence of both
factors results in a functional cooperation dependent of the EBF
binding site.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
EBF has previously been shown to interact with functionally important
regions of the mb-1 (6, 13), B29
(14), 5 (15, 16), and
VpreB (15, 18) promoters, and now also of the
Blk promoter. This suggests that EBF is a pleiotropic
activator of genes encoding components of the pre-BCR complex. EBF has
also been reported to activate the expression of IgL genes and BSAP in
dedifferentiated 70Z/3 pre-B cells (17). This would
propose that EBF has the ability to activate a large majority of the
genes known to define the pre-B cell stage and thus suggest that EBF
could be a fate-determining factor in B cell development. However, the
activation of some of the suggested target genes was not observed upon
stable ectopic expression of EBF in the hemopoietic cell line Ba/F3
(15), indicating that the activation of genes in the 70Z/3
cells is not solely dependent on the expression of EBF. Furthermore,
EBF-deficient mice do develop a pro-B cell compartment, suggesting that
the earliest stages of B cell development occur even in the absence of
EBF. Hence, it is uncertain if EBF alone is able to initiate a full B
cell developmental program. Rather, it appears that the factor is
involved in the regulation of a large number of genes important to
define the B cell lineage and that the role of EBF is to make B cell
differentiation possible rather than to determine the fate of the
progenitor cells.
The idea that EBF and BSAP act in concert to promote B cell
differentiation and share target genes has now been supported from
studies of the mb-1 (13, 42), 5,
VpreB (40, 41), and Blk (28, 30) (this report) promoters. However, such a cooperation has not
been clearly shown experimentally. We here present data suggesting that
these factors indeed interact functionally to activate the
Blk promoter. This functional cooperation did involve some
synergy because the combined effect was about twice as high as the
expected additive effect. The combined activity was also to a large
extent dependent on a functional EBF binding site, because the
induction of the mutated Blk promoter after coexpression of
the proteins was largely impaired. Mutation of the defined BSAP site
did not significantly effect BSAP binding to the whole promoter.
However, this mutation did prevent binding to a factor, presumably
NF-B (30), in A20 cells (P.Å., unpublished
observation). This factor could not be detected in pre-B cells,
suggesting that the effect of this mutation on promoter function in A20
cells (30) may be a result of impaired binding of this
factor rather than BSAP. However, previous studies indicate that
several mutations in the BSAP site of the Blk promoter
results in functional reductions of promoter activity
(30); thus, we believe that both EBF and BSAP participate
in the regulation of the Blk promoter. Similar findings have
been obtained from experiments addressing the regulation of the
mb-1 promoter, where mutation of either the EBF
(13) or the BSAP (42) binding sites results
in reduced functional activity of the promoter. However, the
observations that mutation of either of the binding sites only results
in reductions, as opposed to a complete abolishment, of promoter
activity, may suggest a partial redundancy among the two proteins. A
degree of redundancy is also supported by the finding that either of
the factors can activate the Blk promoter in HeLa cells.
It is also interesting to note that the functional relevance of the
Blk EBF binding site appears to be restricted to the pre-B
cell stage. Similar observations has been made in studies of EBF
regulation of the B29 (14, 43) and mb-1 (13, 44) genes, questioning the role of EBF in mature B cells. This
may be relevant because EBF has been suggested to directly regulate the
expression of the pre-B cell-specific genes encoding the surrogate
light chains 5 and Vpre-B (15, 16, 18). The finding
that the expression pattern of these genes (22, 45) do not
totally correlate to that of EBF, because EBF can be expressed also in
B cells (6, 13), has lead to the suggestion that EBF alone
cannot mediate pre-B cell-specific expression of the surrogate light
chain genes. However, this could be achieved if EBF function is altered
in the B cell, either by posttranslational mechanisms or due to the
lower expression levels observed in B as compared with pre-B cells
(6, 13). A third explanation could be expression of a
protein that interacts with EBF to modify its function or target gene
specificity. Such a mechanism has been proposed from studies of the
transcriptional regulation of olfactory neuron-specific genes where the
Zn finger protein Roaz modulates the activity of EBF (Olf-1) (46, 47). The continued expression of EBF target genes in more mature
developmental stages may then be achieved by a developmental shift to
involve other transcription factors (43).
Our attempts to activate the endogenous Blk gene by stable ectopic expression of EBF in the bone marrow-derived cell clone BaF/3 or by transient expression of EBF in S194 plasma-cytoma cells have been unsuccessful. We believe that this is due to the combined effects of a single EBF binding site and the rather low functional activity of the Blk promoter. The modest activity of the Blk promoter (28) (this study), contrasted by rather high expression levels of the endogenous gene (26, 28), may suggest this gene to be under the control of a distal enhancer element regulated by other factors than BSAP or EBF. This element could then together with EBF compensate for the absence of BSAP in mice carrying a homologous disruption of the Pax-5 gene (31).
Flow cytometric analysis of bone marrow from
EBF-/- mice suggested the presence of cells
expressing B220 and CD43 but not BP1 or HSA (9). PCR
analysis showed expression of sterile Ig transcripts (Iµ and µ0),
TdT, and IL-7 receptor transcripts but neither mRNA for Rag-1, Ig,
VpreB, 5, Igß, nor Ig gene recombination was detected
(9). This suggests that in the absence of EBF, B cell
development is arrested at the transition from fraction A (pro-B) to
fraction B pre-B cells. This phenotype cannot be explained by the
absence of any of the formerly known genetic targets and neither do we
believe that the absence of Blk can explain the observed phenotype.
Thus, we suggest that EBF is involved also in the regulation of other
yet unidentified genes whose identity and function will increase the
understanding of early B cell development.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Mikael Sigvardsson, Immunology Group, Cell and Molecular Biology, Lund University, Sölvegatan 21, S-223 62 Lund, Sweden. E-mail address:
3 Abbreviations used in this paper: EBF, early B cell factor; Blk, B lymphoid kinase; BSAP, B cell-specific activator protein; IgH, Ig heavy chain; BCR, B cell receptor; IgL, Ig light chain; ß-gal, ß-galactosidase; TBE, Tris-borate, EDTA; Blk-EBFM, Blk promotor with mutated EBF binding site; Blk-BSAPM binding site, Blk promotor with mutated BSAP binding site; Blk-EBM, Blk promotor with double mutated EBF and BSAP binding sites.
Received for publication April 21, 1999. Accepted for publication September 3, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
5 core enhancer activity. Eur. J. Immunol. 27:315.[Medline]
and Ig-ß components of the IgM antigen receptor complex by amino-terminal sequencing. Eur. J. Immunol. 20:2795.[Medline]
5, a new light-chain-related locus selectively expressed in pre-B lymphocytes. Nature 324:579.[Medline]
5 locus of the mouse, which appears to be selectively expressed in pre-B lymphocytes. EMBO J. 6:2267.[Medline]
B/p50 interacts with the blk gene during B cell activation. J. Biol. Chem. 273:18647. promoters. J. Immunol. 156:3788.[Abstract]
5 promoters as well as the KI and KII sites upstream of the J genes. Eur. J. Immunol. 27:750.[Medline]
5 gene transcribed selectively in pre-B lymphocytes. EMBO J. 6:103.[Medline]
This article has been cited by other articles:
|
|
 |
|
  S. Zandi, R. Mansson, P. Tsapogas, J. Zetterblad, D. Bryder, and M. Sigvardsson EBF1 Is Essential for B-Lineage Priming and Establishment of a Transcription Factor Network in Common Lymphoid Progenitors J. Immunol., September 1, 2008; 181(5): 3364 - 3372. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-H. Kuo, R. M. Gerstein, and L. H. Castilla Cbf{beta}-SMMHC impairs differentiation of common lymphoid progenitors and reveals an essential role for RUNX in early B-cell development Blood, February 1, 2008; 111(3): 1543 - 1551. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Lagergren, R. Mansson, J. Zetterblad, E. Smith, B. Basta, D. Bryder, P. Akerblad, and M. Sigvardsson The Cxcl12, Periostin, and Ccl9 Genes Are Direct Targets for Early B-cell Factor in OP-9 Stroma Cells J. Biol. Chem., May 11, 2007; 282(19): 14454 - 14462. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Mansson, P. Tsapogas, M. Akerlund, A. Lagergren, R. Gisler, and M. Sigvardsson Pearson Correlation Analysis of Microarray Data Allows for the Identification of Genetic Targets for Early B-cell Factor J. Biol. Chem., April 23, 2004; 279(17): 17905 - 17913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Merluzzi, M. Moretti, S. Altamura, P. Zwollo, M. Sigvardsson, G. Vitale, and C. Pucillo CD40 Stimulation Induces Pax5/BSAP and EBF Activation through a APE/Ref-1-dependent Redox Mechanism J. Biol. Chem., January 16, 2004; 279(3): 1777 - 1786. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Liberg, M. Sigvardsson, and P. Akerblad The EBF/Olf/Collier Family of Transcription Factors: Regulators of Differentiation in Cells Originating from All Three Embryonal Germ Layers Mol. Cell. Biol., December 15, 2002; 22(24): 8389 - 8397. [Full Text] [PDF]
|
|
|
|
|
|
P. Akerblad, U. Lind, D. Liberg, K. Bamberg, and M. Sigvardsson Early B-Cell Factor (O/E-1) Is a Promoter of Adipogenesis and Involved in Control of Genes Important for Terminal Adipocyte Differentiation Mol. Cell. Biol., November 15, 2002; 22(22): 8015 - 8025. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. K. Smith, R. Gisler, and M. Sigvardsson Cloning and Characterization of a Promoter Flanking the Early B Cell Factor (EBF) Gene Indicates Roles for E-Proteins and Autoregulation in the Control of EBF Expression J. Immunol., July 1, 2002; 169(1): 261 - 270. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Goitsuka, H. Mamada, D. Kitamura, M. D. Cooper, and C.-l. H. Chen2 Genomic Structure and Transcriptional Regulation of the Early B Cell Gene chB1 J. Immunol., August 1, 2001; 167(3): 1454 - 1460. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
2 µg of nuclear extracts
from a panel of cell lines using either a [32P]-labeled
octamer, a mb-1 promoter EBF binding site, or an
oligonucleotide spanning the region -7 to -32 of the
Blk promoter, as probes, is shown. The unbound probes
are indicated by F.