|
|
||||||||
Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
Endotoxin-induced uveitis (EIU) is an animal model of acute anterior
inflammation that is caused by an injection of LPS (11).
In this model, vascular endothelium, macrophages, and other cells may
be directly activated by LPS in principal. Although this model is not
an actual simulation of clinical uveitis, such as Behcets disease or
Reiters syndrome, subsequent cytokine activation with inflammatory
reactions may more or less mimic an acute phase of anterior uveitis. In
this model, cellular infiltration and the increase in protein level in
the aqueous humor reach maximum levels at
24 h after LPS treatment
(12, 13). We reported previously that selectins play key
roles in the initiation and retention of cellular infiltration in EIU;
P-selectin is expressed on the vascular endothelium in the iris-ciliary
body 15 min after LPS treatment and may contribute to the initial phase
of cellular infiltration (14); E-selectin may contribute
to the maintenance of cellular infiltration into the inflammatory site
during inflammation; its inhibition resulted in the early resolution of
uveitis (15). In cultured HUVEC, estrogen has been
reported to reduce the expression of E-selectin (3).
Considering the higher frequency of male patients with anterior uveitis
and the importance of E-selectin in EIU, we postulated that estrogen
may modulate cellular infiltration in EIU, and that E-selectin may be
one of the target molecules in this process. Also, modulation of
proinflammatory cytokines such as IL-1, IL-6, and TNF by estrogens in
monocytes and macrophages was reported by several authors
(16, 17, 18). Because increased expressions of these cytokine
genes were reported in EIU (13, 19, 20), we
speculated that estrogen could also modulate the expression of some of
these genes in EIU. Thus, in the present study, we first examined
whether there is a gender difference in the susceptibility to anterior
uveitis following LPS injection. We subsequently examined whether
estrogen modulates cellular infiltration and, if so, whether estrogen
has some effect on the expression of E-selectin in EIU. We also
screened for several proinflammatory cytokines to see whether estrogen
could modulate their gene expressions in vivo in EIU.
| Materials and Methods |
|---|
|
|
|---|
EIU was induced in adult male and female Lewis rats (200 g) by injection of 200 µg of LPS (Salmonella minnesota, Sigma, St. Louis, MO) diluted in 0.1 ml of sterile saline into one hind footpad. In ovariectomized female rats, EIU was induced 7 days after ovariectomy.
Drug treatment
17ß-Estradiol (E2, Sigma; 1, 10, or 100 µg/rat) was resolved in ethanol, diluted in 0.2 ml/rat of PBS, and administered i.p. at the time of LPS treatment. Tamoxifen was used as an estrogen receptor antagonist and was administered i.p. 1 h before LPS treatment at a dose of 150 µg/rat in 0.2 ml of PBS over 10 mg/rat of E2.
Evaluation of inflammatory response in EIU
The number of infiltrating cells into the aqueous humor and the
aqueous humor protein concentration were used as indicators of the
degree of anterior inflammation. Inflammation was evaluated at 24
h after LPS treatment, when cellular infiltration into the aqueous
humor reached a maximum level. The rats were sacrificed, and the
aqueous humor was collected at 24 h after LPS injection as
described previously (21). Briefly, the aqueous humor was
collected from both eyes by anterior chamber puncture (
15 µl/rat)
using a 30-gauge needle under a surgical microscope; the samples were
used for either cell counting or protein measurement. For cell
counting, the aqueous humor sample was suspended with an equal amount
of 0.4% trypan blue solution, and the cells were counted using a
hemocytometer under a light microscope; the number of cells per field
(an equivalent of 0.1 µl) was manually counted, and the number of
cells per microliter was obtained by averaging the results of four
fields from each sample. For protein measurement, each sample was
centrifuged to remove the cell pellet; the protein concentration in the
supernatant was measured using bicinchoninic acid protein assay reagent
(Pierce, Rockford, IL) with BSA as a standard.
Immunohistochemistry
The tissue fixation and immunohistochemical techniques used for examination of paraffin-embedded sections have been described previously (14, 15). Animals were anesthetized (pentobarbital sodium, 100 mg/kg) at 7 h after LPS injection (n = 3) and subsequently killed by cardiac perfusion of 4% paraformaldehyde in PBS. Whole enucleated eyes were fixed in 4% formaldehyde solution overnight at 4°C before paraffin embedding and were sectioned at 5 µm for immunohistochemical analysis. Sections were deparaffinized, and endogenous peroxidase was blocked with 0.3% hydrogen peroxide-methanol. Each section was incubated for 30 min with blocking serum. The sections were incubated overnight at 4°C in a humidified chamber with mouse antiestrogen receptor mAb (ABR, Golden, CO) or polyclonal anti-E-selectin Ab (R&D Systems, Minneapolis, MN) and subsequently washed for 10 min with PBS. Immunostaining was performed by the avidin-biotin peroxidase complex method (ABC Elite kit; Vector Laboratories, Burlingame, CA) with 3,3'-diaminobenzidine tetrahydrochloride (Dako, Glostrup, Denmark) as the substrate. The tissue sections were counterstained for methyl green. As a negative, control normal mouse IgG was used instead of the primary Ab. Other staining procedures were the same as described above.
Quantification of gene expressions of E-selectin and proinflammatory cytokines in the iris-ciliary body
Gene expressions of E-selectin, IL-1
, IL-1ß, IL-6, TNF, and
inducible NOS (iNOS) in the iris-ciliary body were studied using
semiquantitative PCR. Eyes were enucleated at 6 h after LPS
treatment. Each enucleated eye was cut into two pieces along the
limbus, and the iris-ciliary body and retina were separately collected
with fine forceps. RNA was extracted from the pooled iris-ciliary
bodies of both eyes of each animal according to the acid guanidinium
thiocyanate-phenol-chloroform extraction method (22). The
extracted RNA was quantified, and 5 µg of each sample was used to
make cDNA with a first strand DNA synthesis kit (Amersham Pharmacia
Biotech AB, Uppsala, Sweden). PCR was conducted by the method of Saiki
et al. with slight modifications (23). The PCR conditions
were denaturation at 95°C for 30 s, annealing at 55°C for
30 s, and extension at 72°C for 60 s. The reaction was
initiated by adding 2 U of Taq DNA polymerase (Perkin-Elmer
Cetus, Norwalk, CT); at total of 3035 cycles were performed for
E-selectin, IL-1
, IL-1ß, IL-6, TNF, iNOS, and GAPDH, respectively.
The primers used in this experiment were
GTGGAATGACGAGAGATGTGAC (sense strand) and
ACAGCTTTGCACGTGGCTTCT (antisense strand) for E-selectin,
GGCTCACTTCATGAGAACTGC (sense strand) and TGAACTCCTGCTTGACGATCC
(antisense strand) for IL-1
, GACCTGTTCTTTGAGGCTGAC (sense
strand) and TTCATCTCGAAGCCTGCAGTG (antisense strand) for
IL1ß, GACTGATGTTGTTGACAGCCACTGC (sense strand) and
TAGCCACTCCTTCTGTGACTCTAACT (antisense strand) for IL-6,
AGAACTCCAGGCGGTGTCTGT (sense strand) and CCTTGTCCCTTGAAGAGAACC
(antisense strand) for TNF, GCATGGACCAGTATAAGGCAAGCA (sense strand)
and GCTTCTGGTCGATGTCATGAGCAA (antisense strand) for iNOS, and
TGGCACAGTCAAGGCTGAGA (sense strand) and CTTCTGAGTGGCAGTGATGG
(antisense strand) for GAPDH (24). Nucleotide
sequencing and restriction analysis confirmed that the PCR products
were derived from the target cDNA sequences. PCR was conducted in a
semiquantitative manner as described previously (13).
Briefly, 2 µCi of radiolabeled dCTP was added to the PCR mixture.
Following electrophoresis of the PCR products, the bands were excised;
the radioactivity incorporated into the DNA was measured by Cerenkov
scintillation counting. A standard curve was drawn from the
radioactivities by serial dilution of the template cDNA. The relative
quantity of the expressed gene in the cDNA was calculated from this
standard curve. The cDNA concentration was first normalized by PCR with
the primers for GAPDH, and the relative expression of the target gene
was subsequently determined.
Statistical analysis
Data are expressed as means ± SD. Statistical analysis was performed using the Bonferroni method. p values of <0.05 were regarded as significant.
| Results |
|---|
|
|
|---|
We first studied the effects of different doses of
E2 (1, 10, and 100 µg) on EIU in male rats. In
EIU rats, the number of infiltrating cells in the aqueous humor at
24 h after LPS injection was 360 ± 9 cells/µl (mean
± SD, n = 3). Treatment with 10 µg of
E2 resulted in the most significant reduction in
cell number to 88 ± 10 cells/µl (n = 3,
p < 0.0001). At doses of 1 and 100 µg,
E2 showed a lesser but significant reduction of
cell number to 160 ± 17 and 177 ± 6 cells/µl,
respectively (n = 3, p < 0.0001) (Fig. 1
A).
|
We subsequently investigated whether there are gender differences in
susceptibility to EIU and the effects of E2 on
each sex. In EIU, cellular infiltration was more marked in male than in
female rats (363 ± 168 cells/µl vs 101 ± 37 cells/µl;
n = 5, p < 0.05).
E2 further reduced the cell number in female EIU
rats to 46 ± 19 cells/µl (n = 5), although this
was not statistically significant. In ovariectomized female rats, the
cell number increased above that of nonovariectomized female rats to
157 ± 30 cells/µl (n = 5, p <
0.05), which was again markedly reduced to 16 ± 10 cells/µl by
treatment with E2 (n = 5,
p < 0.005) (Fig. 2
A). The aqueous humor protein
content was also less in female than in male rats (5.9 ± 1.2
mg/ml vs 13.7 ± 2.5 mg/ml; n = 5,
p < 0.001). E2 further reduced
the protein level in female EIU rats to 4.4 ± 0.5 mg/ml
(n = 5), and ovariectomy increased the protein
concentration in EIU to 7.2 ± 3.2 mg/ml (n = 5),
although these effects were not statistically significant
(n = 5). Treatment with E2 and
LPS significantly reduced the protein concentration in ovariectomized
female rats to 2.1 ± 0.4 mg/ml (n = 5,
p < 0.05) (Fig. 2
B).
|
|
In paraffin-embedded sections, estrogen receptor-like
immunoreactivity was consistently observed in the nucleus of vascular
endothelium of the iris-ciliary body and in the nucleus of some stromal
cells (n = 3; Fig. 4
A, arrows). With normal mouse
IgG, no specific staining was observed (n = 3; Fig. 4
B).
|
The levels of mRNA expression of E-selectin and several
proinflammatory cytokines were evaluated in the iris-ciliary body using
a semiquantitative PCR. PCR products were obtained by PCR using
specific primers for E-selectin, IL-1
, IL-1ß, IL-6, TNF, iNOS, and
GAPDH cDNA in the iris-ciliary body. In this study, control rats were
each injected with 100 µl of endotoxin-free saline, and the
iris-ciliary bodies were collected 6 h later. The levels of
E-selectin mRNA expression are shown as a ratio to the level in the
control rats (Fig. 5
). E-selectin gene
expression was 23-fold higher in male rats receiving LPS injection, and
was reduced to 12.6-fold in rats receiving a simultaneous i.p.
injection of E2 (n = 5,
p < 0.05). The expression of E-selectin mRNA was then
reversed to 20.9-fold in rats receiving E2 and
tamoxifen with LPS, and tamoxifen added with LPS resulted in a
22.7-fold increase in the E-selectin mRNA level. As for proinflammatory
cytokines, the mRNA levels of all of the tested cytokines were
significantly increased in the iris-ciliary body following LPS
injection, but a significant effect of E2 was
only observed on IL-6 gene expression. In EIU male rats, the level of
IL-6 mRNA expression was raised to 3.0-fold of that for control rats;
this level was reduced to the control level in rats receiving a
simultaneous i.p. injection of E2
(n = 5, p < 0.05). The decreased
expression of IL-6 mRNA by E2, however, was not
reversed by tamoxifen (Fig. 6
). The
levels of mRNA of IL-1
, IL-1ß,TNF, and iNOS were not significantly
changed by either E2 or tamoxifen.
|
|
E-selectin immunoreactivity was observed along the inner surface
of vessel walls in the iris-ciliary body at 7 h after LPS
injection (n = 3; Fig. 7
A, arrows). The inner margins
of the vessel walls were not clearly visualized in the iris-ciliary
body from the EIU rats treated with E2
(n = 3; Fig. 7
B, arrowheads).
|
| Discussion |
|---|
|
|
|---|
Because male rats showed more marked cellular infiltration in EIU, and because we have previously observed the up-regulation of several cytokines, NO, and selectins in EIU in male rats (13, 14, 15, 21, 25), we performed additional experiments using male rats. Although the circulating levels of estrogen are low in males, the physiological and pathological functions of estrogen receptors in males have been suggested previously (i.e., estrogen administration was shown to improve vascular function in men (26) and estrogen reduces plaque formation in knockout male mice that express high levels of apoE (27)). In addition, estrogen receptors were reported to be present in the vascular smooth muscle cells from both males and females (28). To confirm whether estrogen receptors are also present in the anterior eye in our model, we performed immunohistochemical staining for estrogen receptor. Estrogen receptor-like immunoreactivity was found in the nucleus of the vascular endothelium and in the nucleus of some stromal cells in the iris-ciliary body.
The breakdown of the blood-aqueous barrier in uveitis involves cellular infiltration and an increase in protein permeability. Previous reports showed that these two features do not always occur in parallel and may involve independent mechanisms (14, 15); selectins significantly reduced cellular infiltration in EIU, but their effect on protein concentration was not significant. Similarly in the present study, the effect of estrogen was more apparent on cellular infiltration than on the increase in protein content in the aqueous humor in males. This implies that estrogen may act on some specific factors related to cellular infiltration, such as selectins. Selectins are a group of molecules that are involved in the rolling phase, the first step of cellular infiltration (6, 7, 8, 29). We reported previously that E-selectin is expressed on the vascular endothelium of the iris-ciliary body from 7 to 24 h after LPS treatment (15). We also showed that the expression of E-selectin seems to contribute to the retention of cellular infiltration during uveitis, and the inhibition of this molecule at any time during uveitis reduced subsequent cellular infiltration. In the present study, semiquantitative PCR revealed that E-selectin expression was reduced by 40% by E2 in the iris-ciliary body. Furthermore, tamoxifen reversed the effect of E2 on E-selectin expression. The parallel changes in E-selectin gene expression and cellular infiltration indicated that the effect of estrogen is likely to be mediated by its receptor in part by modulating the expression of E-selectin. Considering the marked effect of estrogen on cellular infiltration, we further screened for several other proinflammatory cytokines that are known to be up-regulated in EIU to determine whether estrogen could also modulate their gene expressions in vivo. Although E2 did not inhibit the LPS-induced expression of IL-1, TNF, and iNOS, it did have a significant inhibitory effect on IL-6 gene expression. The IL-6 gene was reported to be up-regulated in the anterior eye in EIU, and the IL-6 levels in the aqueous humor were shown to be well correlated with the severity of inflammation (19, 30), suggesting that the reduced production of IL-6 by E2 may contribute to the minimization of inflammatory reactions. The effect of estrogen on these cytokines, however, is somewhat disputable. For instance, Zuckerman et al. reported that pretreatment of estriol enhanced the increases in serum levels of TNF and IL-6 after LPS treatment (31), whereas an inhibitory effect of E2 on IL-6 production was reported in relation to the pathogenesis of osteoporosis (17) and in HeLa cells cotransfected with IL-6/chloramphenicol acetyltransferase constructs and estrogen receptor expression plasmid (32). Chao et al. reported that E2 at concentrations of >10-2 ng/ml reduced the amount of TNF released by peritoneal macrophages, whereas E2 at concentrations below this level increased the amount of TNF release (16). IL-1 is also reported to be both positively and negatively affected by estrogens, and the effect of E2 on IL-1 release was not dose-dependent (18, 33). These findings suggest that the effect of estrogen may well be complicated, especially in vivo; its effect is often not dose-dependent or even contradictory according to its concentrations. This may be due in part to its complicated roles as a receptor agonist and as an antioxidant and in part to the fact that estrogen could act on several types of cells capable of cytokine production, including endothelium and macrophages. These observations may also explain the discrepancy that estrogens have both positive and negative effects on autoimmune inflammatory reactions; it is known that premenopausal women are more susceptible to autoimmune diseases, and estrogen is reported to exacerbate Lupus disease (34); in contrast, estrogen is reported to reduce the incidence and severity of arthritis induced with type II collagen (35), and oral contraceptives reduced the incidence rate of rheumatoid arthritis (36).
We subsequently studied whether the effects of E2
observed in our study were receptor-mediated or antioxidative ones. In
many pathological conditions, estrogen seems to exert its effect by
functioning as an antioxidant. Estrogen has been shown to attenuate the
oxidative impairment of synaptic Na+/K+-ATPase
activity, glucose transport, and glutamate transport induced by amyloid
ß-peptide and iron (37). The formation of
atherosclerotic plaques is considered to be due in part to the in vivo
oxidative modification of low-density lipoprotein cholesterol, and the
cardioprotective effects of estrogen may be related to the antioxidant
abilities of estrogen (38); estrogen protects against the
endothelial and myocardial dysfunction resulting from brief
ischemia/reperfusion, which is considered to be antioxidant effect
(39). Interestingly in our model, estrogen is likely to
have exerted its effect on cellular infiltration and E-selectin
expression mainly through its receptor, because the estrogen receptor
antagonist tamoxifen reversed these effects of estrogen (Figs. 3
and 5
). In contrast, the effect of estrogen on the expression of IL-6 mRNA
was not reversed by tamoxifen, which suggested the effect of estrogen
as an antioxidant (Fig. 6
). These findings indicate that estrogen could
act both through the receptor and as an antioxidant in our EIU model.
Although much is known about the mechanisms of gene activation by
steroid receptors, including the estrogen receptor, which typically
involve binding of the ligand-activated receptor to the respective
response element of target genes, the mechanisms of their gene
repression are not well understood. In HeLa cells cotransfected with
IL-6 and estrogen receptor expression plasmid, E2
was shown to inhibit IL-6 gene expression through a receptor-mediated
indirect effect on the transcriptional activity of the IL-6 promoter
site, which lacks a classical estrogen response element
(32). Glucocorticoid inhibited the cytokine-induced
expression of adhesion molecules including E-selectin through its
receptor by interfering with the transcriptional activation potential
of DNA-bound NF-
B complexes; NF-
B is an inducible transcription
factor that participates in the induction of numerous cytokine genes
and other inflammation-associated genes, including E-selectin
(40, 41, 42). These observations may imply that estrogen could
also modulate the expression of other important genes in addition to
the ones tested in our study.
In the present study, we show gender differences in the susceptibility to EIU as well as the protective effects of estrogen against EIU. Considering the higher incidence of anterior uveitis in men, our observation that estrogen reduced the gene expressions of E-selectin and IL-6 in EIU may suggest a possible role for estrogen as an in vivo modulator of several important genes involved in the pathogenesis of human anterior uveitis.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Michiko Mandai, Department of Ophthalmology and Visual Sciences, Kyoto University Graduate School of Medicine, Kyoto 606-8507, Japan. ![]()
3 Abbreviations used in this paper: NOS, NO synthase; EIU, endotoxin-induced uveitis; E2, 17ß-estradiol; iNOS, inducible NOS. ![]()
Received for publication December 7, 1998. Accepted for publication April 16, 1999.
| References |
|---|
|
|
|---|
, interleukin-1ß, and tumor necrosis factor gene expression in endotoxin-induced uveitis. Invest. Ophthalmol. Vis. Sci. 35:1107.
transcription factor. P. Cohen, and J. P. Foulkes, eds. The Physiology of the NF-
Transcription Factor 423. Elsevier/North Holland Biochemical Press, Amsterdam.
B-like factor is essential but not sufficient for cytokine induction of endothelial leukocyte adhesion molecule 1 (ELAM-1) gene transcription. Nucleic Acids Res. 19:2645.
, and inhibition by glucocorticoids. Biochem. J. 328:707.
This article has been cited by other articles:
![]() |
C. Crisafulli, S. Bruscoli, E. Esposito, E. Mazzon, R. Di Paola, T. Genovese, P. Bramanti, G. Migliorati, and S. Cuzzocrea PPAR-{alpha} Contributes to the Anti-Inflammatory Activity of 17{beta}-Estradiol J. Pharmacol. Exp. Ther., December 1, 2009; 331(3): 796 - 807. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Banerjee, R. Rose, G. A. Johnson, R. C. Burghardt, and S. K. Ramaiah The Influence of Estrogen on Hepatobiliary Osteopontin (SPP1) Expression in a Female Rodent Model of Alcoholic Steatohepatitis Toxicol Pathol, June 1, 2009; 37(4): 492 - 501. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. CHAO, B. A. PARKER, and N. J. ZVAIFLER Accelerated Cutaneous Nodulosis Associated with Aromatase Inhibitor Therapy in a Patient with Rheumatoid Arthritis J Rheumatol, May 1, 2009; 36(5): 1087 - 1088. [Full Text] [PDF] |
||||
![]() |
S. Matsubara, C. H. Swasey, J. E. Loader, A. Dakhama, A. Joetham, H. Ohnishi, A. Balhorn, N. Miyahara, K. Takeda, and E. W. Gelfand Estrogen Determines Sex Differences in Airway Responsiveness after Allergen Exposure Am. J. Respir. Cell Mol. Biol., May 1, 2008; 38(5): 501 - 508. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Torgler, S. E. Bongfen, J. C. Romero, A. Tardivel, M. Thome, and G. Corradin Sporozoite-Mediated Hepatocyte Wounding Limits Plasmodium Parasite Development via MyD88-Mediated NF-{kappa}B Activation and Inducible NO Synthase Expression J. Immunol., March 15, 2008; 180(6): 3990 - 3999. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Bukulmez, D. B. Hardy, B. R. Carr, R. A. Word, and C. R. Mendelson Inflammatory Status Influences Aromatase and Steroid Receptor Expression in Endometriosis Endocrinology, March 1, 2008; 149(3): 1190 - 1204. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. H. Straub The Complex Role of Estrogens in Inflammation Endocr. Rev., August 1, 2007; 28(5): 521 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Esposito, A. Iacono, G. M. Raso, M. Pacilio, A. Coppola, R. Di Carlo, and R. Meli Raloxifene, a Selective Estrogen Receptor Modulator, Reduces Carrageenan-Induced Acute Inflammation in Normal and Ovariectomized Rats Endocrinology, August 1, 2005; 146(8): 3301 - 3308. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghisletti, C. Meda, A. Maggi, and E. Vegeto 17{beta}-Estradiol Inhibits Inflammatory Gene Expression by Controlling NF-{kappa}B Intracellular Localization Mol. Cell. Biol., April 15, 2005; 25(8): 2957 - 2968. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. C. Chadwick, S. Chippari, E. Matelan, L. Borges-Marcucci, A. M. Eckert, J. C. Keith Jr., L. M. Albert, Y. Leathurby, H. A. Harris, R. A. Bhat, et al. Identification of pathway-selective estrogen receptor ligands that inhibit NF-{kappa}B transcriptional activity PNAS, February 15, 2005; 102(7): 2543 - 2548. [Abstract] [Full Text] [PDF] |
||||
![]() |
C-C Chan, G F Reed, Y Kim, E Agron, and R R Buggage A correlation of pregnancy term, disease activity, serum female hormones, and cytokines in uveitis Br J Ophthalmol, December 1, 2004; 88(12): 1506 - 1509. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. C. Harnish, L. M. Albert, Y. Leathurby, A. M. Eckert, A. Ciarletta, M. Kasaian, and J. C. Keith Jr. Beneficial effects of estrogen treatment in the HLA-B27 transgenic rat model of inflammatory bowel disease Am J Physiol Gastrointest Liver Physiol, January 1, 2004; 286(1): G118 - G125. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Bucolo, S. Cuzzocrea, E. Mazzon, and A. P. Caputi Effects of Cloricromene, a Coumarin Derivative, on Endotoxin-Induced Uveitis in Lewis Rats Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1178 - 1184. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. W. Cousins, M. E. Marin-Castano, D. G. Espinosa-Heidmann, A. Alexandridou, L. Striker, and S. Elliot Female Gender, Estrogen Loss, and Sub-RPE Deposit Formation in Aged Mice Invest. Ophthalmol. Vis. Sci., March 1, 2003; 44(3): 1221 - 1229. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Marin-Castano, S. J. Elliot, M. Potier, M. Karl, L. J. Striker, G. E. Striker, K. G. Csaky, and S. W. Cousins Regulation of Estrogen Receptors and MMP-2 Expression by Estrogens in Human Retinal Pigment Epithelium Invest. Ophthalmol. Vis. Sci., January 1, 2003; 44(1): 50 - 59. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alvarez, C. Hermenegildo, A. C. Issekutz, J. V. Esplugues, and M.-J. Sanz Estrogens Inhibit Angiotensin II-Induced Leukocyte-Endothelial Cell Interactions In Vivo via Rapid Endothelial Nitric Oxide Synthase and Cyclooxygenase Activation Circ. Res., December 13, 2002; 91(12): 1142 - 1150. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Evans, K. Lai, L. J. Shaw, D. C. Harnish, and C. C. Chadwick Estrogen Receptor {alpha} Inhibits IL-1{beta} Induction of Gene Expression in the Mouse Liver Endocrinology, July 1, 2002; 143(7): 2559 - 2570. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Miyamoto, M. Mandai, H. Takagi, I. Suzuma, K. Suzuma, S. Koyama, A. Otani, H. Oh, and Y. Honda Contrasting Effect of Estrogen on VEGF Induction under Different Oxygen Status and Its Role in Murine ROP Invest. Ophthalmol. Vis. Sci., June 1, 2002; 43(6): 2007 - 2014. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohta, K. Nakayama, T. Kurokawa, T. Kikuchi, and N. Yoshimura Inhibitory Effects of Pyrrolidine Dithiocarbamate on Endotoxin-Induced Uveitis in Lewis Rats Invest. Ophthalmol. Vis. Sci., March 1, 2002; 43(3): 744 - 750. [Abstract] [Full Text] [PDF] |
||||
![]() |
C Cuello, D Wakefield, and N Di Girolamo Neutrophil accumulation correlates with type IV collagenase/gelatinase activity in endotoxin induced uveitis Br J Ophthalmol, March 1, 2002; 86(3): 290 - 295. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pfeilschifter, R. Koditz, M. Pfohl, and H. Schatz Changes in Proinflammatory Cytokine Activity after Menopause Endocr. Rev., February 1, 2002; 23(1): 90 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Direskeneli Behcet's disease: infectious aetiology, new autoantigens, and HLA-B51 Ann Rheum Dis, November 1, 2001; 60(11): 996 - 1002. [Full Text] [PDF] |
||||
![]() |
A. Nonaka, J. Kiryu, A. Tsujikawa, K. Yamashiro, K. Miyamoto, H. Nishiwaki, M. Mandai, Y. Honda, and Y. Ogura Administration of 17{beta}-Estradiol Attenuates Retinal Ischemia-Reperfusion Injury in Rats Invest. Ophthalmol. Vis. Sci., August 1, 2000; 41(9): 2689 - 2696. [Abstract] [Full Text] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |