|
|
||||||||




*
Veterans Administration Medical Center, Iowa City, IA 52242; and Divisions of
Pulmonary, Critical Care, and Occupational Medicine, and
Rheumatology, Department of Internal Medicine, University of Iowa, Iowa City, IA 52242
| Abstract |
|---|
|
|
|---|
, and macrophage inflammatory protein-2 in the lavage fluid
following LPS inhalation. The immunoprotective effect of CpG-containing
oligonucleotides was dose-dependent and was most pronounced in mice
pretreated between 2 and 4 h before the inhalation challenge,
corresponding to the peak levels of serum cytokines. bDNA resulted in a
similar immunoprotective effect, and methylation of the CpG motifs
abolished the protective effect of CpG oligonucleotides. The protective
effect of CpG oligonucleotides was observed in mice with either a
disrupted IL-10 or IFN-
gene, but release of cytokines in the lung
was increased, especially in the mice lacking IFN-
. In contrast, CpG
DNA did not protect mice with a disrupted IL-12 gene against the
LPS-induced cellular influx, even though CpG DNA reduced the release of
TNF-
and macrophage inflammatory protein-2 in the lung. These
findings indicate that CpG-containing oligonucleotides or bDNA are
protected against LPS-induced cellular airway inflammation through an
IL-12-dependent pathway, and that the pulmonary cytokine and cellular
changes appear to be regulated independently. | Introduction |
|---|
|
|
|---|
20-fold more common in bDNA than in
vertebrate DNA. CpG motifs appear to be underrepresented in vertebrate
genomes; when present, they are more likely to be methylated. DNA
containing unmethylated CpG motifs results in B cell proliferation and
in the release of IL-6 and IL-10 (2, 3, 4, 5), NK cell
activation, secretion of IFN-
(2, 6, 7, 8), and monocyte
activation with elevated production of TNF-
and IL-12 (9, 10). Further evaluation of the immunologic response to
CpG-containing oligonucleotides indicates that these specific motifs
stimulate a Th1-like inflammatory response dominated by the release of
IL-12 and IFN-
(2). However, oligonucleotides
containing CpG motifs also stimulate the production and secretion of
IL-10 (4, 5), a potent immunosuppressive cytokine
(11). Thus, in addition to the potential adjuvant effects
of oligonucleotides containing CpG motifs (12, 13, 14, 15, 16, 17), these
agents are particularly effective in substantially modifying a Th2
cytokine-driven inflammatory response, making it more Th1-like
(18). Moreover, the potent immunologic activation by
unmethylated CpG motifs suggests that the vertebrate immune system uses
these unique bDNA characteristics to trigger innate immune defenses
against infection by microorganisms. Endotoxin is one of the primary mediators of inflammation released by Gram-negative organisms and appears to be an important cause of environmentally induced airway disease. Inhaled endotoxin is strongly associated with the development of acute decrements in airflow among cotton workers (19, 20, 21), swine confinement workers (22), and poultry workers (23). We have shown that the concentration of endotoxin in the bioaerosol appears to be the most important occupational exposure associated with the development (24) and progression (25) of airway disease in agricultural workers. In addition, the concentration of endotoxin in the domestic environment adversely effects asthmatics, with higher concentrations of ambient endotoxin associated with greater degrees of airflow obstruction (26, 27). Physiologically, inhaled endotoxin (26, 28, 29, 30, 31) can cause airflow obstruction in naive or previously unexposed subjects. Furthermore, asthmatic individuals develop airflow obstruction at lower concentrations of inhaled endotoxin than normal controls (31). Exposure-response studies have shown that inhaled LPS results in recruitment of neutrophils, activation of macrophages with production and release of proinflammatory cytokines, and damage to airway epithelia in a dose-dependent manner (32, 33, 34, 35). In aggregate, these studies indicate that endotoxin is a potentially important cause of airway disease among exposed individuals.
Given the immune modulating effects of CpG-containing oligonucleotides
and the possibility that the vertebrate immune system uses the unique
unmethylated CpG motifs in bDNA to defend against the potentially
adverse effects of microorganisms, we reasoned that systemic treatment
with either bDNA or these oligonucleotides containing unmethylated CpG
motifs may reduce the inflammatory response to inhaled LPS. Because
IFN-
is a key cytokine mediating LPS-induced inflammation
(36, 37, 38) and because IL-10 inhibits IFN-
via a
macrophage-dependent step (39), we further hypothesized
that these CpG-containing oligonucleotides would reduce the
inflammatory response to LPS by increasing the production and release
of IL-10. Although our findings demonstrate that the systemic
administration of either bDNA or oligonucleotides containing
unmethylated CpG motifs does indeed suppress the inflammatory response
to inhaled LPS, IL-12 rather than IL-10 or IFN-
appears to be
important in mediating this process.
| Materials and Methods |
|---|
|
|
|---|
In the first series of experiments, mice were treated i.v. with
20 base oligonucleotides containing CpG motifs (CpG oligo) or 20 base
oligonucleotides without embedded CpG motifs (non-CpG oligo) at 1, 2,
3, 4, 6, or 12 h before a 4-h inhalation challenge with
Escherichia coli LPS (35 µg/m3).
Next, we determined whether bDNA was also effective in protecting
against the inflammatory effects of inhaled LPS by pretreating mice
with either 25 µg of E. coli DNA or 25 µg of calf thymus
DNA 2 h before an inhalation challenge with E. coli
LPS. To determine whether unmethylated CpG motifs were responsible for
the protective effect, we subsequently pretreated mice with
oligonucleotides containing either unmethylated CpG motifs or
methylated CpG motifs before an inhalation challenge with E.
coli LPS. To determine the role of IL-10, IFN-
, or IL-12, we
pretreated IL-10 (C57BL/6-IL-10tm1Cgn),
IFN-
(C57BL/6-IFN-
tm1Ts), or IL-12
(C57BL/6-IL-12btm1Jm) knockout (KO) mice
with CpG-containing oligonucleotides and then performed a similar
inhalation challenge with E. coli LPS. Immediately after
inhalation challenge, all mice were sacrificed, blood samples were
obtained, whole lung lavage was performed, and lungs were harvested for
mRNA analysis. In all experiments, five mice were used for each
condition.
Animals
C57BL/6, C57BL/6-IL-10tm1Cgn,
C57BL/6-IFN-
tm1Ts, and
C57BL/6-IL-12btm1Jm male mice (The Jackson
Laboratory, Bar Harbor, ME) were obtained at 6 wk of age and used
within 2 wk. All animal care and housing requirements set forth by the
National Institutes of Health Committee on Care and Use of Laboratory
Animals of the Institute of Laboratory Animal Resources were followed,
and animal protocols were reviewed and approved by the Institutional
Animal Care and Use Committee. Mice were maintained in wood-chip
bedding (Northeastern Product, Warrensberg, NY), with food (Formulab
Chow 5008, PMI, Richmond, IN) and water supplied ad libitum.
Oligonucleotides
A total of 20 base oligonucleotides were synthesized with and without the embedded CpG motifs (Oligos etc., Wilsonville, OR). These oligonucleotides contained a nuclease-resistant phosphorothioate-modified backbone and were purified by two rounds of ethanol precipitation before use. The CpG oligonucleotide was selected for study because of previous studies showing it to have a strong immunostimulatory effect (40). The "nonstimulatory" oligonucleotide was identical with the stimulatory oligonucleotide, except that the two embedded CpG motifs were modified; one appeared as an ApG motif and the other appeared as a GpC motif. The two synthesized oligonucleotides had the following sequences: CpG oligonucleotide, ATAATCGACGTTCAAGCAAG; non-CpG oligonucleotide, ATAATAGAGCTTCAAGCAAG. Where indicated, a methylated oligonucleotide was synthesized by replacing the two underlined Cs in the CpG oligonucleotide sequence with 5-methylcytosine.
Genomic DNA
E. coli (strain B) DNA and calf thymus DNA were purchased from Sigma (St. Louis, MO) and purified by extraction with phenol:chloroform:isoamyl alcohol (25:24:1) and ethanol precipitation. The LPS level in the E. coli and calf thymus DNA was <0.06 ng/mg of DNA by Limulus assay. Heat-denatured (single-stranded) genomic DNA was used in all experiments.
Chemicals
Endotoxin was purchased as lyophilized, purified E. coli 0111:B4 LPS (PN# L2630, Sigma) and had a specified activity of 1.3 x 106 ng/mg and a protein content of <3%.
Endotoxin assay
The endotoxin concentrations of the LPS solution, LPS aerosol, oligonucleotides, and genomic DNA were assayed using the chromogenic Limulus amebocyte lysate assay (QCL-1000, BioWhittaker, Walkersville, MD) with sterile, pyrogen-free labware and a temperature-controlled microplate block and microplate reader (405 nm). The LPS solution was serially diluted in pyrogen-free water (pfw) and assayed. The airborne concentration of LPS was assessed by sampling 0.30 m3 of air drawn from the exposure chamber through 47-mm binder-free glass microfiber filters (EPM-2000, Whatman International, Maidstone, U.K.) held within a 47-mm stainless steel in-line air sampling filter holder (Gelman Sciences, Ann Arbor, MI). Air-sampling filters were extracted with 10 ml of pfw at room temperature with gentle shaking for 1 h. Next, the filters were serially diluted with pfw and assayed for endotoxin. Four to six air samples were assayed for each exposure. All standard curves (0.11.0 endotoxin units/ml) achieved a linear regression coefficient exceeding r = 0.995. Our laboratory routinely runs spiked samples and filter blanks and participates in interlaboratory validation studies.
Exposure protocol and monitoring equipment
LPS aerosols were generated into a glass 20-liter exposure chamber using a PITT#1 nebulizer supplied with extract by a syringe pump. Liquid feed rates ranged from 0.0027 to 0.21 ml/min. High-efficiency particulate air-filtered air was supplied to the nebulizer at flow rates ranging from 10 to 17 L/min. Mixing within the chamber was aided by a magnetically coupled rotor. The chamber atmosphere was exchanged at 1 change/min. LPS concentrations were determined by sampling the total chamber outflow. Particle size distributions were determined with an aerodynamic particle sizer (TSI, St. Paul, MN) and gravimetrically with a Marble personal cascade impactor and Mylar media (41) by sampling within the exposure chamber.
Lung lavage
Immediately following the inhalation challenge, mice were euthanized, the chest was opened, and lungs were lavaged in situ via PE-90 tubing inserted into the exposed trachea. A pressure of 25 cm H2O was used to wash the lungs with 6.0 ml of sterile pyrogen-free saline. Following whole lung lavage, the lungs were isolated, frozen in liquid nitrogen, and stored at -70°C.
Treatment of bronchoalveolar lavage fluid
Our standard method (33) of processing the sample is as follows: immediately following lavage, the volume is noted and 15-ml conical tubes are centrifuged for 5 min at 200 x g. The supernatant fluid is decanted and frozen at -70°C for subsequent use. The residual pellet of cells is resuspended and washed twice in HBSS (without Ca2+ or Mg2+). After the second wash, a small aliquot of the sample is taken for cell count using a hemocytometer. Next, the cells are washed once more and resuspended in RPMI 1640 medium so that the final concentration gives a cell count of 1 x 106 cells/ml. The cells that are present in 1012 (one of the 1 x 106 ml cell suspensions) are spun for 5 min onto a glass slide using a special filter card with a cytocentrifuge (Cytospin-2; Shanden Southern, Sewickley, PA). Staining is conducted using a Diff Quick Stain set (Harleco, Gibbstown, NY). The slide is then dried, one drop of optically clear immersion oil is put on the slide over the cells, and a coverslip is placed on top.
Cytokine analysis of lavage fluid and serum
Lavage fluid and serum were assayed for TNF-
, macrophage
inflammatory protein-2 (MIP-2), IL-6, IL-10, IL-12 (p-40), and IFN-
.
In all cases, a polyclonal Ab specific for the murine recombinant
cytokine (TNF-
, MIP-2, IL-6, IL-10, IL-12, or IFN-
) was used as a
capture reagent in a standard commercially available sandwich ELISA
(R&D Systems, Minneapolis, MN). The limit for detection is 5.1 pg/ml
for TNF-
, 1.5 pg/ml for MIP-2, 10 pg/ml for IL-6, 10 pg/ml for
IL-10, 5 pg/ml for IL-12, and 10 pg/ml for IFN-
.
Preparation of RNA and multiprobe RNase protection assay
Total RNA was extracted from lung specimens using the
single-step method (42, 43), lysing flash-frozen lungs in
RNA STAT-60 (Tel-Test B, Friendswood, TX). The composition of RNA
STAT-60 includes phenol and guanidinium thiocyanate in a monophase
solution. The lung parenchyma were homogenized in the RNA STAT-60 using
a polytron homogenizer. Chloroform was added; total RNA was
precipitated from the aqueous phase by addition of isopropanol, washed
with ethanol, and solubilized in water. After drying the pellet in a
vacuum desiccator, the yield and purity of the RNA were quantitated by
measuring the ratio of absorbances at 260 and 280 nm. Minigel
electrophoresis was used to confirm the integrity of the 28S and 18S
rRNA bands. Gene transcripts were detected using the RNase protection
assay as described previously (44). Equivalent amounts of
RNA were examined, as judged by the amount of L32, which encodes an
ubiquitously expressed ribosome subunit protein (45) in
each sample. Commercially available probes were used to detect TNF-
,
MIP-2, IL-6, IL-10, IL-12, and IFN-
.
Statistical analysis
Four comparisons were pursued in this analysis: 1) the effect of
i.v. CpG-containing oligonucleotides vs oligonucleotides without
embedded CpG motifs in modulating the inflammatory response to inhaled
LPS; 2) the effect of i.v. bDNA vs calf thymus DNA in modulating the
inflammatory response to inhaled LPS; 3) the effect of unmethylated CpG
motifs vs methylated CpG motifs in controlling the inflammatory
response to LPS; and 4) the role of IL-10, IFN-
, or IL-12 in
mediating the protective effect of unmethylated CpG-containing
oligonucleotides. The inflammatory response was assessed using lavage
cellularity, lavage fluid cytokine concentration, serum concentration
of cytokines, and the relative concentration of mRNA for specific
cytokines in the lung parenchyma. Given the number of mice for each
comparison (four to six per group), the Mann-Whitney U
nonparametric statistical test was used to test all comparisons
(46).
| Results |
|---|
|
|
|---|
and IFN-
at any of the timepoints
in mice pretreated with either oligonucleotide, although in some other
mouse strains, these cytokines are easily detected after CpG treatment
(6).
|
and MIP-2 and
in an elevation in the concentration of IL-12 in the lavage fluid
following treatment with CpG oligonucleotides 2 h before the
inhalation challenge (Fig. 2
were not measurable in the lavage fluid following inhalation of LPS at
any of the timepoints. Interestingly, results from the RNase protection
assay indicate that total lung mRNA concentrations for TNF-
,
IL-1ß, MIP-2, MIP-1
, MIP-1ß, and IFN-
are similar in the lung
tissue of mice pretreated with CpG- or non-CpG-containing
oligonucleotides 2 h before the LPS inhalation (Fig. 3
|
|
, MIP-2, or IL-12 or the in serum
concentration of TNF-
, IL-6, IL-10, or IFN-
(cytokine data not
presented). Interestingly, bDNA, in comparison with calf thymus DNA,
resulted in a significant increase in the concentration of IL-12 in the
serum (14,581.6 ± 2,067.6 vs 2,120.2 ± 747.7 ng/ml;
p = 0.009), suggesting that the serum concentration of
IL-12 might be important in the immunoprotective effect of
bDNA.
|
Because endogenous and exogenous IL-10 are known to suppress the
inflammatory response to LPS (11, 47) and CpG
oligonucleotides increase the production and secretion of IL-10
(4, 5), we reasoned that IL-10 might be playing a critical
role in mediating the immunoprotective effects of CpG oligonucleotides.
To pursue this hypothesis, we pretreated mice genetically deficient in
IL-10 (C57BL/6-IL-10tm1Cgn) with
oligonucleotides with or without CpG motifs and subsequently performed
an inhalation challenge with E. coli LPS. Compared with
pretreatment with i.v. oligonucleotides not containing a CpG motif,
CpG-containing oligonucleotides significantly reduced the total
cellularity and the percentage of PMNs in the lavage fluid in mice with
a disrupted IL-10 gene
(C57BL/6-IL-10tm1Cgn) (Fig. 5
A). Although the
concentration of TNF-
and MIP-2 was similar in the lavage fluid
between these treatment groups, IL-12 was markedly elevated in the mice
pretreated with CpG-containing oligonucleotides (Fig. 5
B).
Moreover, as seen with the response to i.v. bDNA, IL-12 was found to be
markedly elevated in the serum in IL-10-deficient mice that were
treated with CpG-containing oligonucleotides and challenged with LPS
(data not presented). Importantly, the immunoprotective effects of CpG
oligonucleotides in mice with a disrupted IL-10 gene were more profound
than those observed among wild-type mice (Fig. 2
, A and
B).
|
and MIP-2 in the lavage fluid in IL-12 KO mice challenged
with inhaled LPS (Fig. 6
and
MIP-2 may not be essential to the cellular response to inhaled LPS.
Moreover, additional studies demonstrate that the IL-12-dependent
immunoprotective effect of CpG-containing oligonucleotides is not
dependent upon IFN-
. CpG-containing oligonucleotides resulted in a
reduced inflammatory response to inhaled LPS in IFN-
KO mice
(C57BL/6-IFN-
tm1Ts) (Fig. 7
KO mice following treatment with CpG-containing
oligonucleotides, CpG-containing oligonucleotides also resulted in an
increase in IL-12 in the lavage fluid.
|
|
| Discussion |
|---|
|
|
|---|
and MIP-2. The
immunoprotective effect of CpG-containing oligonucleotides requires
unmethylated CpG motifs embedded within the oligonucleotide. Moreover,
our results indicate that the protective effect of CpG oligonucleotides
against the cellular influx is dependent upon IL-12 but does not
require IL-10 or IFN-
. These findings suggest that oligonucleotides
containing CpG motifs may prove helpful in controlling the inflammatory
response to inhaled LPS and possibly other environmental toxins. In previous studies, we and others have shown that DNA containing CpG motifs can cause a systemic inflammatory response syndrome and prime inflammatory cells for LPS-induced toxicity (6, 48). Superficially, those results are surprising in light of the current demonstration that CpG DNA can prevent LPS-induced toxicity in the lung. However, a closer examination of these experimental systems and results sheds light on the organ-specific regulation of the inflammatory response to LPS. In the previous studies, the administration of high doses of CpG DNA caused a strong systemic immune activation that predisposed to systemic inflammatory response syndrome. However, lower doses of CpG DNA cause a less marked immune activation which can be therapeutically useful (12, 13, 14, 15, 16, 17, 18, 49, 50).
The immune activation triggered by CpG DNA can be associated with the
expression of a set of cytokines, including TNF-
, IFN-
ß,
IFN-
, IL-6, IL-10, IL-12, IL-18, and MIP-2, depending upon the cell
type and mouse strain studied (1, 2, 6, 7, 10, 13, 40, 51). The predominant effects of these cytokines are generally
thought to be proinflammatory, although some of the cytokines, such as
IL-10 and IL-12, have mutually antagonistic effects. It is not obvious
that any of these cytokines should mediate the CpG-induced suppression
of endotoxin toxicity. Indeed, both IL-10 and IL-12 are produced in the
lung following endotoxin inhalation, and IL-12 is required for
endotoxin-induced lethality (52). Alternatively, IL-12 can
either promote or suppress collagen-induced inflammatory arthritis,
depending upon the timing of administration (53). IL-12
has also been reported to suppress angiogenesis (54) and
graft vs host disease (55) and to induce NO-mediated
immunosuppression following vaccination (56). Thus,
although our finding that IL-12 is required for the CpG-mediated
suppression of endotoxin-induced pulmonary cellular inflammation was
unexpected, there is some precedent for IL-12 to antagonize
inflammation. Moreover, IL-12 is down-regulated in allergic asthma and
increases in asthmatics that have a beneficial response to
corticosteroids (57). These findings suggest that IL-12
may play an important role in preventing or reducing airway
inflammation.
In general, IL-12 could block lung inflammation either through local direct effects (mediated through the action on cells in the lung), through systemic effects possibly involving the induction of other cytokines, or through some combination of effects. We believe that a pure local effect may not explain our results, because inhaled CpG induces local inflammation (40) and does not block LPS-induced lung inflammation. The cellular and molecular mechanisms through which IL-12 exerts these effects await further investigation.
Our finding that the IL-12-dependent immunoprotective effects of
CpG-containing oligonucleotides do not require IFN-
is very
important. IFN-
has been shown previously to mediate several of the
immunologic activities of IL-12, although other effects of IL-12
are IFN-
-independent (58, 59, 60, 61). The local production of
IFN-
is a critical element in the initiation of cytokine-mediated
inflammatory responses. IFN-
, in turn, can direct the release of
other effector molecules such as TNF-
, IL-1, and IL-6
(62). Experimental manipulations that increase or decrease
the amount of IFN-
produced result in a corresponding accentuation
or inhibition of inflammatory responses. IFN-
is produced by T cells
and NK cells in response to IL-12 (60, 63), but IFN-
production is inhibited by IL-10 (39). Recent studies have
established that the magnitude of the systemic response to LPS
administration, such as the Shwartzman reaction or the response to
Gram-negative infection, is significantly increased by IFN-
or IL-12
(36, 37). However, our findings demonstrate that the lung
cellular inflammatory response to inhaled LPS and the IL-12-dependent
immunoprotective effects of CpG-containing oligonucleotides are not
dependent upon IFN-
. Nonetheless, IL-12 is not required for the
protective effect of CpG DNA on the pulmonary cytokine response to
inhaled LPS (Fig. 6
B). This finding suggests that these
acute proinflammatory cytokines, which are regulated by IL-12 or
IFN-
, are neither essential to the acute cellular response to
inhaled LPS nor involved in this immunoprotective effect of
CpG-containing oligonucleotides. In fact, our studies with the IFN-
KO mice demonstrate that CpG oligonucleotides inhibit PMN recruitment
to the lung despite marked increases in MIP-2, suggesting that IL-12
inhibits the chemotactic effects of potent chemokines.
IL-10 opposes the inflammatory actions of Th1-like cytokines, such as those whose expression is induced by CpG DNA. Thus, the fact that IL-10 is not required for the endotoxin-neutralizing effect of CpG DNA is quite compatible with the requirement of IL-12 for this effect. IL-10 has well-established immunosuppressive effects in models of transplant rejection (64), indicating that the inflammatory mechanisms involved in transplant rejection differ from those that are involved in LPS-induced pulmonary inflammation.
In considering the immunoprotective effects of CpG-containing
oligonucleotides, one must ask whether these oligonucleotides are
simply tolerizing mice to LPS through mechanisms of LPS tolerance.
Tolerance to the toxic effects of endotoxin was first recognized by
physicians who used bacterial vaccines for fever therapy
(65). Several studies have shown that LPS tolerance is an
active, well-orchestrated response presumably designed to limit
excessive inflammation. Repeated sublethal injections of endotoxin in
humans and animals result in a diminished release of inflammatory
mediators to endotoxin (33, 66, 67). The
"hyporesponsive" macrophage is thought to play a key role in the
development of early endotoxin tolerance for three reasons. First,
early endotoxin tolerance is associated with a decreased release of
arachidonic acid metabolites by macrophages (68),
decreased endotoxin-induced G protein function in peritoneal
macrophages (66), and diminished production of TNF-
by
peritoneal macrophages (67, 69). Second, the transfer of
peritoneal macrophages from endotoxin-sensitive mice to
endotoxin-resistant mice will render the resistant mice sensitive to
the toxic effects of endotoxin (70, 71). Third, tolerance
to endotoxin is associated with an increase in the concentration of
macrophage progenitors in the bone marrow (72), suggesting
that the pool of available macrophages in endotoxin-tolerant animals
may be immature and unable to respond to endotoxin. The specific
importance of TNF-
and IL-1 in the development of endotoxin
tolerance is suggested by several studies that have shown that repeated
administrations of TNF-
or IL-1 can significantly decrease morbidity
and mortality from endotoxin (73, 74, 75, 76) and Gram-negative
sepsis (76, 77). However, tolerance to LPS is independent
of TNF-
and IL-1 (78). LPS tolerance results in an
increase in the expression of several genes including p50 of NF-
B
(79), TNF receptor type II (80), IL-10
(81, 82), and TGF-ß1
(82). In fact, IL-10 and TGF-ß1
may be important in mediating tolerance to LPS (82).
Moreover, IL-12 (as well as IFN-
and GM-CSF) can effectively prevent
and reverse LPS desensitization (83). Because IL-12 is
important in mediating the immunoprotective effects of CpG-containing
oligonucleotides in our model of lung injury, the mechanisms of LPS
tolerance appear to be distinct from those involved with CpG-containing
oligonucleotides.
The immunoprotective effect of CpG-containing oligonucleotides suggests that this class of agents may prove effective in the prevention and treatment of LPS-mediated airway disease. Although we have shown previously in mice that either tolerance to LPS (33) or pretreatment with an LPS antagonist (84) substantially reduces the inflammatory response to inhaled grain dust, these specific approaches are not practical in humans occupationally or environmentally exposed to aerosols containing LPS. In fact, in human volunteers, we have found that pretreatment with either inhaled triamcinolone (85), i.v. hydrocortisone (85), or pentoxifylline (86) does not substantially alter the physiologic or biologic response to inhaled grain dust. Because the concentration of endotoxin in the domestic environment adversely affects asthmatics (26), with higher concentrations of ambient endotoxin associated with greater degrees of airflow obstruction (27), endotoxin may play an important role in the airway disease caused by agents other than organic dusts. In fact, among subjects sensitized to the house dust mite, the concentration of endotoxin rather than house dust in the domestic environment is associated with the severity of asthma (27). Thus, controlling the inflammatory response to inhaled endotoxin may provide a novel approach for the treatment of airway disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. David A. Schwartz, Pulmonary, Critical Care, and Occupational Medicine Division, Department of Internal Medicine, University of Iowa, Iowa City, IA 52242. E-mail address: ![]()
3 Abbreviations used in this paper: bDNA, bacterial DNA; PMN, polymorphonuclear leukocyte; pfw, pyrogen-free water; KO, knockout; MIP, macrophage inflammatory protein. ![]()
Received for publication December 14, 1998. Accepted for publication April 22, 1999.
| References |
|---|
|
|
|---|
. Proc. Natl. Acad. Sci. USA 93:2879.
production by NK cells and increases sensitivity to endotoxin. J. Immunol. 156:4570.[Abstract]
/ß and -
with deoxyribonucleic acid from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 79:866.[Medline]
production by stimulation of interleukin-12 and tumor necrosis factor-
. Cell. Immunol. 167:72.[Medline]
, and tumor necrosis factor
are the key cytokines of the generalized Shwartzman reaction. J. Exp. Med. 180:907.
production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
receptor deficient mice are resistant to endotoxic shock. J. Exp. Med. 179:1437.
production by suppressing natural killer cell stimulatory factor/IL-12 synthesis in accessory cells. J. Exp. Med. 178:1041.
production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.
and IFN-
in IL-12-induced Th1 development. J. Immunol. 156:1442.[Abstract]
in the management of infectious disease. Ann. Intern. Med. 123:216.
and recombinant tumor necrosis factor
synergize in vivo to induce early endotoxin tolerance and associated hematopoietic changes. Infect. Immun. 56:2650.
protection against the lethality of endotoxin and experimental sepsis in mice. J. Surg. Res. 50:421.[Medline]
protects rats against the lethality, hypotension, and hypothermia of Gram-negative sepsis. J. Clin. Invest. 88:34.
B with predominance of p50 homodimers. J. Biol. Chem. 269:17001.
, IL-12, and granulocyte-macrophage colony-stimulating factor. J. Immunol. 158:2911.[Abstract]
This article has been cited by other articles:
![]() |
F Obermeier, U G Strauch, N Dunger, N Grunwald, H C Rath, H Herfarth, J Scholmerich, and W Falk In vivo CpG DNA/toll-like receptor 9 interaction induces regulatory properties in CD4+CD62L+ T cells which prevent intestinal inflammation in the SCID transfer model of colitis Gut, October 1, 2005; 54(10): 1428 - 1436. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Deng, T. A. Moore, M. W. Newstead, X. Zeng, A. M. Krieg, and T. J. Standiford CpG Oligodeoxynucleotides Stimulate Protective Innate Immunity against Pulmonary Klebsiella Infection J. Immunol., October 15, 2004; 173(8): 5148 - 5155. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Ropert, M. Closel, A. C. L. Chaves, and R. T. Gazzinelli Inhibition of a p38/Stress-Activated Protein Kinase-2-Dependent Phosphatase Restores Function of IL-1 Receptor-Associated Kinase-1 and R |