| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Department of Microbiology and Immunology, Virginia Commonwealth University, Richmond, VA 23298
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RII), has
been hypothesized to have a role in IgE regulation. A new CD23
transgenic mouse was generated using the MHC class I promoter and IgH
enhancer to further test the hypothesis that CD23 plays a role in the
down-regulation of IgE. Study of three founder lines by FACS showed
overexpression to varying extents on both B and T lymphocytes. No
alterations in lymphocyte populations was observed. All three founder
lines exhibited strong suppression of IgE in response to DNP-keyhole
limpet hemocyanin/alum and Nippostrongylus brasiliensis
infection compared with that in parental or littermate controls. The
founder line exhibiting the highest level of suppression also was less
susceptible to Ag-induced systemic anaphylactic shock. Overall, the
data support the concept that enhancing CD23 levels can be used to
suppress IgE-mediated disease. The mechanism involves decreased IgE
synthesis, because the serum half-life of IgE was not altered in
transgenics, and enzyme-linked immunospot analysis demonstrated lower
IgE-producing cells stimulated by injection of anti-IgD.
Transgenics also exhibited significantly decreased IgG1 responses and
exhibited lower levels of all Ig isotypes, although this was more
variable in different founder lines. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
RII, was first observed by Lawrence et
al. (1) in 1973. CD23 was initially described as a B cell
activation marker (2), and cloning analysis later revealed
that CD23 and FcRII are the same protein (3). CD23 is
unique among Fc receptors because it is not a member of the Ig
superfamily. It is a member of the C-type lectin family, thereby
requiring calcium for binding to IgE (4, 5). Two isoforms
of CD23 are expressed (6), termed CD23a and CD23b. CD23b
is expressed on a variety of hemopoietic cells in the human, including
B lymphocytes (1, 7), follicular dendritic cells
(FDC),3 T lymphocytes
(8) eosinophils, platelets, macrophages, and NK cells
(9). CD23a expression is limited to B cells and possibly
FDCs (6), and since mice express primarily the CD23a
isoform, expression is correspondingly limited (10, 11). Membrane CD23 interacts with at least two additional ligands, in addition to IgE. These are CD21 (12) and CD11b/CD18 and CD11c/CD18 (13). Thus, not surprisingly, membrane CD23 has several roles, such as IgE binding, regulation of IgE synthesis, Ag processing (14), and B cell differentiation (2). Gene knockout and transgenic technology has been used to determine the function of CD23. The phenotype of CD23 knockout animals with respect to that of wild-type animals is somewhat controversial, Yu et al. (15) indicated that these animals have an enhanced IgE response to Ag/alum injections, whereas two other groups (16, 17) were unable to support these findings. Texido et al. (39) produced a transgenic strain in which CD23 transgenic expression was controlled by the Thy1 promoter, and these animals demonstrated some suppression of IgE production. In this study we report the characterization of a new transgenic model in which CD23 was overexpressed on both B and T lymphocytes by using the murine MHC class I promoter, H-2Kb, in conjunction with an IgH enhancer. Expression of the transgene was not seen on nonlymphoid tissue, such as heart and liver. The serum IgE half-life was similar in control and transgenic animals. These new transgenics were tested in vitro and in vivo for regulation of IgE as well as other isotypes in a variety of model systems. Transgenic animals consistently exhibited strongly suppressed IgE synthesis in Ag/alum immunization, Nippostrongylus brasiliensis (Nb) infections, and anti-IgD injection models. Sensitized animals also exhibited reduced sensitivity to systemic anaphylactic shock. Suppression of other Ig isotypes, especially IgG1, was also seen, although this effect was variable in different founder lines.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Mouse IgE from anti-DNP--26 (18) and
monoclonal anti-CD23 (B3B4 (19) or 2G8
(20)) were purified from appropriate ascites. B3B4 and 2G8
are both rat anti-mouse CD23 Abs that interact at a site similar to
but not identical with the site on CD23 that binds IgE. The
anti-leucine zipper M15, mouse IgG1, was a gift from Immunex
(Seattle, WA) (21). B1E3 and R1E4 are both monoclonal rat
anti-mouse IgE Abs that were purified from rat ascites as
previously described (22). Rabbit B is a polyclonal
anti-CD23 Ab purified from rabbit serum as previously described
(20). Rabbit B was produced by injecting a rabbit with an
engineered construct consisting of the extracellular region of CD23
(23) (EC-CD23) and was absorbed with mouse IgG before use.
PE-anti-CD23 and FITC-anti-CD23 were obtained from PharMingen
(San Diego, CA) for FACS analysis. FITC-anti-B220 (6B2)
(24), anti-Thy1 (30H12) (25),
anti-CD4 (GK1.5) (26), and 2.4G2 (27)
were purified from nude mouse ascites and coupled to FITC using
standard procedures. Coupling ratios (F/P) were always 6 or less. The
anti-IgD mAbs H
a/1 (28) and
FF1–4D5 (28) were gifts from Dr. Fred Finkelman
(University of Cincinnati, Cincinnati, OH). Recombinant CD40L and M15
were obtained from Immunex (Seattle, WA), IL-5 was purchased from R&D
Systems (Minneapolis, MN), and baculovirus supernatant containing rIL-4
was a gift from Dr. William Paul (National Institutes of Health,
Bethesda, MD). KLH and BSA (both from Sigma, St. Louis, MO) were
coupled to DNP as described previously (29). Coupling
ratios for DNP/protein were determined as previously described
(29), and preparations had a minimum ratio of 10.
Transgenic preparation
The pHSE3' vector was a gift from Steve Desiderio (Johns Hopkins University, Baltimore, MD). The preparation of this vector has been described previously (30); briefly, the vector is a pUC18 base with a H-2Kb MHC class I promoter, a ß-globin poly(A) signal for termination of the transcript, and an IgH enhancer to help limit expression of the transgene to lymphocytes. Support for this limited expression is seen in the use of this system for TCR (30) and blk (31) transgenics. CD23 cDNA was blunt ended and cloned downstream of the H-2Kb promoter and upstream of the ß-globin splice site using the blunted SalI site; restriction analysis was used to determine correct orientation. An XhoI digest was used to remove pUC18 sequences before microinjection into embryos. After gel isolation, the transgene construct was purified using a positively charged minicolumn (Qiagen, Valencia, CA), precipitated, and sent to the Transgenic Mouse Core Facility at the University of Pennsylvania, where it was microinjected into the male pronucleus of a (BALB/c x C57BL/6)F1 embryo. Tail DNA from progeny was analyzed by PCR; primer sequences were (sense) TACTCAGGATACTGGG and GCATGCAGTTCCCTT. If the transgene was present, a 1-kb piece was observed by gel electrophoresis. Due to the large intron size, the native CD23 was not amplified with these primers. Eight transgenic founder mice were initially identified and bred for further analysis. New pups were tagged for identification, with ear punches. The ear punches were saved, and DNA was extracted using a proteinase K protocol (32). DNA was stored at 4°C until use in PCR reactions. To ensure that the gel bands seen in the first PCR reaction were the transgene, a second set of primers were designed involving the MHC class I H-2Kb promoter and the CD23 cDNA. The sense primer (AGCCGAGAGTCCTGAGCTTT) annealed to the H-2Kb promoter, whereas the second primer (TCTTAGTCGCCAGGCAGTGA) annealed to the CD23 cDNA, respectively. A 1-kb fragment was observed by gel electrophoresis if the transgene was present. Mice testing positive by PCR with either or both sets of primers or one set plus sCD23 ELISA (see below) were used in the experiments.
At 6–8 wk of age, positive progeny were sacrificed, and spleen cells were analyzed on a FACScan (Becton Dickinson) after double staining with FITC-6B2 or FITC-30H12 in combination with PE-B3B4 (each used at 10 µg/ml) for 30 min to 1 h on ice in the dark. Nonspecific binding was blocked using 10 µg/ml 2.4G2. Three founder lines were chosen for additional study based on the enhanced CD23 expression observed. The founder mice and their progeny were bred back to BALB/c mice to test responses of the transgene on a background of potential high IgE responses in BALB/c mice.
Animals and cell isolation
BALB/c and C57BL/6 mice were purchased from the National Cancer Institute (Frederick, MD) or The Jackson Laboratory (Bar Harbor, ME). All mice used in experiments were between 6–14 wk of age. Transgenic mice were maintained under pathogen-free conditions at Medical College of Virginia-Virginia Commonwealth University. B cells are isolated from disrupted spleens using a Percoll gradient as previously described (33, 34). Resting B cells were collected from the 66–70% interface, and activated B cells were collected from the 60–66% interface of a discontinuous Percoll gradient. Resting B cells (1 x 106 cells/ml) were activated in vitro in a 24-well plate (Costar, Cambridge, MA) for 48 h with 50,000 U/ml IL-4, 5 ng/ml IL-5, 0.1 µg/ml CD40LT, and 0.1 µg/ml M15 at 37°C in a 5% CO2 incubator. These activation conditions have previously been shown to be optimal (35). At the indicated times, cells were analyzed by FACS for surface markers.
Ag immunization and Nb infection
Methoxyflurane-anesthetized mice were immunized s.c. on day 0 and were challenged on day 14 with 100 µg of DNP-KLH in alum with heat-killed Bordetella pertussis (Sigma) as described previously (35). Mice were bled intracardially in the single time point analysis and by tail vein for the kinetic analysis. Nb infections were established by injecting 800 worms/200 µl of PBS s.c. on day 0 and were boosted (same dose) on day 20. Nb larvae were a gift from Dr. Thomas Huff (Medical College of Virginia-Virginia Commonwealth University) and were maintained as previously described (36). Mice were bled as described for the Ag/alum immunizations, and serum was tested by ELISA.
ELISAs
The concentration of serum-soluble CD23 was determined by an ELISA assay previously described (23). Briefly, the coating Ab was 2G8, and the detection Ab was rabbit polyclonal anti-CD23 (rabbit B) followed by goat anti-rabbit HRP (Southern Biotechnology Associates, Birmingham, AL). The standard curve used the Escherichia coli-expressed EC-CD23 (23) prepared in-house. The values shown represent duplicate samples determined at multiple dilutions.
Levels of IgE, IgG1, IgM, IgG2a, IgG2b, and IgG3 were determined by ELISA as previously described (35). Supernatants from B cells activated in vitro or serum from mice were analyzed for IgE as previously reported (20). Briefly, a pair of rat anti-mouse IgE monoclonals, B1E3 and R1E4, were used as the capture and biotinylated secondary Ab, respectively. Total IgG1, IgG2a, IgG2b, IgG3, and IgM were all determined using an unlabeled primary goat anti-mouse Ab at 5 µg/ml and were detected using goat anti-mouse class-specific Ab coupled to alkaline phosphatase (all Abs are from Southern Biotechnology Associates). To detect Ag-specific IgG1 and anti-DNP IgE in serum from immunized mice, the ELISA plates were coated with 5 µg/ml KLH-DNP in ELISA BBS, and the rest of the ELISA protocol was completed in the same manner as that used for total IgG1.
Anti-IgD immunization and ELISPOT
Anti-IgD Abs, 100 µg of each H-a/1
and FF1–4D5 (both gifts from Dr. Fred Finkelman), and 200 µg of
2.4G2 were injected i.v. Eight days later, the mice were bled from the
tail vein to test serum for IgE by ELISA. On day 9 spleens were
removed, and activated B cells were isolated and used in an ELISPOT
analysis using a modification of published protocols (37).
ELISPOT Immulon 4 (Dynex, Chantilly, VA) plates were coated with 50
µg/ml B1E3 in 50 µl/well overnight at 4°C. A blocking solution of
PBS with 5% FBS was added to the plate in a volume of 200 µl/well
and incubated overnight at 4°C. The blocking solution was discarded,
and 150 µl/well medium was added for incubation for 10 min at room
temperature. Splenic cells from anti-IgD-injected mice were added
as follows: 10,000 cells were placed in the first well in complete B
cell medium and diluted 1/2 across the plate in 150 µl of medium from
wells 1–10. Wells 11 and 12 were used as medium alone blanks for the
assay for each mouse tested. Each mouse was run in duplicate. The cells
were incubated for 5 h at 37°C in a 5%
CO2 incubator, then were discarded, and the
plates were washed five times in ELISPOT wash solution (PBS with 0.25%
Tween-20). The last three washes were for 5 min each, between which the
wash solution was discarded. A 1/250 dilution of biotinylated R1E4 was
added to the wells in blocking solution in 50 µl/well and incubated
overnight at 4°C. Plates were washed five times as described above,
and Streptavidin-AP (Southern Biotechnology) was added at 50 µl/well
for 2 h at room temperature. ELISPOT substrate was added to the
plates at 50 µl well, and the plates were not moved until the agarose
hardened. Spots were counted 24 h later using an inverted
microscope. ELISPOT substrate consists of 1.25 ml of 3% low melting
point agarose (Fisher Biotech, Philadelphia, PA) in water; with 5 ml of
15 mg 5-bromo-4-chloro-3-indolyl phosphate (Sigma) in AMP buffer (15 mg
MgCl2-6H20, 10 µl of
Triton X-405, 25 mg of NaN3, and 9.6 ml of
2-amino-2-methyl-1-propanol, pH 10.25). The number of IgE-secreting
cells was quantified by counting the number of blue spots per well and
multiplying by the dilution factor, and was expressed as the number of
AFC per million B cells.
Seurm IgE half-life
The half-life of IgE was determined by injecting control and transgenic mice with an anti-DNP IgE mAb (18). Mice were injected intracardially with 1.5 mg of anti-DNP IgE, and each mouse was bled from the tail vein at 2, 4, 7, 12, and 15 h. Serum was assayed by ELISA for anti-DNP IgE at each time point as described for the ELISA.
Systemic anaphylactic shock
Using the Dombrowicz et al. protocol (38), control and transgenic mice were sensitized with 300 ng of Bordetella pertussis toxin (Sigma) in the tail vein and immunized i.p. with 405 µg of DNP-KLH in alum 48 h later. Mice were bled on day 20 to test serum for IgE by ELISA. One milligram of DNP-BSA in PBS with 2% Evans Blue dye (J. T. Baker Chemical, Philipsburg, N.J) was administered i.v. on day 21. The rectal temperature of the mice was followed for 70 min postinjection using an instrument panel analogic probe connected to a thermometer (both from Yellow Springs Instruments, Yellow Springs, OH); readings were taken every 10 min. Temperature and leakage of the dye into tissue were used to determine whether mice were susceptible to systemic anaphylactic shock.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
The previously reported Thy1.1 promoter-driven CD23 transgenic
exhibited increased CD23 expression on resting T cells, but
overexpression of CD23 on B cells was demonstrated only after
backcrossing the transgenic animals to CD23-/-
animals (39). The new CD23 transgenics analyzed here used
the murine class I promoter/IgH enhancer so that CD23 would be
overexpressed on both resting B and T lymphocytes. An initial eight
founder lines were obtained, and FACS analysis of splenic cells of
progeny indicated that five of these founders exhibited overexpression
of CD23. Data are presented from the three highest expressing founder
lines (M1, M11, and M21) in this study. The highest level of CD23
expression was observed in the M21 line, and a representative example
of CD23 overexpression is shown in Fig. 1
, where overexpression is demonstrated
on both T and B lymphocytes (Fig. 1, A and B).
The overexpression remained evident on B cells even after activation
with CD40L and IL-4 (Fig. 1, C–F). The use of the class I
promoter suggested that transgene expression would be increased with
IFN-
; however, this did not prove to be the case. Increased CD23
expression due to IFN- either alone or in combination with CD40L
(compare Fig. 1, D and E, and data not shown) was
not observed. CD23 overexpression was also observed in the M1 and M11
lines, although the levels were, in general, less than that with M21
(data not shown). Overexpression was also evident in that transgenic
mice exhibited increased soluble CD23 levels in serum; using a soluble
CD23 ELISA, littermates had a sCD23 serum level of 127 ± 31,
whereas transgenics had 5.4 ± 1 sCD23/ml, respectively. This
characteristic was useful in confirming transgene expression in animals
combined with PCR before use in experiments.
|
Serum half-life of IgE does not differ from controls animals
CD23 overexpression could potentially result in absorption of IgE
by transgenic CD23 to the extent that serum levels of IgE could be
misleading (with respect to actual IgE synthesis) due to this
absorption. Thus, the serum half-life of IgE was determined.
DNP-specific monoclonal IgE (18) was injected into
transgenic and littermate control animals, and serum levels of
anti-DNP-IgE were determined by ELISA at different times. Analysis
revealed that the half-life of IgE is 7.6 h in the transgenics and
9.7 h in the controls (Fig. 2). Both
values were within the previously described 5- to 10-h half-life of
serum IgE in mice (40).
|
Mice were immunized and boosted with DNP-KLH in alum plus
heat-killed B. pertussis. Single time point analysis 9 days
postbooster of serum by ELISA showed significant suppression of IgE and
Ag-specific IgG1 in the transgenic animals compared with that in BALB/c
parental controls or Thy1 promoter-driven CD23 transgenic animals (Fig. 3). The kinetics of the response were
also examined using the same immunization protocol and bleeding
the mice on the days indicated. Total IgE and DNP-KLH specific
IgG1 were markedly suppressed over time in the M21 founder line (Fig. 4).
|
|
Nb is a helminth that normally induces high levels of IgE. Mice
were infected with Nb larvae, and ELISA analysis revealed that both the
M11 and M21 lines exhibited suppression of total IgE and IgG1 on day 14
postinfection compared with littermate controls (data not shown). Fig. 5 shows kinetic analysis of Nb-infected
mice from both M11 and M21 founder lines. In the kinetic assays, mice
were also given a secondary infection as indicated, the mice were bled
during the course of the infection, and serum was tested for total IgE
and IgG1 by ELISA. IgE was suppressed kinetically throughout the
infection in both M21 and M11 lines. Note that no significant
differences were observed in IgG1 in the M11 line, in contrast to the
results of the single time point Nb experiment and the results seen
with Ag/alum (Fig. 3
).
|
Two groups of mice were injected with the anti-IgD mAbs
Ha/1 and FF1–4D5 in combination with 2.4G2;
stimulation with anti-IgD is known to give high IgE production
(41). Analysis of serum IgE levels revealed reduced IgE
production (Fig. 6A). In
addition, spleen cells from anti-IgD-injected mice were examined by
the ELISPOT protocol to determine whether the reduction in IgE
correlated with a reduced number of IgE Ab-forming cells. The results
are shown in Fig. 6B and demonstrate that the reduced serum
IgE correlates with a reduction in IgE AFC.
|
To determine whether overexpression of CD23 in these animals
affected the basal levels of isotypes in the animals, serum from
nonimmunized mice was also tested for IgM, IgG2a, IgG2b, IgG3, IgG1,
and IgE by ELISA. A summary of the results is shown in Table I. Overall, while there was a trend
toward a decrease in basal Ig levels in both transgenic lines, the
large variation in normal Ig levels resulted in a large SE and marginal
significance. In addition, in selected immunization situations, other
isotypes were examined. In general, the effects on all isotypes
examined were suppressed, with the M11 values being intermediate
between those in the M21 and BALB/c controls. The greatest suppression
observed was with IgE, IgG1, and IgM. All other Ig levels were
minimally affected, and IgA was not tested. Overall, the results are
consistent with a general suppression of humoral immunity in these CD23
transgenics.
|
To determine whether the reduction in IgE levels was sufficient to
protect the animals from anaphylactic shock, the transgenic line with
the greatest IgE suppression (M21) was first sensitized to OVA and
challenged on day 21 as described in Materials and Methods.
A decrease in anaphylactic symptoms was observed. Namely, extrusion of
the Evans Blue dye into tissues, as noted particularly with ear color,
was greatly reduced in the transgenics (data not shown). Secondly, the
littermate controls became unresponsive to stimuli and/or died as a
result of the anaphylactic shock symptoms (three of four animals). To
better quantitate the findings, the body temperature of the animals was
determined every 10 min, and the values obtained are shown in Fig. 7. The body temperature of the littermate
controls decreased from 
37 to 34°C, while the transgenics
exhibited only a transient decrease in temperature of about 1°C and
showed no decrease in activity levels. Protection from anaphylactic
shock was also seen with the M1 transgenics in a similar manner (data
not shown). This evidence indicates that the reduction of IgE by
overexpression of CD23 in vivo can be sufficient to prevent generalized
anaphylaxis.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Texido et al. (39) developed a transgenic animal model in
(C57BL/6 x CB6)F1 mice in which CD23 was
overexpressed by the Thy1.1 promoter. These mice exhibited about a 50%
suppression of the IgE response in the alum/Ag, anti-IgD, and Nb
models, whereas IgG1 responses were similar to those of littermate
controls. Expression of the transgene was mainly restricted to T
lymphocytes; however, backcrossing onto the
CD23-/- phenotype did demonstrate some
expression on B cells. Overexpression of CD23 using the class I
promoter/Ig enhancer in this new transgenic model resulted in clearly
enhanced expression on both resting and stimulated B lymphocytes as
well as T and non-B, non-T cells. This is directly seen in the
comparison with the Thy1 transgenics shown in Fig. 3. Other transgenics
prepared with this system, namely TCR (30) and
blk (31), also reported primarily lymphocyte
expression. In that regard, sections of heart and liver from
transgenics did not show any evidence of CD23 expression. It certainly
remains possible that other tissues/cells can be induced to express the
transgene, especially in the presence of IFN exposure; this aspect
remains to be investigated.
The dramatic suppression of IgE responses in the various in vivo models
tested lend further support to the concept that CD23 can regulate IgE
levels. The mechanism of this suppression remains to be elucidated.
Obviously, because both membrane and soluble CD23 levels are enhanced
in the transgenic animals, the observed phenotype could be due to
either membrane or soluble CD23 (or both). Because soluble CD23
transgenics had no observable phenotype (39), membrane
CD23 is certainly favored as being responsible for the alterations
observed. The current model of CD23 predicts that three monomers
interact with each other to form a functional trimer on the cell
surface. This model is based on the noted heptad repeat pattern found
in the stalk region of the molecule (5) and chemical
cross-linking studies (43). CD23 is cleaved by an as yet
unidentified metalloprotease (44), and the cleaved
monomeric product interacts with only a single low affinity with IgE
(W. C. Bartlett et al., unpublished observations). Recently, Kelly
et al. (23) found that a soluble CD23 oligomer with high
affinity/avidity for IgE could be produced by attachment of a modified
leucine zipper to the amino terminus of the stalk region of CD23. It
will be interesting to determine whether transgenic animals producing
this soluble oligomer have a phenotype similar to that of the membrane
transgenics; such studies are in progress. The simplest explanation for
the phenotype is that the CD23 overexpression absorbs secreted IgE,
thereby removing it from circulation. Indeed, at least in humans, the
anti-IgE therapy currently being used in clinical trials (reviewed
in Ref. 45) appears to work primarily by removing IgE from
the circulation. The lack of effect on serum IgE
t1/2, combined with the strong reduction in
IgE AFC in mice injected with anti-IgD argues that the mechanism
involves a reduction in IgE production. This laboratory also recently
reported an in vitro model in which IgE production was inhibited by
culture of B cells in the presence of CD23-expressing CHO cells
(20). In both that study and ours, while the most dramatic
inhibition involved IgE levels, some suppression of other Ig classes
was also seen. Suppression of IgG1 was seen in all three transgenic
lines (Fig. 3) in both alum/Ag-treated and Nb-infected mice (Figs. 4 and 5). However, we note that suppression of IgG1 was not evident in
the M11 line in the kinetic analysis of Nb infection (Fig. 5). Although
the reason for this variability is not clear at present, the initial
founder lines were on a (BALB/c x C57BL/6) background, namely a
cross between a high and a low IgE responder. We are currently breeding
the transgene onto both backgrounds so it can be determined whether
variability in suppression is related to the background of the animals.
Although the mice used in these studies had been bred back to BALB/c
animals, the animals were used at generations 3–6; therefore,
significant levels of C57 genes remained present. In any case, it is
noted that the phenotype of the transgenics mimics a milder phenotype
of CD21-/- animals (46) in which
an impaired B cell response to T-dependent Ags was observed. The
inhibition of IgE and IgG1 combined with the lower levels of other Ig
isotypes (Table I) suggests that overexpression of CD23 results in a
general impairment of B cell differentiation/Ig production. We are
currently examining germinal center formation and architecture in these
mice and are especially interested in FDC function. CD23 is known to be
expressed on FDC in mice (11), and high level expression
of CD23 on FDC correlated with lower IgE levels in this study. In view
of the capacity for CD23 and CD21 to interact (12),
expression on FDC could potentially interfere with CD21 signaling on
the B cell. Another possible explanation for the phenotype would be
alterations in cytokine profiles resulting in CD23 transgenics having
an enhanced Th1 response. We are currently investigating whether the
cytokine profiles have been altered using Leishmania major
infections, which require a Th1 response for clearance of the
parasite.
Systemic anaphylaxis is a potentially fatal result of type I allergic
disease. Anti-IgE therapy currently being tested in clinical trials is
successful at removing IgE from the body for 3 mo, presumably
via clearance of immune complexes by the reticuloendothelial
system. Repeat injections are necessary, because IgE synthesis levels
are not affected (reviewed in Ref. 45). It is noted,
however, that anti-IgE treatment does appear to inhibit IgE
synthesis in the mouse model (45, 47). Although successful
at removing IgE, the anti-IgE Abs potentially cause serum sickness
due to the non-human complementarity-determining region of the Ab.
These studies suggest that an alternative therapy would be to develop
protocols to elevate CD23 levels before B cell activation in view of
the reduced IgE levels seen in these transgenics. While a concern is
general inhibition of Ig responses, clearly the most dramatic effects
are on IgE production. Therefore, the use of CD23, a native protein, to
decrease IgE production remains an attractive strategy to control IgE
production, providing that techniques to cause elevation of normal
levels can be found. In this regard, the finding that metalloprotease
inhibitors can increase membrane CD23 levels and result in suppression
of IgE production (48) further supports this concept.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Daniel H. Conrad, Box 980678, MCV Station, Richmond, VA 23298. E-mail address:
3 Abbreviations used in this paper: FDC, follicular dendritic cells; Nb, Nippostrongylus brasiliensis; EC-CD23, extracellular region of CD23; M15, anti-leucine zipper mAb; B3B3 and 2G8, anti-CD23 mAbs; KLH, keyhole limpet hemocyanin; CD40LT, CD40 ligand trimer; ELISPOT, enzyme-linked immunospot; AFC, Ab-forming cells; sCD, soluble CD.
Received for publication January 28, 1999. Accepted for publication April 22, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
R) on lymphocytes. J. Immunol. 138:2576.[Abstract]
RII is calcium-dependent but not inhibited by carbohydrate. J. Immunol. 144:2638.[Abstract]
RII: C-type lectin membrane protein with a split personality?. J. Gordon, ed. Monographs in Allergy 29th ed.28. Karger, Basel.
receptor II (FcRII/CD23): Tissue-specific and IL-4-specific regulation of gene expression. Cell 55:611.[Medline]
R2/CD23: its discovery and possible functions. Monogr. Allergy 29:1.
RII/CD23: The low affinity receptor for IgE. Annu. Rev. Immunol. 8:623.[Medline]
RII). J. Immunol. 148:2340.[Abstract]
receptor II (CD23) function on mouse B cells: Role in IgE dependent antigen focusing. Proc. Natl. Acad. Sci. USA 86:7556.RII and FcRI. Mol. Immunol. 28:1149.[Medline]
RI. J. Immunol. 161:6696.
RI: properties and comparison with CD40L-mediated activation. Int. Immunol. 9:239.RI 
chain results in upregulation of FcRIII-dependent mast cell degranulation and anaphylaxis: evidence of competition between FcRI and FcRIII for limiting amounts of FcR ß and chains. J. Clin. Invest. 99:915.[Medline]
RII/CD23: implications for function. J. Immunol. 150:2372.[Abstract]
RII) release from cell membranes is mediated by a membrane-bound metalloprotease. Biochem. J. 333:573.
RII). Eur. J. Immunol. 27:3228.[Medline]
This article has been cited by other articles:
|
|
 |
|
  G. Pongratz, J. W. McAlees, D. H. Conrad, R. S. Erbe, K. M. Haas, and V. M. Sanders The Level of IgE Produced by a B Cell Is Regulated by Norepinephrine in a p38 MAPK- and CD23-Dependent Manner. J. Immunol., September 1, 2006; 177(5): 2926 - 2938. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. S. Gounni The high-affinity IgE receptor (Fc{epsilon}RI): a critical regulator of airway smooth muscle cells? Am J Physiol Lung Cell Mol Physiol, September 1, 2006; 291(3): L312 - L321. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Sukumar, D. H. Conrad, A. K. Szakal, and J. G. Tew Differential T Cell-Mediated Regulation of CD23 (Fc{epsilon}RII) in B Cells and Follicular Dendritic Cells. J. Immunol., April 15, 2006; 176(8): 4811 - 4817. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Getahun, F. Hjelm, and B. Heyman IgE Enhances Antibody and T Cell Responses In Vivo via CD23+ B Cells J. Immunol., August 1, 2005; 175(3): 1473 - 1482. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Montagnac, A. Molla-Herman, J. Bouchet, L. C. H. Yu, D. H. Conrad, M. H. Perdue, and A. Benmerah Intracellular Trafficking of CD23: Differential Regulation in Humans and Mice by Both Extracellular and Intracellular Exons J. Immunol., May 1, 2005; 174(9): 5562 - 5572. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Kilmon, A. E. Shelburne, Y. Chan-Li, K. L. Holmes, and D. H. Conrad CD23 Trimers Are Preassociated on the Cell Surface Even in the Absence of Its Ligand, IgE J. Immunol., January 15, 2004; 172(2): 1065 - 1073. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Rabah, S. Grant, C. Ma, and D. H. Conrad Bryostatin-1 Specifically Inhibits In Vitro IgE Synthesis J. Immunol., November 1, 2001; 167(9): 4910 - 4918. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Kilmon, R. Ghirlando, M.-P. Strub, R. L. Beavil, H. J. Gould, and D. H. Conrad Regulation of IgE Production Requires Oligomerization of CD23 J. Immunol., September 15, 2001; 167(6): 3139 - 3145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Payet-Jamroz, S. L. T. Helm, J. Wu, M. Kilmon, M. Fakher, A. Basalp, J. G. Tew, A. K. Szakal, N. Noben-Trauth, and D. H. Conrad Suppression of IgE Responses in CD23-Transgenic Animals Is Due to Expression of CD23 on Nonlymphoid Cells J. Immunol., April 15, 2001; 166(8): 4863 - 4869. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Sancho, A. G. Santis, J. L. Alonso-Lebrero, F. Viedma, R. Tejedor, and F. Sanchez-Madrid Functional Analysis of Ligand-Binding and Signal Transduction Domains of CD69 and CD23 C-Type Lectin Leukocyte Receptors J. Immunol., October 1, 2000; 165(7): 3868 - 3875. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
