|
|
||||||||
CUTTING EDGE |


*
Laboratory of Medical Allergology, Allergy Unit, and
Laboratory of Tissue Typing, Department of Clinical Immunology, National University Hospital, Copenhagen, Denmark
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
| Materials and Methods |
|---|
|
|
|---|
Eosinophils were purified from healthy, nonallergic
volunteers as described in detail elsewhere (5). Briefly,
a Percoll gradient (1.082 g/ml; Pharmacia, Uppsala, Sweden) was used to
enrich eosinophils; anti-CD16-coated MACS magnetic
particles (Miltenyi Biotech, Bergisch Gladbach, Germany) were used to
deplete neutrophils. Eosinophil purity was invariably
97% (lymphocytes <0.5%). The whole procedure was conducted at
4°C in a Ca2+-free and
Mg2+-free medium.
Immunocytochemistry assay
The purified eosinophils were spun down on a slide, fixed, and immersed in 1% BSA blocking buffer for 10 min to avoid unspecific binding; next, primary Ab (20 µg/ml of either anti-NF-AT1 (mouse mAb 4G6-G5), anti-NF-AT2 (mouse mAb 7A6), anti-NF-AT3 (goat pAb3 C-20), or anti-NF-AT4 (goat pAb C-20); Santa Cruz Biotechnology, Santa Cruz, CA) was added. Eosinophils were then incubated overnight at 4°C, followed by the addition of secondary Ab, and were visualized by an alkaline phosphatase staining system (Dako, Glostrup, Denmark).
Real time quantitative RT-PCR assay
All real time quantitative RT-PCRs were performed as described elsewhere (6). Briefly, total RNA was reverse transcribed and submitted to real time quantitative PCR in an ABI Prism 7700 Sequence Detector System (Perkin-Elmer, Norwalk, CT). By using a SYBR Green PCR Core Reagents Kit (Perkin-Elmer), fluorescence signals were generated during each PCR cycle via the 5' to 3' endonuclease activity of AmpliTaq Gold to provide real time quantitative PCR information. The following sequences of the specific primers (Amersham Pharmacia Biotech, Little Chalfont, U.K.) were used: NF-AT1 sense, 5'-AGAAACTCGGCTCCAGAATCC-3'; NF-AT1 antisense, 5'-TGGTTGCCCTCATGTTGTTTTT-3'; NF-AT2 sense, 5'-GCCGCAGCACCCCTACCAGT-3'; NF-AT2 antisense, 5'-TTCTTCCTCCCGATGTCCGTCTCT-3'; NF-AT3 sense, 5'-GGTTTCCCGGCCAGTCCAGGTCTA-3'; NF-AT3 antisense, 5'-AAGGGGCGGGGAAGGAAGGAAACT-3'; NF-AT4 sense, 5'-ACCAGCCCGGGAGACTTCAATAGA-3'; NF-AT4 antisense, 5'-AAATACCTGCACAATCAATACTGG-3'.
The target cDNA was adjusted to amounts equal to those of the
housekeeping gene (ß-actin) according to the manufacturers
instructions. PCRs were optimized under the following conditions:
15 s at 95°C and 60 s at 60°C with 40 cycles for each
amplification. To express the results, two terms were used:
Rn, representing the normalized reporter
signal minus the baseline signal established in the first few cycles
PCR, and CT (threshold cycle), representing the
PCR cycle at which an increase in reporter fluorescence signal above a
baseline can first be detected.
Electrophoretic mobility shift assay (EMSA)
Nuclear extracts were prepared as described by McCaffrey et al.
and Aramburu et al. (7, 8). Briefly, 400 µl of ice-cold
Dignam buffer A and then 25 µl of 10% Nonidet P-40 were added into
the cells. The cells were vortexed and centrifuged (9000 rpm, 30
s, 4°C). Pelleted nuclei were lysed in 50 µl of Dignam buffer C and
centrifuged (12,000 rpm, 10 min, 4°C); the resulting supernatants
were diluted (1/1) with Dignam buffer D. Double-stranded synthetic
oligonucleotide DNA probes were end-labeled with
[
-32P]ATP (5000 Ci/mmol) and T4
polynucleotide kinase (Amersham Pharmacia Biotech Inc.). The sequences
of the oligonucleotide probes used (5' to 3', one strand) were as
follows (9, 10): human IL-2 distal NF-AT site (NF-AT
huIL-2), GGAGGAAAAACTGTTTCATACAGAAGG (binding sequences are
underlined); consensus AP-1 site, CGCTTGATGACTCAGCCGGAA. EMSA
reactions were performed at room temperature in a final volume of 25
µl. Nuclear extracts (3 µg of protein per reaction volume) were
incubated for 15 min in binding buffer (8), followed by
the addition of 0.5 ng 32P-labeled probes to
react for 15 min; next, the samples were electrophoresed on
nondenatured 5% polyacrylamide gels in 0.25 Tris-borate-EDTA (TBE)
buffer. In some experiments, cold probes used as competitors were added
at the beginning of the reaction to identical aliquots of the extracts
(100-fold higher than labeled probes). The mAbs used for supershift
(all at 10 µg/ml) were incubated with the nuclear extracts on ice for
30 min.
| Results and Discussion |
|---|
|
|
|---|
By immunocytochemistry assay, we have observed that NF-AT1 (Fig. 1
A) and NF-AT4 (Fig. 1
D) are cytoplasmically expressed in resting
eosinophils. NF-AT2 (Fig. 1
B) and NF-AT3 (Fig. 1
C) have not been detected. Fig. 1
, E and
F, are the mouse and goat isotype Ab negative control,
respectively. We have also observed a tendency for NF-AT1 and NF-AT4 to
be expressed in the nuclei in IL-4- and IL-5-activated
eosinophils. NF-ATs have also been detected in peripheral T
lymphocytes (data not shown).
|
NF-AT1 and NF-AT4 mRNA have been detected in resting
eosinophils; NF-AT2 and NF-AT3 mRNA have not (Fig. 2
A). There are
1.9 x
103 copies for NF-AT1 and
6.7 x
102 copies for NF-AT4 in the resting
eosinophils, whereas no copies coding NF-AT2 and NF-AT3
have been found within 40 cycles. NF-AT1 mRNA have been significantly
up-regulated in IL-4- and IL-5-stimulated (all at 10 ng/ml)
eosinophils (Fig. 2
B). There are
6.4 x
103 copies and
5 x
103 copies for NF-AT1, respectively. NF-AT4 mRNA
have also been significantly up-regulated in the IL-4- and
IL-5-stimulated eosinophils (Fig. 2
C). There are
3.0 x 103 copies and
4.4 x
103 copies for NF-AT4, respectively. A linear
relationship between CT and log starting quantity
of the standard DNA template or target cDNA (NF-AT1 and NF-AT4) has
been detected (Fig. 2
D). We have also observed that NF-AT1,
NF-AT2, NF-AT3, and NF-AT4 have been expressed in purified T
lymphocytes, and their expression can be up-regulated by IL-4 and IL-5,
respectively (data not shown).
|
There is no detectable NF-AT in the nuclei of resting
eosinophils. NF-AT huIL-2 binding proteins have been
detected in the nuclei of IL-4- or IL-5-stimulated (1 h)
eosinophils, which indicates that IL-4 and IL-5 can induce
NF-AT activation, resulting a translocation of NF-AT in
eosinophils (Fig. 3
A). Ionomycin (Ion) (0.1
µg/ml) also activates NF-AT to nuclear translocation. Cyclosporin A
(0.1 µg/ml) is a potent inhibitor of activation of NF-AT (Fig. 3
A). NF-AT complexes in IL-4-, IL-5-, or Ion-stimulated
eosinophils have been completely and specifically competed
by a 100-fold molar excess of the cold NF-AT huIL-2 probe, whereas no
competition is induced by the cold AP-1 site probe. A 100-fold molar
excess of the cold AP-1 site probe can completely and specifically
compete the 32P-labeled AP-1 probe (Fig. 3
B). It is not clear why the cold AP-1 site probe does not
compete the NF-AT huIL-2 probe in our experiments, because the binding
complex probably contains both NF-AT and AP-1 (8, 9).
NF-AT translocation into the nuclei of IL-4- and IL-5-stimulated
eosinophils has been detected within 15 min and lasts for
120 min (Fig. 4
A). In the
current study, AP-1 was seen in freshly isolated
eosinophils; increased activity of AP-1 in nuclei of
eosinophils after stimulation with IL-4 or IL-5 was
observed for 120 min (Fig. 4
B). NF-AT1 complex was
supershifted by the mouse anti-NF-AT1 mAb (Fig. 4
C).
Neither isotype mouse IgG nor mouse anti-NF-AT2 mAb can affect the
relative mobility of the NF-AT complex. These results confirm the
presence of NF-AT1, but not NF-AT2, in the nuclei of IL-4- or
IL-5-activated eosinophils. Likewise, the presence of
NF-AT4, but not NF-AT3, in the nuclei of IL-4- or IL-5-activated
eosinophils has also been confirmed (data not shown). The
mechanism by which IL-4 and IL-5 induce the appearance of NF-ATs in the
nuclei of eosinophils is unknown, because the cytokines are
not known to induce a Ca2+ influx, which is
thought to be necessary for nuclear translocation of NF-AT. It will be
of interest to further investigate this mechanism. In Fig. 4
C, it appears that the entire band is supershifted with
anti-NF-AT1. This finding seems to be in contrast to the
conclusions for NF-AT4. The reason for this phenomenon may be that the
NF-AT4 content in eosinophils is so small that the NF-AT1
band overlaps the NF-AT4 band.
|
|
Kiani et al. demonstrated that NF-AT1 is also involved in
down-regulating the late phase of IL-4 gene transcription-inhibiting
Th2 responses. This is evidence that NF-AT proteins regulate not only
the initiation but also the termination of gene transcription
(14). Our results are in support of this observation in
light of the biological functions of eosinophils and Th2
lymphocytes. Based on our results, we might propose that NF-AT could be
deficient or genetically inactivated in certain circumstances such as
allergic conditions. A challenge such as allergen stimulation initiates
a cascade of events of allergic inflammation, including overproduction
of IL-4 and IL-5, activation of eosinophils, and
eosinophilia. An over-release of IL-4 and IL-5 could
subsequently activate NF-AT in eosinophils. The cascade of
biological events in eosinophils after NF-AT activation
would result in later feedback "talking" to Th2 lymphocytes to
induce secondary activation of NF-AT in the Th2 lymphocytes (may also
be other types of immune cells). This later feedback talking could lead
to the termination of allergic disorders. A schematic view for this
proposal is illustrated in Fig. 5
. It
will be quite interesting to investigate the exact mechanism of the
secondary activation of NF-AT in Th2 lymphocytes during the later
feedback talking on the pathway in the cytokine network between
eosinophils and Th2 lymphocytes, especially in cells from
allergic subjects.
|
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Drs. Tan Jinquan or Lars K. Poulsen, Laboratory of Medical Allergology, Finsen Center 7542, National University Hospital, Tagensvej 20, DK-2200 Copenhagen N, Denmark. E-mail address: ![]()
3 Abbreviations used in this paper: pAb, polyclonal Ab; EMSA, electrophoretic mobility shift assay; Ion, ionomycin; NF-AT huIL-2, distal NF-AT site of the human IL-2 promoter; CT, threshold cycle. ![]()
Received for publication February 1, 1999. Accepted for publication April 30, 1999.
| References |
|---|
|
|
|---|
B site and to the conserved lymphokine promoter sequence "cytokine-1.". J. Biol. Chem. 267:1864.This article has been cited by other articles:
![]() |
A. Vega, P. Chacon, J. Monteseirin, R. El Bekay, G. Alba, J. Martin-Nieto, and F. Sobrino Expression of the transcription factor NFAT2 in human neutrophils: IgE-dependent, Ca2+- and calcineurin-mediated NFAT2 activation J. Cell Sci., July 15, 2007; 120(14): 2328 - 2337. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sen, B. Yongyi, H. Yuling, X. Luokun, H. Li, X. Jie, D. Tao, Z. Gang, L. Junyan, H. Chunsong, et al. V{alpha}24-Invariant NKT Cells from Patients with Allergic Asthma Express CCR9 at High Frequency and Induce Th2 Bias of CD3+ T Cells upon CD226 Engagement J. Immunol., October 15, 2005; 175(8): 4914 - 4926. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kiani, I. Habermann, M. Haase, S. Feldmann, S. Boxberger, M. A. Sanchez-Fernandez, C. Thiede, M. Bornhauser, and G. Ehninger Expression and regulation of NFAT (nuclear factors of activated T cells) in human CD34+ cells: down-regulation upon myeloid differentiation J. Leukoc. Biol., November 1, 2004; 76(5): 1057 - 1065. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Jullien, R. Q. Cron, K. Dabbagh, A. Cleary, L. Chen, P. Tran, P. Stepick-Biek, and D. B. Lewis Decreased CD154 expression by neonatal CD4+ T cells is due to limitations in both proximal and distal events of T cell activation Int. Immunol., December 1, 2003; 15(12): 1461 - 1472. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Qiuping, L. Qun, H. Chunsong, Z. Xiaolian, H. Baojun, Y. Mingzhen, L. Chengming, H. Jinshen, G. Qingping, Z. Kejian, et al. Selectively Increased Expression and Functions of Chemokine Receptor CCR9 on CD4+ T Cells from Patients with T-Cell Lineage Acute Lymphocytic Leukemia Cancer Res., October 1, 2003; 63(19): 6469 - 6477. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Jiankuo, W. Xingbing, H. Baojun, W. Xiongwin, L. Zhuoya, X. Ping, X. Yong, L. Anting, H. Chunsong, G. Feili, et al. Peptide Nucleic Acid Antisense Prolongs Skin Allograft Survival by Means of Blockade of CXCR3 Expression Directing T Cells into Graft J. Immunol., February 1, 2003; 170(3): 1556 - 1565. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Schubert, R. Q. Cron, A. M. Cleary, M. Brunner, A. Song, L.-S. Lu, P. Jullien, A. M. Krensky, and D. B. Lewis A T Cell-specific Enhancer of the Human CD40 Ligand Gene J. Biol. Chem., February 22, 2002; 277(9): 7386 - 7395. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jinquan, S. Quan, H. H. Jacobi, C. Jing, A. Millner, B. Jensen, H. O. Madsen, L. P. Ryder, A. Svejgaard, H.-J. Malling, et al. CXC chemokine receptor 3 expression on CD34+ hematopoietic progenitors from human cord blood induced by granulocyte-macrophage colony-stimulating factor: chemotaxis and adhesion induced by its ligands, interferon gamma -inducible protein 10 and monokine induced by interferon gamma Blood, August 15, 2000; 96(4): 1230 - 1238. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Jinquan, C. Jing, H. H. Jacobi, C. M. Reimert, A. Millner, S. Quan, J. B. Hansen, S. Dissing, H.-J. Malling, P. S. Skov, et al. CXCR3 Expression and Activation of Eosinophils: Role of IFN-{gamma}-Inducible Protein-10 and Monokine Induced by IFN-{gamma} J. Immunol., August 1, 2000; 165(3): 1548 - 1556. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Ochi, N. H. De Jesus, F. H. Hsieh, K. F. Austen, and J. A. Boyce IL-4 and -5 prime human mast cells for different profiles of IgE-dependent cytokine production PNAS, September 12, 2000; 97(19): 10509 - 10513. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |