The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tapping, R. I.
Right arrow Articles by Tobias, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tapping, R. I.
Right arrow Articles by Tobias, P. S.
The Journal of Immunology, 1999, 162: 5483-5489.
Copyright © 1999 by The American Association of Immunologists

Membrane-Anchored Forms of Lipopolysaccharide (LPS)-Binding Protein Do Not Mediate Cellular Responses to LPS Independently of CD141

Richard I. Tapping, Sally L. Orr, Evangeline M. Lawson, Katrin Soldau and Peter S. Tobias2

Department of Immunology, The Scripps Research Institute, La Jolla, CA 92037


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Inflammatory responses of myeloid cells to LPS are mediated through CD14, a glycosylphosphatidylinositol-anchored receptor that binds LPS. Since CD14 does not traverse the plasma membrane and alternatively anchored forms of CD14 still enable LPS-induced cellular activation, the precise role of CD14 in mediating these responses remains unknown. To address this, we created a transmembrane and a glycosylphosphatidylinositol-anchored form of LPS-binding protein (LBP), a component of serum that binds and transfers LPS to other molecules. Stably transfected Chinese hamster ovary (CHO) fibroblast and U373 astrocytoma cell lines expressing membrane-anchored LBP (mLBP), as well as separate CHO and U373 cell lines expressing membrane CD14 (mCD14), were subsequently generated. Under serum-free conditions, CHO and U373 cells expressing mCD14 responded to as little as 0.1 ng/ml of LPS, as measured by NF-{kappa}B activation as well as ICAM and IL-6 production. Conversely, the vector control and mLBP-expressing cell lines did not respond under serum-free conditions even in the presence of more than 100 ng/ml of LPS. All the cell lines exhibited responses to less than 1 ng/ml of LPS in the presence of the soluble form of CD14, demonstrating that they are still capable of LPS-induced activation. Taken together, these results demonstrate that mLBP, a protein that brings LPS to the cell surface, does not mediate cellular responses to LPS independently of CD14. These findings suggest that CD14 performs a more specific role in mediating responses to LPS than that of simply bringing LPS to the cell surface.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lipopolysaccharide, or endotoxin, a molecule that comprises the outer membrane of Gram-negative bacteria, provides a highly potent stimulus to cells of the immune system. LPS-induced cellular activation is mediated through two host proteins: LPS-binding protein (LBP)3 and the leukocyte receptor CD14 (1, 2). LBP is a 60-kDa serum glycoprotein that interacts with LPS aggregates and delivers LPS to other host proteins, most notably CD14. CD14 is a 55-kDa receptor expressed on the surface of neutrophils and macrophages that appears to function in a variety of important biological processes. In addition to mediating inflammatory responses of cells to LPS, CD14 has been shown to mediate responses to many pathogen-derived ligands, including Gram-positive bacterial peptidoglycan (3), mycobacterial lipoarabinomanan (4), fungal products (5, 6), and spirochetal lipoproteins (7, 8).

Paradoxically, in addition to their roles as proinflammatory effector molecules, LBP and CD14 also act in the cellular clearance of endotoxin from body fluid. In this role, LBP is an opsonin for whole Gram-negative bacteria, and CD14 is a receptor for both bacteria opsonized with LBP (9, 10) and for LBP-LPS aggregates (11). Binding of these particles leads to cellular internalization, followed by degradation and inactivation of LPS (12). Several lines of evidence have shown that this clearance function is separate from those events leading to cellular activation (11, 13, 14, 15). In this regard, CD14 is also one of many receptors involved in the recognition and clearance of apoptotic cells, a process that also does not lead to cellular activation (16).

Most notable of the functions of CD14 is that it is the critical receptor that allows cells of myeloid lineage to respond to low concentrations of LPS (2). In fact, the maturation of the LPS response in monocytic cells has been shown to be dependent on the expression of CD14 on the cell surface (17). In addition, expression of CD14 confers LPS responsiveness to a variety of nonmyeloid cells. This ability was first demonstrated using 70Z/3 cells, a pre-B cell line whose sensitivity to LPS is increased over 1000-fold upon transfection with CD14 (18). Subsequent studies have shown that low ng/ml concentrations of LPS can activate NF-{kappa}B in both CHO and HT1080 fibroblast cell lines only after these cell lines are transfected with CD14 (19, 20). The disaggregation and delivery of LPS to CD14 that are mediated by LBP act to enhance the sensitivity of CD14-expressing cells to LPS.

Since CD14 is a glycosylphosphatidylinositol (GPI)-anchored molecule that does not traverse the cell membrane, the mechanism by which it confers LPS responsiveness to cells has remained a long-standing question in the field. This question is not restricted to CD14 since it remains unknown how other GPI-anchored receptors mediate cellular signaling (21). Clearly, the GPI anchor itself is not required for the ability of CD14 to transduce signals since expression of various transmembrane-anchored forms of this receptor still confer LPS responsiveness to cells (22, 23). Analogous to CD14, the leukocyte integrins CD11/CD18 also bind whole bacteria and LPS (24), and expression of these heterodimeric transmembrane proteins imparts LPS responsiveness to CHO cells (25). As with CD14, it is not known how these integrins trigger cellular activation signals across the cell membrane in response to LPS. This ability is not a function of any cytoplasmic protein sequences since expression of mutant receptors of CD11/CD18 that lack their cytoplasmic tails still elicit LPS-induced activation of NF-{kappa}B in CHO cells (26).

The fact that different LPS-binding receptors lacking traditional intracellular signaling domains still enable cellular responses to LPS has led to the theory that the only role of CD14 is to bring LPS in close proximity to the cell membrane where other events subsequently lead to cellular activation. To address this, and to better understand the mechanism of CD14-mediated activation, we engineered cell lines expressing membrane-anchored forms of the LPS delivery molecule, LBP. Here, we show that, although membrane-anchored LBP (mLBP) binds LPS, it does not confer LPS responsiveness to either CHO or U373 cells even at high ng/ml concentrations of LPS. Conversely, expression of CD14 in CHO or U373 cells confers LPS responsiveness to these cells in the presence of pg/ml concentrations of LPS. These results suggest that CD14 performs a more specific function in mediating LPS-induced activation of cells than that of merely bringing LPS to the cell surface.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of CHO and U373 cell lines

A vector-expressing LBP with a carboxyl-terminal GPI-anchoring sequence was generated by first modifying full-length LBP by PCR. The oligonucleotides 5'-GTAAGCTTGGTACCACTGCACTGGGAATCTAGG-3' and 5'-GCACCAGCTCTAGAAACTCTCATGTATTGGACATTGG-3' were used as primers to the amino terminus and carboxyl terminus of LBP, respectively, in a PCR reaction that amplified LBP from a vector containing a cDNA encoding full-length human LBP (27). The ends of the amplified human LBP DNA were cleaved at the newly introduced HindIII and XbaI sites. The GPI-anchoring sequence of CD55, decay accelerating factor (28), was made synthetically by annealing the complementary oligonucleotides 5'-CTAGAAGTGGAACCACTTCAGGTACCACCCGTCTTCTATCTGGTCACACGTGTTTCACGTTGACAGGTTTGCTTGGGACGCTAGTAACCATGGGCTTGCTGACTTAGGC-3' and 5'-GGCCGCCTAAGTCAGCAAGCCCATGGTTACTAGCGTCCCAAGCAAACCTGTCAACGTGAAACACGTGTGACCAGATAGAAGACGGGTGGTACCTGAAGTGGTTCCACTT-3', which results in an XbaI a NotI overhang. The amplified and cleaved human LBP and the double stranded oligonucleotide encoding the GPI anchor sequence were ligated together via the XbaI overhangs and inserted into the vector pCDNA3.1 (Invitrogen, San Diego, CA) via the HindIII/NotI sites. The resulting pCDNA-LBP vector encodes full-length human LBP with the addition of 35 amino acids SRSGTTSGTTRLLSGHTCFTLTGLLGTLVTMGLLT at the carboxyl terminus, which is the minimal GPI-anchoring sequence of CD55 (29). This construct was confirmed by sequencing at the Core Facility of The Scripps Research Institute.

CHO and U373 cell lines expressing mCD14, mlBP, and vector alone were made by transfecting U373 cells with the vectors pRSV-CD14 (18), pCDNA-LBP, and pCDNA3.1 empty vector, respectively. Transfections were performed by electroporating 2 x 106 cells in 0.5 ml of electroporation buffer (20 mM HEPES, 10% FCS, and 150 mM NaCl (pH 7.4)) at 300 volts and 960 µF for 20 ms in the presence of 5 µgs of the appropriate vector and 20 µgs of salmon sperm DNA as a carrier. The cells recovered overnight in RPMI 1640 medium containing 10% FCS, 1% penicillin/streptomycin/glutamine, and 10 mM HEPES (pH7.4) and subsequently underwent selection in the same medium containing 800 µg/ml gentamicin for 5 wk. Upon recovery, CD14-transfected cells were stained for mCD14 expression using the FITC-labeled anti-CD14 Ab MY-4 (PharMingen, San Diego, CA). Cells transfected with mLBP were stained for mLBP expression using the biotinylated anti-LBP Ab 18G4 followed by staining with streptavidin PE. The top 2% of cells expressing either mCD14 or mLBP were collected by FACS, recovered, and retested for mCD14 and mLBP expression, respectively. All FACS analyses were performed in the Flow Cytometry Core Facility of The Scripps Research Institute.

LPS binding assays

Adherent U373 cells were washed with PBS and removed from flasks using cell dissociation buffer (Life Technologies, Gaithersburg, MD). Cell suspensions were washed with FACS buffer (20 mM HEPES, 150 mM NaCl, 0.2% BSA, 10 mM NaN3 (pH 7.4)), and 1 x 105 cells were resuspended in 0.1 ml of FACS buffer on ice. FITC-labeled Re595 LPS was added to a final concentration of 500 ng/ml. Cell suspensions were shifted to 37°C for 5 min and put back on ice before analysis by flow cytometry. When used, Abs were added to the cell suspension for 30 min on ice at a final concentration of 20 µg/ml before the addition of LPS. Abs against LBP (8F5, 1E8, and 2B5) and CD14 (28C5) were a gift from A. Moriarty and D. Leturcq (R. W. Johnson Pharmaceutical Research Institute, La Jolla, CA).

Whole cell-binding assays were performed as described previously (30). Briefly, 5 x 105 dissociated U373 cells were incubated in 0.1 ml of binding buffer (20 mM HEPES, 150 mM NaCl, 2 mM EDTA, and 0.5% BSA, 10 mM NaN3, 5 mM deoxyglucose, 2 mM NaF (pH 7.4)) containing 800 ng/ml [3H]LPS from Escherichia coli strain K12 (List Biologicals, Campbell, CA) for 5 min at 37°C. The cell suspension was then layered on 200 µl of silicon fluid composed of 80% 550 fluid and 20% 200 fluid (Dow Corning, Midland, MI) and centrifuged for 1 min at 10,000 x g. The tubes were frozen on dry ice, and the cell pellet was clipped into a scintillation vial and resuspended in 200 µl of 1 N sodium hydroxide. Cell-bound counts were determined after adding Ecoscint scintillation fluid to the vial (National Diagnostics, Atlanta, GA). When used, Abs were added to cells on ice for 30 min before the addition of LPS.

Cell activation assays

CHO or U373 cells were trypsinized, transferred into either six-well (105 cells per well) or 96-well plates (104 cells per well) and allowed to recover overnight in complete medium. The adherent cells were washed 4 times using serum-free RPMI 1640 medium, left overnight in the same medium, and rewashed four times using serum-free medium immediately before activation to ensure removal of serum components, including sCD14. The cells were subsequently treated with serum-free RPMI 1640 medium containing 1 mg/ml of low endotoxin BSA and various concentrations of Re595 LPS for either 1 h, when measuring NF-{kappa}B, or 6 h, when measuring IL-6 or ICAM. Abs were preincubated with cells for 20 min before the addition of Re595 LPS. Recombinant human sCD14 was purified from insect cells infected with a recombinant baculovirus as described (30) and was added with the LPS as indicated.

After a 6-h incubation with LPS, U373 cell supernatants were collected and assayed for IL-6 production. The IL-6 ELISA was performed using 96-well Immulon plates (Dynatech Laboratories, Chantilly, VA), which were coated using 2 µg/ml goat anti-human IL-6 polyclonal Ab (R&D Systems, Minneapolis, MN). The standard curve was generated using recombinant human IL-6 derived from CHO cells (Genzyme, Cambridge, MA). Bound IL-6 was detected using 2 µg/ml rabbit anti-human IL-6 polyclonal Ab (Endogen, Woburn, MA) followed by a 1:1000 dilution of goat anti-rabbit IgG-conjugated HRP (Biosource, Camarillo, CA). Plates were developed using o-phenylenediamine as a substrate, and optical density was determined at a wavelength of 490 nm using a Spectramax plate reader and software (Molecular Devices, Sunnyvale, CA). All values were interpolated from a four-parameter fit of the standard IL-6 curve.

After a 6-h incubation with LPS, cell surface expression of ICAM was determined by removal of the U373 cells with cell dissociation buffer (Life Technologies) and staining the cells in FACs buffer containing PE-conjugated mouse anti-human ICAM (PharMingen) followed by FACS analysis.

NF-{kappa}B activation assay

After a 1-h incubation with LPS, nuclear extracts were prepared by a standard method (31) with modifications as described (32). Briefly, six-well plates of adherent CHO or U373 cells were washed with ice cold PBS. The cells were scraped off of the plates, centrifuged, and resuspended in 0.4 ml of ice cold buffer A (10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM DTT, 0.5 mM PMSF (pH 7.9)). After 10 min on ice, 25 µL of 10% Nonidet P-40 detergent was added. The solution was quickly mixed, and nuclei were immediately pelleted by centrifuging at 14,000 x g for 10 s. The nuclear pellet was resuspended in 50 µl of buffer B (20 mM HEPES (pH 7.9), 0.4 mM NaCl, 1 mM EDTA, 1 mM EGTA, 0.1 mM PMSF), and, after 30 min on ice, nuclear lysates were cleared by centrifuging at 14,000 x g for 30 s. The supernatant containing nuclear proteins was transferred to new vials, and the protein concentration of each extract was determined using bicinchoninic acid reagent (Pierce, Rockford, IL). The activity of NF-{kappa}B in the nuclear extracts was determined by a standard EMSA. Briefly, 3 µgs of nuclear extract was preincubated with 10 µl of binding buffer (5 mM HEPES, 5 mM MgCl2, 50 mM KCl, 0.5 mM DTT, 10% glycerol containing 0.4 mg/ml poly(dI-dC), and 0.1 mg/ml sonicated salmon sperm DNA (pH 7.9)) for 10 min at room temperature. Then 25 fmol (50,000 cpm) of 32P end-labeled double stranded oligonucleotide encoding the consensus NF-{kappa}B site 5'-AGTTGAGGGGACTTTCCCAGGC-3' (Promega, Madison, WI) was added, and the reaction was incubated for another 10 min at room temperature. Samples were analyzed on 5% polyacrylamide gels prepared in 50 mM Tris borate buffer containing 1 mM EDTA. Electrophoresis was performed at 4°C for 2 h at 12 V/cm, after which gels were dried on Whatman paper followed by phosphoimaging (Molecular Dynamics, Sunnyvale, CA) or autoradiography.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell surface expression of CD14, an LPS-binding protein, confers LPS responsiveness to a variety of non-CD14-expressing cell types. Since LBP is another well-characterized LPS binding and transfer protein, we were interested in comparing the effect of LPS on cells expressing a membrane-anchored form of LBP. To this end, we constructed a vector encoding full-length human LBP with the addition, at the carboxyl terminus, of the 35-aa sequence required for the GPI anchoring of CD55 (decay-accelerating factor). This mLBP expression vector, along with an expression vector encoding normal GPI-anchored CD14, was separately transfected into CHO and U373 cells. These fibroblast and epithelial-like astrocytoma cells are not known to endogenously express CD14. Stably transfected CHO and U373 cell lines expressing mCD14, mLBP, or vector alone were generated under gentamicin selection followed by FACS using anti-LBP and anti-CD14 Abs (see Materials and Methods). A typical FACS analysis of these sorted cell lines using mAbs to CD14 and LBP reveals that CD14-transfected and mLBP-transfected cells specifically express cell surface CD14 and LBP, respectively (Fig. 1Go). Expression of either CD14 or mLBP is undetectable in the vector control cells.



View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 1. CHO and U373 cell lines that express mCD14 or mLBP. To determine cell surface expression of mCD14 or mLBP, FACS analysis was performed by staining of cells with biotinylated forms of the anti-CD14 Ab 28C5 (solid line) or the anti-LBP Ab 18G4 (dashed line), followed by staining with streptavidin PE. FACS analysis was performed on CHO or U373 cell lines generated by transfection with vector alone, mCD14, or mLBP, as indicated.

 
The ability of the different cell lines to bind LPS was determined under serum-free conditions. When incubated with 500 ng/ml of FITC-labeled LPS on ice, all the U373 cell lines exhibited the same low level of background fluorescence as determined by FACS (Fig. 2GoA). When the whole cell binding reaction was shifted to 37°C, the vector control and mCD14-U373 cells exhibited a small increase in median fluorescence; however, the fluorescence of the mLBP-U373 cells dramatically increased, indicating that these cells specifically bind FITC-labeled LPS. The apparent binding of FITC-labeled LPS to mLBP-U373 cells was almost completely blocked by preincubation of the cells with the anti-LBP Abs 1E8 and 2B5, but was unaffected by the control Abs IB4 and 8F5, which recognize CD18 and denatured LBP, respectively. Similarly, the binding was inhibited by Fab fragments of the anti-LBP Ab 2B5 but not by Fab fragments of the anti-CD14 Ab 28C5. These results demonstrate that LBP expressed on the surface of cells as a GPI-anchored protein is capable of binding FITC-labeled LPS. To confirm these results, whole cell-binding assays were performed using biosynthetically radiolabeled LPS (Fig. 2GoB). The results obtained with radiolabeled LPS were essentially identical to those obtained with FITC-labeled LPS, confirming that at 37°C membrane-anchored LBP is capable of binding LPS. A time course of the binding of LPS by mLBP revealed that it is rapid, saturating within 2 min (data not shown). Cells expressing mCD14 did not exhibit any significant measurable binding of LPS compared with vector control cells, even after incubating the binding reaction for several hours at 37°C. In this regard, mCD14 has been shown to be a receptor for LBP-LPS complexes (2, 11), and, as expected, addition of soluble LBP caused a dramatic increase in the association of FITC-LPS to the mCD14-expressing cells (Fig. 2GoA).



View larger version (27K):
[in this window]
[in a new window]
 
FIGURE 2. Membrane LBP binds LPS. A, Different U373 cell lines were incubated at 37°C for 5 min in FACS buffer containing 500 ng/ml FITC-labeled LPS. Cells were put back on ice, washed with FACS buffer, and analyzed by flow cytometry. Median channel fluorescence was determined using Becton Dickinson (Mountain View, CA) software. B, Different U373 cell lines were incubated at 37°C for 5 min in binding buffer containing 800 ng/ml of [3H]LPS from E. coli strain K12. Cell-bound counts were determined as described in Materials and Methods. Error bars represent the range of duplicate values. When used, Abs were preincubated with cells for 30 min on ice before addition of LPS.

 
To address whether expression of mLBP enables LPS-induced cellular activation, we compared the responses of the different cell lines following exposure to LPS. To this end, we incubated the cells with various concentrations of LPS under serum-free conditions and measured activation of NF-{kappa}B in nuclear extracts by a standard EMSA. As expected, NF-{kappa}B was activated by as little as 1 ng/ml of LPS in both mCD14-CHO and CD14-U373 cells (Fig. 3Go). This activation was dependent on the expression of CD14 since the vector control cells were not activated even after exposure to as much as 100 ng/ml of LPS. Expression of mLBP did not alter the LPS responses of either the CHO or U373 cells, which, like the vector control cells, remained unresponsive even after exposure to 100 ng/ml of LPS. Since the soluble form of CD14 has been shown to enable epithelial and endothelial cells to respond to LPS (33, 34), we added recombinant soluble CD14 (sCD14) to our assay to ensure that our cell lines are still capable of LPS-induced cellular activation. Addition of sCD14 enabled all the cell lines to respond to LPS (Fig. 3Go). These results demonstrate that, even though the CHO and U373 cells are capable of LPS-induced activation, expression of a membrane-anchored form of LBP on the cell surface does not confer LPS-induced activation of NF-{kappa}B.



View larger version (48K):
[in this window]
[in a new window]
 
FIGURE 3. LPS activates NF-{kappa}B in cells expressing mCD14 but not mLBP. CHO and U373 cell lines were incubated for 1 h under serum-free conditions with various concentrations of Re595 LPS as indicated, and cell extracts were analyzed for NF-{kappa}B activity by EMSA as described in Materials and Methods. Where indicated, 1 µg/ml of sCD14 was added with LPS. The data shown are from a representative experiment that was repeated with similar results.

 
To confirm that the NF-{kappa}B results reflect LPS-induced cellular activation events, we also measured the expression of two markers of inflammation, ICAM and IL-6, in our U373 cells. Under serum-free conditions, mCD14-U373 cells exhibited increased ICAM expression after treatment with as little as 100 pg/ml of Re595 LPS (Fig. 4Go). In contrast, mLBP-U373 cells and vector control cells showed no measurable ICAM response even after treatment with as much as 100 ng/ml LPS. To confirm this finding, we performed similar experiments using IL-6 production as a measure of cell activation. Activation of IL-6 production was measurable after the exposure of mCD14-U373 cells to as little as 100 pg/ml LPS and was maximal using 10 ng/ml LPS (Fig. 5Go). In contrast, mLBP-U373 cells and vector control U373 cells showed no measurable response to LPS even at concentrations as high as 100 ng/ml. These results demonstrate that, under serum-free conditions, expression of CD14 enables U373 cells to respond to low pg/ml concentrations of LPS while expression of LBP on the surface of these cells does not confer LPS responsiveness. In support of this conclusion, U373 cells expressing LBP as a transmembrane-anchored fusion protein, using sequences encoding the transmembrane domain of tissue factor, were also unresponsive to LPS under serum-free conditions (data not shown).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 4. LPS induces activation of ICAM in U373 cells expressing CD14 but not mLBP. U373 cell lines were incubated for 6 h under serum-free conditions with various concentrations of Re595 LPS as indicated and subsequently analyzed for ICAM expression by FACS as described in Materials and Methods. The data shown are from a representative experiment that was repeated with similar results.

 


View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 5. LPS induces activation of IL-6 in U373 cells expressing mCD14 but not mLBP. U373 cell lines were incubated for 6 h with various concentrations of Re595 LPS as indicated and subsequently analyzed for IL-6 production as described in Materials and Methods. Error bars represent the SD of three independent values.

 
To ensure that our U373 cell lines are still capable of LPS-induced inflammatory responses, we added recombinant sCD14 to our activation assay. In the presence of 1 µg/ml of recombinant sCD14, both the vector control and mLBP-U373 cells exhibited responses to LPS even at a concentration as low as 1 ng/ml LPS (Fig. 6Go). These results demonstrate that these cell lines are still capable of LPS-induced activation through sCD14. Therefore, even though these cells are still capable of LPS-induced activation, expression of LBP on the cell membrane does not confer LPS responsiveness to cells under serum-free conditions. A small, but measurable, LPS response by the U373 vector control and mLBP-U373 cell lines was observed under higher LPS concentrations (Fig. 6Go). Interestingly, this activation was consistently higher in the mLBP-U373 cells, compared with the vector control cells (Figs. 5Go and 6Go), even though both cell lines were treated identically. This result could suggest that cell surface expression of LBP mediates a low level of cellular activation in response to LPS. However, this activation was completely blocked by the anti-CD14 Ab 28C5, demonstrating that it is in fact due to a low level of contaminating CD14 in our assay (Fig. 6Go). Thus, it is likely that the higher level of residual activation observed when using the mLBP-U373 cells arises from the cellular expression of functional LBP, which is transferring the LPS to the contaminating CD14 in our assay. In support of this, the residual activation observed is also abrogated by the addition of the anti-LBP Ab 2B5 (Fig. 6Go).



View larger version (17K):
[in this window]
[in a new window]
 
FIGURE 6. mLBP-expressing U373 cells are capable of LPS-induced activation via sCD14. A, Vector control or (B) mLBP-expressing U373 cells were incubated for 6 h with various concentrations of Re595 LPS in the presence or absence of sCD14, anti-CD14 Ab 28C5, or anti-LBP Ab 2B5 as indicated and subsequently analyzed for IL-6 production as described in Materials and Methods. Each data point is the mean of duplicate values.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The basic mechanism by which CD14 mediates cellular activation has been unresolved since the discovery of this GPI-anchored molecule as a receptor for LPS-induced events (2). One theory of how CD14 signals is that it binds LPS and subsequently interacts with an as yet unidentified signal-transducing molecule. It is proposed that the interaction of CD14 and LPS with the signaling molecule would be the first step leading to cellular activation (35, 36). In support of this, monocytes pretreated with trypsin are no longer LPS responsive even though the CD14 on their surface appears intact and still binds LPS (37). The observation that certain analogues of LPS can act as potent LPS antagonists, capable of blocking cellular responses to LPS without inhibiting the apparent association of LPS with CD14, has also been cited as evidence for the existence of a separate signaling receptor (38, 39). The most compelling evidence for an accessory LPS-signaling molecule stems from the initial observation that lipid IVa, a metabolic precursor of LPS lacking two acyl chains, acts as an LPS agonist in humans and as an LPS antagonist in mice (40). Even though both of these actions are facilitated by CD14, the heterologous expression of mouse or human CD14 does not alter the species-specific cellular responses observed (20). These latter studies demonstrated that the target of the species-specific effect of lipid IVa must be a cellular-signaling component other than CD14 (20). Recently, members of a family of genes known as Toll-like receptors (41) were found to mediate cellular responses to LPS (42, 43, 44). As the Toll-like receptors signal activation of innate immune responses (45) and possess cytoplasmic signaling domains homologous to those of the IL-1 receptor, they represent interesting potential cell surface signaling partners for CD14.

Cellular responses of CD14-expressing cells to LPS are augmented by the presence of LBP. LBP is a serum protein that binds LPS and delivers it in a less aggregated state to other proteins, including CD14 (46, 47). Recent studies have shown that LBP and sCD14 are also capable of transferring LPS to phospholipid vesicles (48). This finding has given rise to an alternate theory as to how LBP and CD14 enable cellular responses to LPS. The premise of this theory is that CD14 is an LPS carrier that merely brings LPS to the cellular membrane (48). Once at the membrane, it is proposed that the acyl chains of LPS perturb the plasma membrane, leading to activation of the cell (49). Thus, in this model, LPS and CD14 do not directly interact with a downstream signaling molecule; rather, membrane perturbations indirectly activate downstream signals. It is worth noting, however, that neither LBP or sCD14 have been shown to transfer LPS into the membrane of an intact cell, and, in fact, it has been shown that cell surface-associated LPS appears to be entirely removable by treatment with proteinase K (15).

In short, the mechanism by which CD14 mediates cellular responses to LPS remains largely undefined. To address the hypothesis that mCD14 simply functions as a molecule that brings LPS to the plasma membrane, we generated CHO and U373 cell lines expressing either mCD14 or membrane-anchored forms of LBP. Under serum-free conditions, cells expressing mCD14 responded to as little as 1 ng/ml of LPS as measured by NF-{kappa}B activation. In addition, U373 cells expressing mCD14 exhibited activation of ICAM and IL-6 after exposure to as little as 0.1 ng/ml of LPS. Conversely, the cell lines expressing mLBP, as well as the vector control cell lines, did not respond to LPS under serum-free conditions even at LPS concentrations 1000-fold higher than those required for CD14-mediated LPS activation. Ironically, under these serum-free conditions, we were unable to measure binding of LPS to cells expressing CD14 but observed dramatic binding of LPS to cells expressing mLBP. These results demonstrate that CD14 performs a function leading to cellular activation that LBP cannot. Presently, we do not know what this function is, but we hypothesize that CD14-LPS complexes are recognized by at least one as yet unidentified molecule that initiates transmembrane signaling.

Finally, these results emphasize the idea that bulk binding of LPS cannot be equated to cellular activation since CD14-dependent activation of cells occurs under conditions where LPS binding cannot be measured. That LPS clearance and LPS-induced cellular activation are separate events is supported by at least four independent observations. First, binding of LBP-LPS aggregates to CD14 is completely inhibited by certain anti-LBP Abs that have no effect on cellular activation (11). Second, certain LBP mutants that show a loss of cell stimulatory activity are unaltered in their ability to promote binding of LPS-containing aggregates to monocytes (13). Third, treatment of cells with cytochalasin D markedly inhibits CD14-mediated internalization of LPS without any effect on cellular activation (14). Finally, the initial state of LPS aggregation has a strong influence on CD14-dependent internalization but has no measurable effect on the ability of LPS to stimulate cells (15). The inability of our mLBP-expressing cells to be directly activated by LPS, despite being able to bind LPS, supports the view that events leading to clearance of LPS vs those leading to LPS-induced cellular activation are separate. Our results also indirectly support the idea that the role of LBP in promoting cellular activation is to disaggregate LPS and deliver LPS in a more monomeric form to CD14.


    Acknowledgments
 
We gratefully acknowledge the assistance of the Core Facility and the Flow Cytometry Facility of The Scripps Research Institute.


    Footnotes
 
1 These studies were supported by National Institutes of Health Grants AI-32021 and HL-23584 to P.S.T. R.I.T. is a postdoctoral fellow of the American Heart Association Western States Affiliate. This is publication number 11988-IMM from the Scripps Research Institute. Back

2 Address correspondence and reprint requests to Dr. Peter S. Tobias, Department of Immunology, IMM-12, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037. E-mail address: Back

3 Abbreviations used in this paper: LBP, LPS-binding protein; GPI, glycosylphosphatidylinositol; mLBP, membrane-anchored LBP; mCD14, membrane CD14; sCD14, soluble CD14; CHO, Chinese hamster ovary. Back

Received for publication November 25, 1998. Accepted for publication February 16, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Schumann, R. R., S. R. Leong, G. W. Flaggs, P. W. Gray, S. D. Wright, J. C. Mathison, P. S. Tobias, R. J. Ulevitch. 1990. Structure and function of lipopolysaccharide binding protein. Science 249:1429.[Abstract/Free Full Text]
  2. Wright, S. D., R. A. Ramos, P. S. Tobias, R. J. Ulevitch, J. C. Mathison. 1990. CD14 serves as the cellular receptor for complexes of lipopolysaccharide with lipopolysaccharide binding protein. Science 249:1431.[Abstract/Free Full Text]
  3. Weidemann, B., H. Brade, E. T. Rietschel, R. Dziarski, V. Bazil, S. Kusumoto, H.-D. Flad, A. J. Ulmer. 1994. Soluble peptidoglycan-induced monokine production can be blocked by anti-CD14 monoclonal antibodies and by lipid A partial structures. Infect. Immun. 62:4709.[Abstract/Free Full Text]
  4. Zhang, Y. M., T. C. Doerfler, T. C. Lee, B. Guillemin, W. N. Rom. 1998. Mechanisms of stimulation of interleukin-1ß and tumor necrosis factor-{alpha} by Mycobacterium tuberculosis components. J. Clin. Invest. 91:2076.
  5. Espevik, T., M. Otterlei, G. Skjak-Braek, L. Ryan, S. D. Wright, A. Sundan. 1993. The involvement of CD14 in stimulation of cytokine production by uronic acid polymers. Eur. J. Immunol. 23:255.[Medline]
  6. Pugin, J., D. Heumann, A. Tomasz, V. Kravchenko, Y. Akamatsu, M. Nishijimi, M.-P. Glauser, P. S. Tobias, R. J. Ulevitch. 1994. CD14 is a pattern recognition receptor. Immunity 1:509.[Medline]
  7. Selati, T. J., D. A. Bouis, R. L. Kitchens, R. P. Darveau, J. Pugin, R. J. Ulevitch, S. C. Gangloff, S. M. Goyert, M. V. Norgard, J. D. Radolf. 1998. Treponema pallidum and Borrelia burgdorferi lipoproteins and synthetic lipopeptides activate monocytic cells via a CD14-dependent pathway distinct from that used by lipopolysaccharide. J. Immunol. 160:5455.[Abstract/Free Full Text]
  8. Wooten, R. M., T. B. Morrison, J. H. Weis, S. D. Wright, R. Thieringer, J. J. Weis. 1998. The Role of CD14 in signaling mediated by outer membrane lipoproteins of Borrelia burgdorferi. J. Immunol. 160:5485.[Abstract/Free Full Text]
  9. Grunwald, U., X. Fan, R. S. Jack, G. Workalemahu, A. Kallies, F. Stelter, C. Schutt. 1996. Monocytes can phagocytose Gram-negative bacteria by a CD14-dependent mechanism. J. Immunol. 157:4119.[Abstract]
  10. Schiff, D. E., L. Kline, K. Soldau, J. D. Lee, J. Pugin, P. S. Tobias, R. J. Ulevitch. 1998. Phagocytosis of Gram-negative bacteria by a unique CD14-dependent mechanism. J. Leukocyte Biol. 62:786.[Abstract]
  11. Gegner, J. A., R. J. Ulevitch, P. S. Tobias. 1995. LPS signal transduction and clearance: dual roles for LBP and mCD14. J. Biol. Chem. 270:5320.[Abstract/Free Full Text]
  12. Luchi, M., R. S. Munford. 1993. Binding, internalization, and deacylation of bacterial lipopolysaccharide by human neutrophils. J. Immunol. 151:959.[Abstract]
  13. Lamping, N., A. Hoess, B. Yu, T. C. Park, C.-J. Kirschning, D. Pfeil, D. Reuter, S. D. Wright, F. Herrmann, R. R. Schumann. 1996. Effects of site-directed mutagenesis of basic residues (Arg 94, Lys 95, Lys 99) of lipopolysaccharide (LPS)-binding protein on binding and transfer of LPS and subsequent immune cell activation. J. Immunol. 157:4648.[Abstract]
  14. Poussin, C., M. Foti, J.-L. Carpentier, J. Pugin. 1998. CD14-dependent endotoxin internalization via a macropinocytic pathway. J. Biol. Chem. 273:20285.[Abstract/Free Full Text]
  15. Kitchens, R. L., R. S. Munford. 1998. CD14-dependent internalization of bacterial lipopolysaccharide (LPS) is strongly influenced by LPS aggregation but not by cellular responses to LPS. J. Immunol. 160:1920.[Abstract/Free Full Text]
  16. Devitt, A., O. D. Moffatt, C. Raykundalia, J. D. Capra, D. L. Simmons, C. D. Gregory. 1998. Human CD14 mediates recognition and phagocytosis of apoptotic cells. Nature 392:505.[Medline]
  17. Martin, T. R., S. M. Mongovin, P. S. Tobias, J. C. Mathison, A. M. Moriarty, D. J. Leturcq, R. J. Ulevitch. 1994. The CD14 differentiation antigen mediates the development of endotoxin responsiveness during differentiation of mononuclear phagocytes. J. Leukocyte Biol. 56:1.[Abstract]
  18. Lee, J. D., K. Kato, P. S. Tobias, T. N. Kirkland, R. J. Ulevitch. 1992. Transfection of CD14 into 70Z/3 cells dramatically enhances the sensitivity to complexes of lipopolysaccharide (LPS) and LPS binding protein. J. Exp. Med. 175:1697.[Abstract/Free Full Text]
  19. Zoeller, R. A., Y. Liu, F. H. Millham, M. W. Freeman, D. T. Golenbock. 1993. Surface expression of human CD14 in Chinese hamster ovary fibroblasts imparts macrophage-like responsiveness to bacterial endotoxin. J. Biol. Chem. 268:22055.[Abstract/Free Full Text]
  20. Delude, R. L., Jr R. Savedra, H. Zhao, R. Thieringer, S. Yamamoto, M. J. Fenton, D. T. Golenbock. 1995. CD14 enhances cellular responses to endotoxin without imparting ligand-specific recognition. Proc. Natl. Acad. Sci. USA 92:9288.[Abstract/Free Full Text]
  21. Brown, D.. 1998. The tyrosine kinase connection: how GPI-anchored proteins activate T cells. Curr. Opin. Immunol. 5:349.
  22. Lee, J.-D., V. Kravchenko, T. N. Kirkland, J. Han, N. Mackman, A. Moriarty, D. Leturcq, P. S. Tobias, R. J. Ulevitch. 1993. GPI-anchored or integral membrane forms of CD14 mediate identical cellular responses to endotoxin. Proc. Natl. Acad. Sci. USA 90:9930.[Abstract/Free Full Text]
  23. Pugin, J., V. V. Kravchenko, J. D. Lee, L. Kline, R. J. Ulevitch, P. S. Tobias. 1998. Cell activation mediated by glycosylphosphatidylinositol-anchored or transmembrane-anchored forms of CD14. Infect. Immun. 66:1174.[Abstract/Free Full Text]
  24. Wright, S. D., M. T. C. Jong. 1986. Adhesion-promoting receptors on human macrophages recognize Escherichia coli by binding to lipopolysaccharide. J. Exp. Med. 164:1876.[Abstract/Free Full Text]
  25. Ingalls, R. R., D. T. Golenbock. 1995. CD11c/CD18, a transmembrane signaling receptor for lipopolysaccharide. J. Exp. Med. 181:1473.[Abstract/Free Full Text]
  26. Ingalls, R. R., M. A. Arnaout, D. T. Golenbock. 1998. Outside-in signaling by lipopolysaccharide through a tailless integrin. J. Immunol. 159:433.[Abstract]
  27. Han, J., J. Mathison, R. Ulevitch, P. Tobias. 1994. LPS binding protein, truncated at Ile-197, binds LPS but does not transfer LPS to CD14. J. Biol. Chem. 269:8172.[Abstract/Free Full Text]
  28. Caras, I. W., M. A. Davitz, L. Rhee, G. Weddell, Jr D. W. Martin, V. Nussenzweig. 1987. Cloning of decay-accelerating factor suggests novel use of splicing to generate two proteins. Nature 325:545.[Medline]
  29. Englund, P. T.. 1993. The structure and biosynthesis of glycosyl phosphatidylinositol protein anchors. C. Richardson, and J. N. Abelson, and A. Meister, and C. T. Walsh, eds. In Annual Review of Biochemistry Vol. 62:121. Annual Reviews, Inc, Palo Alto, CA. [Medline]
  30. Tapping, R. I., P. S. Tobias. 1997. Cellular binding of soluble CD14 requires lipopolysaccharide (LPS) and LPS-binding protein. J. Biol. Chem. 272:23157.[Abstract/Free Full Text]
  31. Dignam, J. D., R. M. Lebovitz, R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475.[Abstract/Free Full Text]
  32. Kravchenko, V. V., S. Steinemann, L. Kline, L. Feng, R. J. Ulevitch. 1996. Endotoxin tolerance is induced in Chinese hamster ovary cell lines expressing human CD14. Shock 5:194.[Medline]
  33. Frey, E. A., D. S. Miller, T. G. Jahr, A. Sundan, V. Bazil, T. Espevik, B. B. Finlay, S. D. Wright. 1992. Soluble CD14 participates in the response of cells to lipopolysaccharide. J. Exp. Med. 176:1665.[Abstract/Free Full Text]
  34. Pugin, J., C. C. Schurer-Maly, D. Leturcq, A. Moriarty, R. J. Ulevitch, P. S. Tobias. 1993. Lipopolysaccharide (LPS) activation of human endothelial and epithelial cells is mediated by LPS binding protein and soluble CD14. Proc. Natl. Acad. Sci. USA 90:2744.[Abstract/Free Full Text]
  35. Ulevitch, R. J., P. S. Tobias. 1994. Recognition of endotoxin by cells leading to transmembrane signalling. Curr. Opin. Immunol. 6:125.[Medline]
  36. Ulevitch, R. J., P. S. Tobias. 1995. Receptor-dependent mechanisms of cell stimulation by bacterial endotoxin. Annu. Rev. Immunol. 13:437.[Medline]
  37. Vasselon, T., R. Pironkova, P. A. Detmers. 1997. Sensitive responses of leukocytes to lipopolysaccharide require a protein component distinct from CD14 at the cell surface. J. Immunol. 159:4498.[Abstract]
  38. Kitchens, R. L., R. J. Ulevitch, R. S. Munford. 1992. Lipopolysaccharide (LPS) partial structures inhibit responses to LPS in a human macrophage cell line without inhibiting LPS uptake by a CD14-mediated pathway. J. Exp. Med. 176:485.[Abstract/Free Full Text]
  39. Kitchens, R. L., R. S. Munford. 1995. Enzymatically deacylated lipopolysaccharide (LPS) can antagonize LPS at multiple sites in the LPS recognition pathway. J. Biol. Chem. 270:9904.[Abstract/Free Full Text]
  40. Golenbock, D. T., R. Y. Hampton, N. Qureshi, K. Takayama, C. R. H. Raetz. 1991. Lipid A-like molecules that antagonize the effects of endotoxins on human monocytes. J. Biol. Chem. 266:19490.[Abstract/Free Full Text]
  41. Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein, J. F. Bazan. 1998. A family of receptors structurally related to Drosophila Toll. Proc. Natl. Acad. Sci. USA 95:588.[Abstract/Free Full Text]
  42. Yang, R.-B., M. R. Mark, A. Gray, A. Huang, M.-H. Xie, M. Zhang, A. Goddard, W. I. Wood, A. L. Gurney, P. J. Godowski. 1998. Toll-like receptor-2 mediates lipopolysaccharide-induced cellular signalling. Nature 395:284.[Medline]
  43. Kirschning, C. J., H. Wesche, T. M. Ayres, M. Rothe. 1998. Human Toll-like receptor 2 confers responsiveness to bacterial lipopolysaccharide. J. Exp. Med. 188:2091.[Abstract/Free Full Text]
  44. Poltorak, A., X. He, I. Smirnova, M.-Y. Liu, C. V. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton, B. Beutler. 1998. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene. Science 282:2085.[Abstract/Free Full Text]
  45. Medzhitov, R., P. Preston-Hurlburt, C. A. Janeway. 1998. A human homologue of the Drosophila Toll protein signals activation of adaptive immunity. Nature 388:394.
  46. Hailman, E., H. S. Lichenstein, M. M. Wurfel, D. S. Miller, D. A. Johnson, M. Kelley, L. A. Busse, M. M. Zukowski, S. D. Wright. 1994. Lipopolysaccharide (LPS)-binding protein accelerates the binding of LPS to CD14. J. Exp. Med. 179:269.[Abstract/Free Full Text]
  47. Tobias, P. S., K. Soldau, J. A. Gegner, D. Mintz, R. J. Ulevitch. 1995. Lipopolysaccharide binding protein-mediated complexation of lipopolysaccharide with soluble CD14. J. Biol. Chem. 270:10482.[Abstract/Free Full Text]
  48. Wurfel, M. M., S. D. Wright. 1998. Lipopolysaccharide-binding protein and soluble CD14 transfer lipopolysaccharide to phospholipid bilayers. J. Immunol. 158:3925.[Abstract]
  49. Thieblemont, N., R. Thieringer, S. D. Wright. 1998. Innate immune recognition of bacterial lipopolysaccharide: dependence on interactions with membrane lipids and endocytic movement. Immunity 8:771.[Medline]



This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
S. Roes, F. Mumm, U. Seydel, and T. Gutsmann
Localization of the Lipopolysaccharide-binding Protein in Phospholipid Membranes by Atomic Force Microscopy
J. Biol. Chem., February 3, 2006; 281(5): 2757 - 2763.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Dunzendorfer, H.-K. Lee, K. Soldau, and P. S. Tobias
TLR4 Is the Signaling but Not the Lipopolysaccharide Uptake Receptor
J. Immunol., July 15, 2004; 173(2): 1166 - 1170.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
D. L. Clemans, R. J. Bauer, J. A. Hanson, M. V. Hobbs, J. W. St. Geme III, C. F. Marrs, and J. R. Gilsdorf
Induction of Proinflammatory Cytokines from Human Respiratory Epithelial Cells after Stimulation by Nontypeable Haemophilus influenzae
Infect. Immun., August 1, 2000; 68(8): 4430 - 4440.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Tapping, R. I.
Right arrow Articles by Tobias, P. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Tapping, R. I.
Right arrow Articles by Tobias, P. S.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS