| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
*
Immunology Program, Memorial Sloan-Kettering Cancer Center, New York, NY 10021; and
Cornell University Graduate School of Medical Sciences, New York, NY 10021
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
|
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In recent years, another function for Bcl-2 has been exposed in its ability to retard cell cycle progression. Using the same cell lines that initially revealed the cell survival effect of Bcl-2 (4), it has been shown that bcl-2 expression delays the G1/S phase transition by lengthening G1 phase of cell cycle, with a proportional increase in total cell cycle time (10). Similar delays in S phase entry were shown using bcl-2 expression in other cell lines (11, 12), as well as in primary cells (10, 12, 13). It was also shown that constitutive bcl-2 expression impaired the activation of primary lymphocytes, as measured by entry into S phase (10, 12, 13, 14) or by IL-2 production (13); the latter effect appeared to be related to diminished NF-AT transcriptional activity. It is of interest to note that the protein domains of Bcl-2 that are apparently responsible for the cell cycle regulatory effect are not the same as those required for dimerization with death effectors (15, 16). This latter finding raises the possibility that Bcl-2 may influence cell cycle progression independently of the inhibition of caspases. In either case, the mechanisms for the cell cycle regulatory effect of Bcl-2, and its biological relevance, have yet to be resolved.
The regulation of cell division in eukaryotic cells centers around control of the transition from G0/G1 phases of cell cycle into S phase. The E2F family of transcription factors (currently five members) are critical regulators of this transition (17). E2F activity is, in turn, regulated by physical association with the retinoblastoma protein (pRb) and/or the related proteins p107 and p130. Upon mitogenic stimulus, cyclin-dependent kinases are activated by periodic increases in cyclins D and E; these kinases then mediate the progressive phosphorylation of pRb and its relatives, resulting in their dissociation from the E2F complex and the activation of E2F transcriptional activity.
The G1/S phase transition also represents an important control point for cell death induction and the regulation of cell survival (18). Many proteins responsible for inducing G1/S phase progression have also been shown to be capable of inducing PCD (19). It logically follows that regulating the activities of cell cycle proteins would also diminish their cell death activities and enhance cell survival. In the present study, we show that Bcl-2 fulfills such a role. In factor-dependent cells, bcl-2 expression results in a decrease in the active (free) isoforms of E2F, and a corresponding increase in E2F/pRb family member complexes, under conditions that lead to PCD in controls (factor withdrawal). These changes correlate with a decrease in pRb phosphorylation, with the appearance of p130 protein, and with the de novo formation of E2F/p130 complexes. Our findings thus suggest an E2F-related mechanism for the cell cycle regulatory effects previously ascribed to Bcl-2. Further, these results provide a linkage between cell cycle regulation and cell survival that incorporates a variety of published observations and that may help to explain how Bcl-2 influences both cell cycle progression and cell survival during proliferation and differentiation.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
FDC-P1 cells infected with a retroviral construct containing the human bcl-2 gene or a control (neo) insert were generated as described (4). Both lines were grown in DMEM containing 10% FBS, recombinant IL-3, and selective antibiotics (G418, 500 µg/ml; Sigma, St. Louis, MO); selective medium was removed for three to four cell divisions before the initiation of experiments. Both control and bcl-2-expressing cell lines were periodically and routinely subcloned by limiting dilution. Recombinant IL-3 was produced as the supernatant from a transfected cell line (20) and was routinely used at twice the concentration required to sustain optimal growth of parental FDC-P1 cells.
Cellular extracts
Protein extracts for immunoblot analysis were prepared by washing cells once in Dulbecco’s PBS (D-PBS), followed by lysis at 5 x 107 cells/ml in 1x gel loading buffer (60 mM Tris, pH 6.8, 700 mM 2-ME, 2% SDS, 10% glycerol, and 0.001% bromophenol blue) at 95°C for 5 min. DNA was sheared by passage through a 25-gauge hypodermic needle, and extracts were stored at -20°C until required. Extracts for E2F gel mobility shift assays were prepared as described (21). Briefly, cells were washed in D-PBS at 4°C and resuspended in two packed cell volumes of ice cold, high salt buffer (20 mM HEPES, pH 7.6, 0.42 M NaCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM PMSF, 0.5 mM DTT, and 25% glycerol); the final concentration of NaCl was adjusted to 0.42 M by addition of 5 M stock. Cells were frozen in liquid N2 and thawed on ice, followed by centrifugation at 20,000 x g for 20 min. The supernatants were removed and stored at -20°C until required.
Flow cytometric DNA content analysis
Cells for DNA content analysis were washed in D-PBS, resuspended in 50 µl of D-PBS, slowly diluted with 1 ml of ice cold 70% ethanol while mixing, and stored overnight at 4°C. Following fixation, cells were centrifuged and resuspended in 1 N HCl/0.5% Triton X-100 in H2O for 15 min at room temperature. Following this treatment, cells were again centrifuged and resuspended in 0.1 M Na2B4O7, pH 8.5, to neutralize the acid. Cells were washed in D-PBS/5% FBS/0.5% Tween 20 and resuspended in propidium iodide (PI; 5 µg/ml in D-PBS) for at least 2 h before analysis on a FACScan (Becton Dickinson, Mountain View, CA). Cell cycle distributions and apoptotic forms were calculated using Mod-Fit software (Verity Software House, Topsham, ME). For BrdU-DNA analysis, cells were first labeled for 30 min with 10 µM 5-bromo-2'-deoxyuridine (BrdU) in medium, followed by washing into fresh medium and reculture.
p130 immunoprecipitation
FDC-P1 cells were washed in PBS and lysed at a concentration of 2 x 107 cells/ml in RIPA buffer (1x PBS, 1% sodium deoxycholate, 0.1% SDS, 0.1 mg/ml PMSF, and Aprotinin (Sigma; 30 µl/ml)) on ice for 30 min. After 5 passages through a 25-gauge needle, the solution was cleared by centrifugation and pretreated with nonspecific rabbit serum followed by protein A/G-conjugated agarose beads (Santa Cruz Biotechnology, Santa Cruz, CA). After preclearing, the lysate was incubated for 8 h with Ab recognizing p130 (C-20; Santa Cruz). Ab complexes were precipitated using protein A/G-conjugated agarose beads; the beads were washed 4x in RIPA buffer before denaturation for immunoblot analysis, as described below.
Protein immunoblot analysis
Gel-loading buffer lysates (described above) were separated by discontinuous SDS-PAGE in gels consisting of 8% (for pRb analysis) or 6% (for p130) acrylamide. Gel lanes were loaded with equivalent volumes of cell extracts (generally 5 x 105 cell equivalents per lane). Following electrophoresis, proteins were transferred to nitrocellulose membranes (HyBond ECL; Amersham, Arlington Heights, IL) by electroblotting in 25 mM Tris (pH 8.3)/200 mM glycine/20% methanol transfer buffer. Membranes were blocked in 10 mM Tris, pH 7.5, containing 0.15 M NaCl, 0.2% Tween 20, and 5% nonfat dry milk. Primary and secondary immunodetection, as well as intervening washes, were performed in the same buffer using 1% dry milk. The primary Abs used in these studies were mAb G3-245 (PharMingen, San Diego, CA) specific for pRb; polyclonal antiserum recognizing p130 protein (C-20; Santa Cruz); or mAb KH95 (Santa Cruz) specific for E2F-1. Biotinylated secondary Abs were purchased from Santa Cruz. Immunoblots were visualized using ECL detection (Amersham) and autoradiographic film (Kodak AR; Rochester, NY).
Electrophoretic gel mobility shift analysis
E2F gel mobility shift assays were performed as described (21). Briefly, reaction mixtures (25 µl) were prepared using 20 ml binding buffer (50 mM KCl, 20 mM HEPES, pH 7.5, 10 mM MgCl2, 10% glycerol, 0.5 mM DTT, 1% Nonidet P-40), 20 mg BSA, 2 mg sonicated salmon sperm DNA, 5–15 mg of protein from high salt cell extracts, and 0.5 ng of 32P-labeled oligonucleotide probe. Reactions were incubated for 10 min at room temperature, and the products were resolved on 4% polyacrylamide gels using 0.25x TBE as buffer, followed by drying and exposure to film (Kodak AR). For competition studies, extracts were first treated with a 100-fold excess of unlabeled wild-type or mutant oligonucleotides, as described (21). For Ab supershift experiments, 0.25 mg of Ab was added to the reaction mixture 10 min before the addition of labeled oligonucleotide probe. The Abs used were clone SD-15, specific for p107 (22); clone C36 (Calbiochem, San Diego, CA), specific for pRb; and polyclonal anti-p130 antiserum (C20; Santa Cruz). The sequence of the double stranded oligonucleotide used to detect E2F binding was as follows (sense strand): 5'-agcttgttttcgcgcttaaatttgagaaagggcgcgaaactagtca-3'. DNA was end-labeled with a [32P]dCTP using the Klenow fragment of DNA polymerase, as described (21).
Reverse transcription and PCR amplification
Total cellular RNA was extracted and treated with 10 units of RNase-free DNase I (Boehringer-Mannheim, Indianapolis, IN) for 30 min at 37°C. Following inactivation of DNase at 95°C, reverse transcription and PCR amplification were performed using the SuperScript One-Step RT-PCR system (Life Technologies, Rockville, MD). Primer sequences were as follows (5'-3'): p130 forward, caacaggtgacaggaaccact; p130 reverse, gtgagtcgagttggtgtagga; hypoxanthine phosphoribosyltransferase (HPRT) forward, gttggatacaggccagactttgtt; and HPRT reverse, gagggtaggctggcctataggct. Predicted products were 594 or 354 bp, respectively. Amplification was conducted for 35 cycles. Amplification products were analyzed after electrophoresis in 2.5% MetaPhor agarose (FMC Bioproducts, Rockland, ME) by staining with ethidium bromide. Image analysis was performed using a Bio-Rad GelDoc 1000 with Molecular Analyst software (Bio-Rad, Hercules, CA).
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In the original description regarding the inhibitory effects of
Bcl-2 on cell death (4), it was shown that normal (control-transfected)
FDC-P1 cells died when denied IL-3, while bcl-2-expressing
cells survived. It was also shown that bcl-2-expressing
cells accumulated at the diploid (2n) DNA stage of cell
cycle. The cell cycle behavior of control cells in the absence of IL-3
was not described in this manuscript. Consequently, it is not clear
whether cell cycle arrest in the absence of IL-3 was due to prolonged
survival in the absence of growth factor stimulation, or to an
intrinsic cell cycle regulatory effect of Bcl-2. To discriminate
between these possibilities, we analyzed proliferative status in both
control and bcl-2-expressing cells in response to IL-3
withdrawal. The data presented in Fig. 1
demonstrate that, in contrast to the behavior of
bcl-2-expressing cells, control FDC-P1 cultures continue to
include mitotic forms after IL-3 withdrawal. For instance, by 20 h
after IL-3 withdrawal, >95% of bcl-2-expressing cells have
arrested at the 2n DNA stage (G0). At this same
time point, control cells appear to remain largely in cycle, with 30%
of cells still in S, G2, and M phases. The accumulation of
apoptotic figures approximates the decrease in S, G2, and M
phase cells in control cultures. However, cell death was not specific
for cells in any stage of cycle, as determined by DNA synthetic
labeling with BrdU (Fig. 2). In addition,
the data in Fig. 2 demonstrate that the mitotic cells (>2n
DNA) seen after factor withdrawal in control cultures are not simply
frozen in cycle, since these cells redistribute throughout cell cycle
during subsequent culture. Together, the results shown in Figs. 1 and 2
indicate that cell cycle arrest after IL-3 withdrawal is a direct
effect of bcl-2 expression, rather than an indirect effect
of prolonged survival in the absence of IL-3 signaling, since control
cells fail to withdraw from cycle under identical conditions. Similar
conclusions can be drawn from the published results of others (13).
These data imply that the consequences of cell cycle regulation by
Bcl-2 may include the promotion of cell survival under stress
conditions, such as growth factor deficiency.
|
|
To further characterize the differences in cell cycle regulation
between control and bcl-2-transduced cells, the
phosphorylation state of pRb was examined (Fig. 3). Both bcl-2-expressing and
control cells expressed mainly the inactive (phosphorylated) form of
pRb when cultured in the presence of growth factor. Upon IL-3
withdrawal, FDC-P1/bcl-2 cells respond by progressive
underphosphorylation of pRb, until by 30 h after withdrawal,
essentially no phosphorylated pRb can be detected. In control FDC-P1
cells, however, phosphorylated pRb remains the primary isoform
detected, consistent with the continued cell cycle progression shown in
Figs. 1
and 2. The levels of pRb protein progressively decline in
control cells after factor withdrawal, despite the fact that total
protein levels do not change substantially during the 30-h culture
period (Fig. 3). This decline in pRb levels in controls is consistent
with the degradation of pRb in cells undergoing PCD (23). In contrast,
pRb levels remain high after factor withdrawal in
FDC-P1/bcl-2, while total protein levels decrease in a
manner consistent with cell cycle arrest. These findings show that cell
cycle regulation by Bcl-2 is associated with specific changes in the
production and activation of pRb, consistent with the previous
localization of these effects to the G1/S phase checkpoint
(10, 13).
|
The Bcl-2-induced accumulation of cells in an apparent
G0 state (Fig. 1), together with the accumulation of the
active form of pRb in these cells (Fig. 3), suggests that cell cycle
regulation by Bcl-2 might involve modulation of the activities of the
E2F family of transcription factors. To evaluate this possibility,
extracts from control or bcl-2-expressing FDC-P1 cells were
tested for their ability to retard the electrophoretic mobility of an
oligonucleotide containing E2F consensus binding sequences. The results
from one such experiment are shown in Fig. 4. Extracts from asynchronous control and
bcl-2-expressing cultures displayed both free E2F and higher
order E2F/pRb family complexes, as expected. However, the proportion of
higher order complexes was frequently increased in cells expressing
bcl-2 compared with controls (see Fig. 4A and
similar data in Fig. 5). This finding may
explain the G1/S phase regulatory effect of Bcl-2 in
dividing cells, including the differences in cell cycle distribution
shown here (Fig. 1) and previously (10). Culture in the absence of IL-3
demonstrated dramatic differences between bcl-2-expressing
and control cells in the processing of E2F/DNA-binding activity.
Consistent with the data shown above, bcl-2-expressing cells
display a diminution in the free (active) isoforms of E2F and a shift
toward higher order complexes that are transcriptionally inactive (24).
Control cells respond in the opposite manner, by a reduction in the
presence of regulatory complexes and the increased liberation of active
isoforms of E2F. This experiment was repeated numerous times. Together
with the data shown in
Figs. 1–3, these findings show that control of
cell cycle progression by Bcl-2 involves the regulation of E2F
transcriptional activity by pRb family members; the relative
contributions of specific pRb family members is revealed in the
experiments described below.
|
|
To further assess the mechanism by which Bcl-2 affects E2F
activity, Abs specific for pRb and related family members p107 and p130
were used to supershift E2F/DNA binding complexes in electrophoretic
mobility assays. The results of one such experiment are shown in Fig. 5. In normally dividing cells of both types (control or
bcl-2), a substantial proportion of E2F complexes were
composed of E2F/pRb or E2F/p107, but not, apparently, E2F/p130. Higher
order E2F/protein complexes are not present in control cells after IL-3
withdrawal (Fig. 4); consequently, supershifted complexes could not be
detected (data not shown). In contrast, the increase in higher-order
E2F complexes seen after IL-3 withdrawal in bcl-2-expressing
cells (Figs. 4 and 5) is associated with the accumulation of complexes
consisting of E2F and p130 at the expense of those formed by E2F/p107
complexes (Fig. 5). Scanning densitometric analysis (not shown)
demonstrates that the E2F/p130 complexes formed after IL-3 withdrawal
in bcl-2-expressing cells is proportional in magnitude to
the E2F/p107 complexes that are lost, suggesting that a shift in E2F
complex formation from p107 to p130 has occurred. Consistent with this,
immunoblot analysis shows that p130 protein levels increase
dramatically after IL-3 withdrawal in bcl-2-expressing
cells, but not in controls (Fig. 6A). In agreement with recent
findings (25), regulation of p130 protein levels appears to occur
posttranscriptionally, since p130 mRNA can be detected in either the
presence or absence of IL-3 (Fig. 6B). The absence of p130
protein in control cells after IL-3 withdrawal is consistent with their
failure to withdraw from cell cycle after factor deprivation (Figs. 1 and 2). In general, these findings are in agreement with the suspected
roles for p130 in cell cycle withdrawal and G0 arrest
(26, 27, 28) and further support the regulation of E2F transcriptional
activity as the likely mechanism for control of cell cycle progression
by Bcl-2. Since certain E2F family members, namely E2F-4 and E2F-5,
have a higher affinity for p130 than others (27, 29, 30), the cell
cycle activities attributable to these are most likely to be affected
by stabilization of p130 protein levels.
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
In addition to the indirect role in cell survival described above,
Bcl-2-induced alterations in E2F activity also could lead to the direct
inhibition of PCD, based on recent findings regarding the control of
gene transcription by E2F-1. The data shown in Fig. 3 reveal that
induction of PCD in control cells is accompanied by an increase in free
E2F isoforms and by the loss of higher order complexes, including those
formed by p107 and pRb (Figs. 4 and 5). Such changes are consistent
with a predicted increase in E2F transcriptional activity (24), as is
supported by the data shown in Figs. 1 and 2. In contrast, cells
expressing bcl-2 display increased levels of higher order
(transcriptionally inactive) E2F complexes after cytokine withdrawal,
as well as a shift in composition toward complexes composed of E2F and
p130. Thus, Bcl-2 appears to induce the sequestration of E2F proteins
that are normally liberated from pRb and p107 during PCD, via the
formation of complexes with p130. Two recent lines of evidence suggest
that this effect may directly promote cell survival. First, it has been
shown that, in the absence of p107 activity, control of E2F-1
transcriptional activity is relegated to p130 (32, 33). Further, E2F-1
has been shown to specifically activate the transcription of genes
involved in the induction of PCD (34, 35, 36). Consequently, it is possible
that the induction of inactive E2F complexes by Bcl-2 may promote cell
survival through the inhibition of E2F-1 activity. The data provided in
this manuscript therefore link Bcl-2 to the regulation of E2F
transcriptional activity in the collective control of both cell death
and cell cycle processes. It is worthwhile to point out that any
substance that blocks cell death may have similar effects on cell cycle
regulatory activities under conditions that lead to cell death.
However, we have shown that Bcl-2 exhibits cell cycle inhibitory
effects during normal proliferation (Fig. 1, reduced S/G2/M
phase cells in Bcl-2-expressing cells under normal growth conditions;
Fig. 4, increased formation of inactive E2F complexes under normal
growth conditions; Ref. 10, increased levels of hypophosphorylated pRb
under normal growth conditions), showing that these effects can occur
independently of the inhibition of apoptosis.
The antagonism of cell death effectors remains as a documented function
of Bcl-2 (37). The data presented in this manuscript suggest that the
cell cycle regulatory role of Bcl-2 operates synergistically with the
neutralization of proapoptotic proteins, further promoting cell
survival through both direct and indirect means. The primary
biochemical interactions responsible for this link remain to be
determined. The most direct interaction between Bcl-2 and cell
cycle-related proteins described to date is the finding that Bcl-2
targets Raf-1 kinase to mitochondrial substrates (38), thereby
competing with the Ras/extracellular signal-regulated kinase (ERK)
pathway for Raf-1 functions. While this mechanism certainly influences
the G1/S phase transition, it is not sufficient to explain
the differences in E2F/p130 protein complexes induced by Bcl-2 after
growth factor withdrawal (Figs. 4 and 5). Also intriguing are the
findings that Bcl-2 can inhibit the nuclear import of transcription
factors, including p53 and NF-AT (13, 39). Given the localization of
Bcl-2 to intracellular membranes, and the apparent pore-forming ability
of Bcl-2 proteins (8), it is possible that Bcl-2 might be involved in
the translocation of a variety of substances into the nucleus,
including the E2F family, cell cycle proteins, and/or their regulatory
partners. The hierarchical definition of the role of Bcl-2 in cell
cycle control and the downstream effects on cell survival thus continue
to represent fertile areas for the further elucidation of these complex
and interrelated disciplines.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Howard T. Petrie, Memorial Sloan-Kettering Cancer Center, Box 341, 1275 York Avenue, New York, NY 10021. E-mail address:
3 Abbreviations used in this paper: PCD, programmed cell death; BrdU, 5-bromo-2'-deoxyuridine; pRb, retinoblastoma protein; D-PBS, Dulbecco’s PBS; PI, propidium iodide; HPRT, hypoxanthine phosphoribosyltransferase.
Received for publication October 6, 1998. Accepted for publication February 16, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
perturbs T cell development and affects cell cycle entry of T cells. EMBO J. 15:6991.[Medline]
This article has been cited by other articles:
|
|
 |
|
  L. Cohen, X. E, J. Tarsi, T. Ramkumar, T. K. Horiuchi, R. Cochran, S. DeMartino, K. B. Schechtman, I. Hussain, M. J. Holtzman, et al. Epithelial Cell Proliferation Contributes to Airway Remodeling in Severe Asthma Am. J. Respir. Crit. Care Med., July 15, 2007; 176(2): 138 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. A. Vorburger, N. Hetrakul, W. Xia, M. Wilson-Heiner, N. Mirza, R. E. Pollock, B. Feig, S. G. Swisher, and K. K. Hunt Gene therapy with E2F-1 up-regulates the protein kinase PKR and inhibits growth of leiomyosarcoma in vivo Mol. Cancer Ther., November 1, 2005; 4(11): 1710 - 1716. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.-L. Hu, R. G. Cowan, R. M. Harman, and S. M. Quirk Cell Cycle Progression and Activation of Akt Kinase Are Required for Insulin-Like Growth Factor I-Mediated Suppression of Apoptosis in Granulosa Cells Mol. Endocrinol., February 1, 2004; 18(2): 326 - 338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Yan, J.-X. Huang, A.-S. Lax, L. Pelliniemi, E. Salminen, M. Poutanen, and J. Toppari Overexpression of Bcl-w in the Testis Disrupts Spermatogenesis: Revelation of a Role of BCL-W in Male Germ Cell Cycle Control Mol. Endocrinol., September 1, 2003; 17(9): 1868 - 1879. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Bevilacqua, M. C. Ceriani, G. Canti, L. Asnaghi, R. Gherzi, G. Brewer, L. Papucci, N. Schiavone, S. Capaccioli, and A. Nicolin Bcl-2 Protein Is Required for the Adenine/Uridine-rich Element (ARE)-dependent Degradation of Its Own Messenger J. Biol. Chem., June 20, 2003; 278(26): 23451 - 23459. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Mazzocca, S. Giusti, A. D. Hamilton, S. M. Sebti, P. Pantaleo, and V. Carloni Growth Inhibition by the Farnesyltransferase Inhibitor FTI-277 Involves Bcl-2 Expression and Defective Association with Raf-1 in Liver Cancer Cell Lines Mol. Pharmacol., January 1, 2003; 63(1): 159 - 166. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Gomez-Manzano, P. Mitlianga, J. Fueyo, H.-Y. Lee, M. Hu, K. B. Spurgers, T. L. Glass, D. Koul, T.-J. Liu, T. J. McDonnell, et al. Transfer of E2F-1 to Human Glioma Cells Results in Transcriptional Up-Regulation of Bcl-2 Cancer Res., September 1, 2001; 61(18): 6693 - 6697. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Divan, J. Lawry, I. R. Dunsmore, M. A. Parsons, and J. A. Royds p53 and p21waf-1 Expression Correlates with Apoptosis or Cell Survival in Poorly Differentiated, but not Well-Differentiated, Retinoblastomas Cancer Res., April 1, 2001; 61(7): 3157 - 3163. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Gala, A. Marreiros, G. J. Stewart, and P. Williamson Overexpression of E2F-1 leads to cytokine-independent proliferation and survival in the hematopoietic cell line BaF-B03 Blood, January 1, 2001; 97(1): 227 - 234. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Vairo, T. J. Soos, T. M. Upton, J. Zalvide, J. A. DeCaprio, M. E. Ewen, A. Koff, and J. M. Adams Bcl-2 Retards Cell Cycle Entry through p27Kip1, pRB Relative p130, and Altered E2F Regulation Mol. Cell. Biol., July 1, 2000; 20(13): 4745 - 4753. [Abstract] [Full Text]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
oligo). These results are characteristic of
several such experiments.
