|
|
||||||||


*
Department of Pharmacological and Physiological Sciences, and
Department of Molecular Microbiology and Immunology, St. Louis University School of Medicine, St. Louis, MO 63104
| Abstract |
|---|
|
|
|---|
80% decrease in specific IL-1 RNA
synthesis. In contrast, SB203580 had no effect on the synthesis of
TNF-
message. LPS-stimulated p38 MAPK activity in the RAW264.7 cells
was blocked by SB203580, as measured by the inhibition of MAPKAP2
kinase activity, a downstream target of the p38 MAPK. CCAATT/enhancer
binding protein (C/EBP)/NFIL-6-driven chloramphenicol acetyltransferase
(CAT) reporter activity was sensitive to SB203580, indicating that
C/EBP/NFIL-6 transcription factor(s) are also targets of p38 MAPK. In
contrast, transfected CAT constructs containing NF-
B elements were
only partially inhibited (
35%) at the highest concentration of
SB203580 after LPS stimulation. As measured by EMSA, LPS-stimulated
NF-
B activation was not affected by SB203580. Overall, the results
demonstrate, for the first time, a role for p38 MAPK in IL-1ß
transcription by acting through C/EBP/NFIL-6 transcription
factors. | Introduction |
|---|
|
|
|---|
brain wave formation (5), to name a few.
Better understood is the role of IL-1 as a potent inflammatory cytokine
in a variety of diseases, such as arthritis (6, 7, 8), atherosclerosis
(9), and diabetes mellitus (10). A number of agonists that stimulate
IL-1 production have been identified, among them is the endotoxin LPS
derived from the cell wall of Gram-negative bacteria. LPS is a potent
stimulator of IL-1 in the macrophage/monocyte cell lineage, and these
processes play a major role in sepsis and subsequent endotoxic shock
(11). Despite the fact that overproduction of IL-1 leads to acute shock
and to a variety of chronic inflammatory diseases, little is known
regarding the regulation of IL-1 production. Several approaches have been initiated to control IL-1 and other proinflammatory cytokines. Most therapeutics have been aimed at the effector level, either the cytokine receptor (12, 13) or the neutralization of the cytokine molecule by either Abs or soluble receptors (14, 15). At the level of cytokine synthesis, some of the inhibitors include glucocorticoids (16), antioxidants (17), cytokines such as IL-4 (18) and IL-10 (19), and a number of low molecular organic compounds (20). Among the latter group, more recent attention has focused on the bicyclic pyridinyl imidazole class of compounds, which are potent inhibitors of TNF and IL-1 synthesis (20, 21, 22, 23). These compounds, termed cytokine suppressive antiinflammatory drugs (CSAID), have a marked specificity for cytokines with no generalized effects on total RNA and protein synthesis. The intracellular target of these compounds is the p38 MAPK (22), a key component in stress-induced signal transduction pathways. Analysis of inhibitory mechanisms by CSAID indicated that the site of action was primarily at the translational level (23, 24).
Our laboratory has identified and characterized cis-acting
elements and nuclear DNA-binding proteins that regulate murine IL-1ß
transcription in the murine macrophage cell line RAW264.7 (25, 26, 27, 28, 29). The
results (26, 28) demonstrated that both proximal and distal NFIL-6
regulatory elements play an important role in the activation of IL-1ß
transcription. In addition, the results showed that both the
CCAAT/enhancer binding protein
(C/EBP)ß3 and C/EBP
transcription factors bound to these sites. Because it is known that 1)
these transcription factors are activated by phosphorylation (30, 31),
and 2) the activation of CHOP, a member of the C/EBP transcription
factor family, is dependent upon phosphorylation at serine residues 78
and 81 by the p38 MAPK (32), we examined the possibility that the p38
MAPK, through C/EBPß and -
factors, might also be important for
IL-1ß transcription. We now report that in some macrophage cell
lines, the p38 MAPK partially controls IL-1ß transcription most
likely through the C/EBPß and/or C/EBP
transcription factors.
These findings show, for the first time, that the p38 MAPK plays a role
in the regulation of IL-1ß expression at the level of transcription.
In addition, these results show that alternate means of cytokine
regulation by p38 MAPK, e.g., transcripton or translation, are possible
in specific tissues for particular genes.
| Materials and Methods |
|---|
|
|
|---|
RAW264.7 and J774 cells (American Type Culture Collection, Manassas, VA) were maintained in flasks in D5 (DMEM (Life Technologies, Gaithersburg, MD) containing 5% heat-inactivated FCS (HyClone, Logan, UT), 2 mM L-glutamine (Life Technologies), 100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies)). LPS (Escherichia coli serotype 0127:B8; Difco Laboratories, Detroit, MI) was dissolved at 5 mg/ml in sterile media in the absence of serum and stored at -20°C.
Plasmid preparation
The trimerized murine 3x C/EBP/NFIL-6 and 3x NF-
B-driven
CAT constructs were generated by the insertion of three copies of each
respective element into the previously described IL-1ß reporter
construct -50 +I CAT (28). Briefly, the sense and antisense trimerized
elements were synthesized as oligonucleotides with artificial 5' KPNI
and 3' SalI sites, annealed, and introduced into the
KpnI and SalI sites of the -50 +I CAT construct.
Each of the final constructs consisted of their respective trimerized
elements 5' of IL-1ß genomic sequence consisting of -50 bp upstream
of the entire first exon, intron one, and the 5' portion of the second
exon terminating immediately upstream of the translational initiation
codon.
Cell transfection
Briefly, the cells were plated at 50100 x 103 cells/well in 6-well tissue culture plates for 4872 h, at which time the transfection protocol was initiated (5070% cell confluency). Transient transfection of RAW264.7 cells was performed using lipofectamine (Life Technologies) according to the manufacturers recommendation. The amounts of DNA used in transfection varied with each of the constructs and are indicated in each of the experiments. The lipofectamine-DNA complex in D5 was allowed to incubate overnight, at which time the media was changed and LPS added at various concentrations as indicated. After 24 h, the transfected cultures were harvested and assayed for CAT activity as described (26, 33).
Nuclear run-off (NRO) analysis
NRO analysis was performed according to the method of Hanson et al. (34) with the following modifications. After the first precipitation, the pellet was resuspended in RNase-free DNase I and incubated for 15 min at 37°C. This was followed by the addition of proteinase K at 200 µg/ml final concentration. After extraction in phenol-chloroform, the mixture was precipitated in ethanol, followed by resuspension in the guanidium isothyocyanate solution, and ethanol precipitation. This sequence was repeated until the recovered cpm remained constant. Typically, between 0.5 and 3.0 x 106 cpm of labeled RNA was recovered per reaction. Equal numbers of counts were used for each hybridization and were conducted for 72 h at 42°C in 2 ml of hybridization buffer (50% formamide, 6x SSC phosphate/EDTA (SSPE), 5x Denhardts, 0.1% SDS, and 100 µg/ml salmon sperm DNA). Filters were washed as described, except that the washes in 0.1x SSC were conducted at 65°C instead of the stated 60°C. The washed filters were exposed to PhosphorImager screens (Molecular Dynamics, Sunnyvale, CA) for typically 3 days. Phosphor image scanning and analysis was performed with a Storm PhosphorImager and software provided by Molecular Dynamics. Autoradiography was performed at -70°C for 3 wk. The intensity of hybridization was assessed by densitometry (Molecular Dynamics) and quantitation performed using the ImageQuant software by Molecular Dynamics.
EMSA
Nuclear extracts were prepared from 4050 x
106 RAW264.7 cells that had been stimulated for 30 min with
LPS. Cells were harvested in PBS, centrifuged, resuspended in 400 µl
of hypotonic buffer (20 mM Tris (pH 7.8), 5 mM MgCl2, 0.2
mM EDTA, 1 mM DTT, 5 mM ß-glycerolphosphate, 0.5 mM PMSF, and 10
µg/ml of pepstatin, aprotinin, and leupeptin), and incubated on ice
for 15 min. A total of 25 µl of 10% Nonidet P-40 was added, the
sample vortexed vigorously for 10 s, followed by centrifugation at
14,000 rpm for 30 s. The pelleted nuclei were resuspended in 75
µl of hypertonic buffer (10 mM Tris (pH 7.8), 350 mM NaCl, 25%
glycerol, 5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT, 10 mM
ß-glycerolphosphate, 0.5 mM PMSF, and 10 µg/ml of pepstatin,
aprotinin, and leupeptin). After 15 min on ice, lysates were
centrifuged at 14,000 rpm for 15 min. Supernatants were harvested,
protein concentration was determined using the BCA Protein Assay
Reagent (Pierce, Rockford, IL), and stored at -80°C until use. EMSA
was performed by standard well described procedures (26). Briefly, 46
µg of protein were incubated with an end-labeled oligonucleotide
probe (1020 x 104 cpm) containing the NF-
B
binding site, AGTTGAGGGGACTTTCCCAGGC (Promega, Madison, WI)
for 20 min at RT in binding reaction buffer (10 mM Tris (pH 7.5), 1 mM
EDTA, 5 mM MgCl2, 5% glycerol, 5% sucrose, and 0.01%
Nonidet P-40, 0.1 mM DTT). The samples were electrophoresed through 4%
polyacrylamide gels in 0.5x Tris-borate-buffer (TBE). For supershift
analysis, Ab specific for the p50 subunit of NF-
B was used (Santa
Cruz Biotechnology, Santa Cruz, CA). Gels were analyzed using a
PhosphorImager, and quantitation was performed using the ImageQuant
software by Molecular Dynamics.
Western blot analysis
LPS at 50 ng/ml in the presence or absence of SB203580 (0.1515 µM, 30 min before LPS addition) was added to 6070% confluent RAW264.7 cells that had been previously plated at 1 x 105 cells per well. Cells were harvested 4 and 8 h later, washed once in PBS, and lysed in solubilization buffer (20 mM Tris-HCL (pH 8.0), 1 mM sodium vanadate, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, 2 mM EDTA, 1% Triton X-100, 50 mM ß-glycerolphosphate, and 10 µg/ml each aprotinin, leupeptin, and pepstatin). Protein concentrations in the cell lysates were determined by Bio-Rad (Richmond, CA) protein assay, as recommended by the manufacturer. Western blot analyses were performed on lysates (30 µg) as described previously (35). Membranes were probed with anti-murine IL-1ß polyclonal rabbit Abs (Genzyme, Cambridge, MA), followed by goat anti-rabbit Abs conjugated with HRP, and developed with enhanced chemiluminescence (Amersham, Arlington Heights, IL), as recommended by the manufacturer. Intracellular IL-1ß after LPS stimulation in the presence and absence of SB203580 was also measured by ELISA (Biosource International, Camarillo, CA), as recommended by the manufacturer.
Kinase assays
For p38 MAPK activity, LPS-stimulated RAW264.7 cells were
harvested at the indicated times, washed once with PBS, and lysed in
solubilization buffer. p38 MAPK was captured from 50 µg of total
cellular lysate protein with GST-activating transcription factor (ATF)2
fusion protein (36) coupled to glutathione-Sepharose beads (Sigma, St.
Louis, MO). After overnight incubation at 4°C with gentle rotation,
the ATF2/p38 MAPK complexes were washed five times with HBIB buffer (20
mM HEPES (pH 7.5), 50 mM NaCl, 0.1 mM EDTA, 2.5 mM MgCl2,
and 0.05% Triton X-100) and resuspended in 30 µl of kinase buffer
(20 mM HEPES, 2 mM DTT, 20 mM ß-glycerolphosphate, 20 mM
p-nitrophenylphosphate, 20 mM MgCl2, 0.1 mM
sodium vanadate, 20 µM ATP, and 5 uCi of [
-32P]ATP),
incubated with agitation at 30°C for 30 min. The bound complexes were
washed several times with HBIB, resuspended in 2x Laemmeli buffer,
boiled for 3 min, and centrifuged. The released complexes were then
analyzed by electrophoresis on 10% SDS-polyacrylamide gels. Gels were
dried and subjected to autoradiography at -70°C for usually several
hours.
To measure MAPKAP2 kinase activity, RAW264.7 cells were harvested 30 min after stimulation with LPS in the presence or absence of SB203580 and lysed in solubilization buffer. Equal amounts of total protein from the lysates were assayed for MAPKAP2 activity using a commercial kit (Upstate Biotechnology, Lake Placid, NY), as recommended by the manufacturer.
| Results |
|---|
|
|
|---|
Previous work showed that the specific p38 MAPK inhibitor SB203580
shuts down IL-1, TNF-
, and IL-6 protein synthesis both in vivo and
in a number of cell lines (20, 37). To determine whether this drug also
inhibited IL-1ß protein in the murine RAW264.7 and J774 monocytic
cell lines, levels of intracellular Il-1ß protein were determined
after LPS stimulation in the presence and absence of SB203580. As seen
in Fig. 1
, the drug inhibited IL-1ß
protein in a dose-dependent manner in RAW264.7 cells, as measured by
ELISA and Western blot analysis. IL-1ß protein was also inhibited in
the J774 cells (data not shown). Because very little of this cytokine
was released into the medium after LPS stimulation, only
intracellular IL-1ß was measured in these experiments.
|
In several studies where SB203580 inhibited IL-1 protein
synthesis, steady state IL-1 mRNA levels were not altered from the
LPS-stimulated controls (23, 24). To determine whether this was also
the case in RAW264.7 and J774 monocytic cell lines, steady state levels
of IL-1ß mRNA were measured after LPS stimulation in the presence and
absence of SB203580. Surprisingly, we found that the steady state
levels of IL-1ß mRNA transcripts, in the presence of SB203580, were
suppressed in a dose-dependent fashion in both RAW264.7 and J774 cell
lines after LPS induction (Fig. 2
,
A and B).
|
Because most data indicated that p38 MAPK regulated cytokine
expression at the posttranscriptional level, we wanted to establish at
what level SB203580 suppressed IL-1ß mRNA in RAW264.7 cells. To
determine whether SB203580 affects transcriptional activation, NRO
analysis was performed in RAW264.7 cells after LPS stimulation in the
presence or absence of SB203580. The NRO assay was performed 4 h
after LPS addition, as we had previously shown that transcription is
most active at this time point (25). As seen in Fig. 3
, IL-1ß transcription was not
detectable in the absence of LPS, but was readily detectable by the 4-h
time point. In the presence of SB203580, induction of IL-1ß RNA, was
inhibited in a dose-dependent manner. The specificity of these results
is noted by the absence of a signal by the immobilized empty Bluescript
vector, and the strong, unaltered TNF-
signals in both the presence
and absence of SB203580.
|
Because we had never directly measured p38 MAPK activity in
RAW264.7 cells, cultures were stimulated with LPS, and p38 MAPK assays
were performed at 0, 0.5, 1, and 3 h thereafter (Fig. 4
A). Little kinase activity
was detected in the absence of LPS, maximal activity was observed at 30
min and, although it had significantly declined, sustained activity was
still evident 3 h after LPS addition. In the presence of SB203580,
the activation of p38 was not blocked in the cells as measured by its
kinase activity in cell extracts (Fig. 4
B). In fact, the
kinase activity was enhanced in these cell extracts. A possible
interpretation is that the intracellular interaction of the drug with
the catalytic domain of p38 may render the kinase more accessible as a
target substrate in stimulated cells and results in more activated p38
molecules. Intracellular inhibition of p38 MAPK activity by SB203580
was measured indirectly as seen in the dose-dependent inhibition of
MAPKAP2 kinase activity (Fig. 4
C), a kinase known to be
activated by the p38 MAPK (38, 39). These results are consistent with
other reports that demonstrated that SB203580 does not block the
activation but, rather, inhibits the kinase activity of p38 MAPK (40).
|
We have previously shown that both proximal and distal
C/EBPß/NFIL-6 elements play an important role in IL-1ß
transcription (26, 28). To test whether p38 MAPK regulates the
C/EBPß/NFIL-6 transcription factor(s), trimerized C/EBPß/NFIL-6
promoter elements ligated upstream of the -50 +I CAT reporter were
transiently transfected into RAW264.7 cells, followed by LPS
stimulation in the presence or absence of SB203580. As seen in Fig. 5
, SB203580 markedly inhibited
LPS-stimulated CAT activity under the major control of C/EBPß/NFIL-6
elements. In contrast, the drug did not inhibit to the same extent LPS
stimulated CAT activity under the control of trimerized NF-
B
elements, also known to play an important role in the initiation of
IL-1ß transcription (41). The partial inhibition of the NF-
B
construct seen at the higher concentrations of SB203580 is likely due
to elements within the minimal promoter -50 +I region, which we have
found sensitive to this drug (data not shown). This is further
supported by the inability of 15 µM SB203580 to alter LPS-induced
binding of the NF-
B factor to its cognate element (Fig. 5
B), as measured by EMSA. Similar EMSA experiments could not
be performed with NFIL-6 oligonucleotides because LPS stimulation does
not alter C/EBPß or
/NFIL-6 binding to its regulatory site (see
Discussion, and Refs. 26 and 28).
|
| Discussion |
|---|
|
|
|---|
transcription factors. The evidence to support this is: 1) the
specific p38 kinase inhibitor SB203580 reduced steady state IL-1ß
mRNA levels and inhibited IL-1b mRNA transcription as measured by NRO
analysis, and 2) the p38 MAPK inhibitor SB203580 blocks
C/EBPß/
-driven CAT expression in transiently transfected RAW264.7
cells, presumably by blocking the activation of the
C/EBPß/
/transcription factors.
In marked contrast to published reports (23, 24), we noted that
SB203580 suppressed IL-1ß mRNA steady state levels. Because the
Northern blot analysis did not address the possibility that the loss of
mRNA might be due to posttranscriptional destabilization mechanisms, we
performed NRO analysis to directly examine the effect of SB203580 on
transcriptional activity. The results showed that the drug was
responsible for a >75% loss in transcription activity and, therefore,
accounts for the majority of mRNA loss seen in our experiments. These
results do not rule out the activation of RNA destabilization as
additional regulatory mechanisms, but, if they are indeed activated,
they do not appear to be the major factor in the disappearance of the
IL-1ß message. Although our results in RAW264.7 and J774 cells are
unlike other reports, we found in preliminary studies that SB203580,
similar to other studies (23, 24), did not alter IL-1ß mRNA levels
(data not shown) in the murine ANA-1 macrophage cell line (43). This
would indicate that the p38 MAPK affects gene expression at different
levels in a cell/tissue-dependent manner. In addition, our results
point out that the role of p38 MAPK in the synthesis of cytokines
varies depending on the nature of the examined cytokine. This is
evident from the NRO data (Fig. 3
), wherein, in sharp contrast to
IL-1ß, SB203580 did not inhibit TNF-
expression at the
transcription level. This data is consistent with other reports that
indicated the control of TNF by p38 MAPK is at the level of translation
(23, 24). Thus, the control of cytokine synthesis by p38 MAPK can
function at different levels, even within the same cell.
Previous work has shown that C/EBP elements and their cognate
transcription factors C/EBPß and C/EBP
play an important role in
the transcription of the IL-1ß gene (26, 28, 44, 45). The data from
both the human and murine genes indicate that both the proximal and
distal sites are necessary but not sufficient for LPS-induced
transcription. EMSA studies using specific Abs indicated that both
C/EBPß and C/EBP
transcription factors bound to both proximal and
distal C/EBP regulatory elements. Although LPS stimulation was required
for C/EBP-driven transcription, EMSA studies showed no differences in
the retarded complexes generated from nuclear extracts before or after
LPS stimulation. This data suggested that LPS-induced activation of
IL-1ß transcription results from a posttranslational modification,
such as phosphorylation, of DNA-bound C/EBPß/
. Although the
present study did not examine the intracellular phosphorylation status
of C/EBPß or -
, it is very likely that both factors were
phosphorylated either directly or indirectly by the p38 MAPK after LPS
stimulation. This statement is based on several reports that
demonstrated the importance of phosphorylation of C/EBP family members
in the regulation of gene expression (31, 46, 47, 48). More importantly, a
recent report showed that a C/EBP family member, CHOP, was
phosphorylated in vivo by the p38 MAPK, resulting in an enhanced
ability to function as a transcriptional activator (32). Present
studies are underway in this system to investigate whether C/EBPß
and/or -
is phosphorylated directly or indirectly by the p38 MAPK in
vivo.
We and others have shown that a number of elements and their respective
factors, both in the mouse and human, contribute to the regulation of
IL-1ß transcription. These include such factors as C/EBPß (26, 28, 44, 45), C/EBP
(26, 28), UNF1 (27), PU.1 (49), NF-
B (50), and the
cAMP response element/ATF (51), all of which appear necessary but not
sufficient to promote transcription. The complexity of the promoter is
not surprising given the numerous stimuli that affect IL-1ß
transcription and the central role that this cytokine plays in
modulating inflammation. Despite its key role in inflammation,
virtually nothing is known regarding the transduction pathways that
affect the regulation of IL-1ß transcription. A number of kinases are
known to be activated in macrophages after LPS stimulation (52), but
little is known regarding their connection to IL-1ß transcription.
One report has described a role for LPS-stimulated casein kinase II (CK
II) in the phosphorylation of the ets transcription factor, PU.1, which
results in its enhanced capacity to activate transcription of the
IL-1ß gene (53). Our studies now describe a second kinase, critical
to IL-1ß transcription, and likely to be functioning immediately
upstream of the nuclear factors C/EBPß and C/EBP
. Because LPS
stimulation does not alter the amount of C/EBPß/
or PU.1 bound to
DNA (26, 28, 49), it appears that phosphorylation is a necessary
modification for their functional roles as transcriptional activators.
Further, this opens the possibility that phosphorylation of the C/EBP
and PU.1 proteins result in the formation of heterodimers that activate
transcription in a synergistic fashion (53). Whether this occurs in
vivo, or that p38 MAPK or CK II interact with other factors important
to IL-1ß transcription (NF-
B, ATF, or UNF1) remains to be
determined.
Our results that pMAPK functions directly or indirectly through
C/EBPß and C/EBP
transcription factors, together with the report
that CK II interacts with the PU.1 ets factor (53), indicate that at
least two divergent signal pathways operate on the IL-1ß promoter.
Activation of monocytes by LPS induces a number of different second
messenger pathways, including the stress-activated transduction pathway
which includes the MAPKs. Three major enzymes make up the terminal
kinases of the MAPK transduction pathway and include the extracellular
signal-related kinase, p38, and c-Jun N-terminal kinase (JNK). They are
all known to directly or indirectly interact with nuclear transcription
factors (54) to modify transcription of their target genes. There is
evidence that CK II is activated through JNK MAPK, and, in turn, CK II
phosphorylates PU.1, a necessary component for LPS-induced IL-1ß
transcription. Thus, the two divergent kinase pathways, p38 and JNK,
influence the IL-1ß promoter at the level of the C/EBPß/
and
PU.1 transcription factors, both necessary but not sufficient for
IL-1ß transcription. Future studies are needed to identify the
important kinases upstream of the p38 and JNK kinases, as well as the
transducing molecules that interact with the NF-
B, UNF1, and
cAMP-dependent factors that are also important in IL-1ß
transcription.
In summary, we have described the importance of the p38 MAPK in LPS-induced IL-1ß transcription in some murine monocytic cell lines. Our results that showed that the bicyclic imidazole inhibited transcription of the IL-1ß gene need not always be the case. We mentioned earlier that SB203580 did not inhibit LPS-stimulated IL-1ß message in the ANA-1 cell line. These results serve to point out that the role of the p38 MAPK probably differs in tissues of different origin and/or differentiation states. In some tissues, the target of the kinase will be at the translation level as proposed (23, 24), while in others, the p38 MAPK will interact at the transcription level. These differences do not appear to be the case for the TNF cytokine as our data appear consistent with the reports of others.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Clifford J. Bellone, St. Louis University School of Medicine, Department of Molecular Microbiology and Immunology, 1402 South Grand Boulevard, St. Louis, MO 63104. E-mail address: ![]()
3 Abbreviations used in this paper: C/EBP, CCAAT/enhancer binding protein; CAT, chloramphenicol acetyltransferase; ATF, activating transcription factor; NRO, nuclear run-off; CK II, casein kinase II. ![]()
Received for publication July 24, 1998. Accepted for publication February 16, 1999.
| References |
|---|
|
|
|---|
. J. Inflamm. 45:97.[Medline]
and IL-1 ß expression in murine macrophages by lipopolysaccharide. Cytokine 5:327.[Medline]
and their activation by phosphorylation. Mol. Cell. Biol. 14:4324.
B site in the human interleukin 1 ß promoter: evidence for a positive autoregulatory loop. Mol. Cell. Biol. 13:6231.
B site in the human interleukin-1 ß promoter: evidence for a positive autoregulatory loop. Mol. Cell. Biol. 13:6231.
This article has been cited by other articles:
![]() |
C.-B. Xu, J.-P. Zheng, W. Zhang, Y. Zhang, and L. Edvinsson Lipid-Soluble Smoke Particles Upregulate Vascular Smooth Muscle ETB Receptors via Activation of Mitogen-Activating Protein Kinases and NF-kappaB Pathways Toxicol. Sci., December 1, 2008; 106(2): 546 - 555. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zhang, S. Saccani, H. Shin, and B. S. Nikolajczyk Dynamic Protein Associations Define Two Phases of IL-1{beta} Transcriptional Activation J. Immunol., July 1, 2008; 181(1): 503 - 512. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. J. Kang, J. Chen, M. Otsuka, J. Mols, S. Ren, Y. Wang, and J. Han Macrophage Deletion of p38{alpha} Partially Impairs Lipopolysaccharide-Induced Cellular Activation J. Immunol., April 1, 2008; 180(7): 5075 - 5082. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Thalhamer, M. A. McGrath, and M. M. Harnett MAPKs and their relevance to arthritis and inflammation Rheumatology, April 1, 2008; 47(4): 409 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Salojin and T. Oravecz Regulation of innate immunity by MAPK dual-specificity phosphatases: knockout models reveal new tricks of old genes J. Leukoc. Biol., April 1, 2007; 81(4): 860 - 869. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kim, C.-D. Jun, K. Suk, B.-J. Choi, H. Lim, S. Park, S. H. Lee, H.-Y. Shin, D.-K. Kim, and T.-Y. Shin Gallic Acid Inhibits Histamine Release and Pro-inflammatory Cytokine Production in Mast Cells Toxicol. Sci., May 1, 2006; 91(1): 123 - 131. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Liang, Y. Zhang, D. McDevit, S. Marecki, and B. S. Nikolajczyk The Interleukin-1beta Gene Is Transcribed from a Poised Promoter Architecture in Monocytes J. Biol. Chem., April 7, 2006; 281(14): 9227 - 9237. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Inoue, D. L. Boyle, M. Corr, D. Hammaker, R. J. Davis, R. A. Flavell, and G. S. Firestein Mitogen-activated protein kinase kinase 3 is a pivotal pathway regulating p38 activation in inflammatory arthritis PNAS, April 4, 2006; 103(14): 5484 - 5489. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-Y. Yeh, J.-Y. Chen, and J.-S. Chia Glucosyltransferases of Viridans Group Streptococci Modulate Interleukin-6 and Adhesion Molecule Expression in Endothelial Cells and Augment Monocytic Cell Adherence Infect. Immun., February 1, 2006; 74(2): 1273 - 1283. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. V. Salojin, I. B. Owusu, K. A. Millerchip, M. Potter, K. A. Platt, and T. Oravecz Essential Role of MAPK Phosphatase-1 in the Negative Control of Innate Immune Responses J. Immunol., February 1, 2006; 176(3): 1899 - 1907. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Hayer, G. Steiner, B. Gortz, E. Reiter, M. Tohidast-Akrad, M. Amling, O. Hoffmann, K. Redlich, J. Zwerina, K. Skriner, et al. CD44 is a determinant of inflammatory bone loss J. Exp. Med., March 21, 2005; 201(6): 903 - 914. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.-H. Kim, C.-H. Choi, S.-Y. Kim, J.-S. Eun, and T.-Y. Shin Anti-Allergic Effects of Artemisia iwayomogi on Mast Cell-Mediated Allergy Model Experimental Biology and Medicine, January 1, 2005; 230(1): 82 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. G. Shepherd, Q. Zhao, S. E. Welty, T. N. Hansen, C. V. Smith, and Y. Liu The Function of Mitogen-activated Protein Kinase Phosphatase-1 in Peptidoglycan-stimulated Macrophages J. Biol. Chem., December 24, 2004; 279(52): 54023 - 54031. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Campbell, C. J. Ciesielski, A. E. Hunt, N. J. Horwood, J. T. Beech, L. A. Hayes, A. Denys, M. Feldmann, F. M. Brennan, and B. M. J. Foxwell A Novel Mechanism for TNF-{alpha} Regulation by p38 MAPK: Involvement of NF-{kappa}B with Implications for Therapy in Rheumatoid Arthritis J. Immunol., December 1, 2004; 173(11): 6928 - 6937. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Weber, K. T. Chambers, K. G. Bensch, A. L. Scarim, and J. A. Corbett PPAR{gamma} ligands induce ER stress in pancreatic {beta}-cells: ER stress activation results in attenuation of cytokine signaling Am J Physiol Endocrinol Metab, December 1, 2004; 287(6): E1171 - E1177. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Tanaka, T. Morita, A. Nezu, A. Tanimura, I. Mizoguchi, and Y. Tojyo Signaling Mechanisms Involved in Protease-Activated Receptor-1-Mediated Interleukin-6 Production by Human Gingival Fibroblasts J. Pharmacol. Exp. Ther., November 1, 2004; 311(2): 778 - 786. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Brooks, J. E. Connolly, and W. F. C. Rigby The Role of mRNA Turnover in the Regulation of Tristetraprolin Expression: Evidence for an Extracellular Signal-Regulated Kinase-Specific, AU-Rich Element-Dependent, Autoregulatory Pathway J. Immunol., June 15, 2004; 172(12): 7263 - 7271. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Godambe, K. M. Knapp, E. A. Meals, and B. K. English Role of vav1 in the Lipopolysaccharide-Mediated Upregulation of Inducible Nitric Oxide Synthase Production and Nuclear Factor for Interleukin-6 Expression Activity in Murine Macrophages Clin. Vaccine Immunol., May 1, 2004; 11(3): 525 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Kelicen and N. Tindberg Lipopolysaccharide Induces CYP2E1 in Astrocytes through MAP Kinase Kinase-3 and C/EBP{beta} and -{delta} J. Biol. Chem., April 16, 2004; 279(16): 15734 - 15742. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Weber, A. L. Scarim, and J. A. Corbett PPAR{gamma} is not required for the inhibitory actions of PGJ2 on cytokine signaling in pancreatic {beta}-cells Am J Physiol Endocrinol Metab, March 1, 2004; 286(3): E329 - E336. [Abstract] [Full Text] |
||||
![]() |
X. Li, N. Udagawa, M. Takami, N. Sato, Y. Kobayashi, and N. Takahashi p38 Mitogen-Activated Protein Kinase Is Crucially Involved in Osteoclast Differentiation But Not in Cytokine Production, Phagocytosis, or Dendritic Cell Differentiation of Bone Marrow Macrophages Endocrinology, November 1, 2003; 144(11): 4999 - 5005. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y.-W. Liu, H.-P. Tseng, L.-C. Chen, B.-K. Chen, and W.-C. Chang Functional Cooperation of Simian Virus 40 Promoter Factor 1 and CCAAT/Enhancer-Binding Protein {beta} and {delta} in Lipopolysaccharide-Induced Gene Activation of IL-10 in Mouse Macrophages J. Immunol., July 15, 2003; 171(2): 821 - 828. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Guo, R. E. Gerl, and J. W. Schrader Defining the Involvement of p38{alpha} MAPK in the Production of Anti- and Proinflammatory Cytokines Using an SB 203580-resistant Form of the Kinase J. Biol. Chem., June 13, 2003; 278(25): 22237 - 22242. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Maggi Jr., J. M. Moran, R. M. L. Buller, and J. A. Corbett ERK Activation Is Required for Double-stranded RNA- and Virus-induced Interleukin-1 Expression by Macrophages J. Biol. Chem., May 2, 2003; 278(19): 16683 - 16689. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Ronni, V. Agarwal, M. Haykinson, M. E. Haberland, G. Cheng, and S. T. Smale Common Interaction Surfaces of the Toll-Like Receptor 4 Cytoplasmic Domain Stimulate Multiple Nuclear Targets Mol. Cell. Biol., April 1, 2003; 23(7): 2543 - 2555. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Parasrampuria, P. de Boer, D. Desai-Krieger, A. T. Chow, and C. R. Jones Single-Dose Pharmacokinetics and Pharmacodynamics of RWJ 67657, a Specific p38 Mitogen-Activated Protein Kinase Inhibitor: A First-in-Human Study J. Clin. Pharmacol., April 1, 2003; 43(4): 406 - 413. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Maggi Jr., J. M. Moran, A. L. Scarim, D. A. Ford, J.-W. Yoon, J. McHowat, R. M. L. Buller, and J. A. Corbett Novel Role for Calcium-independent Phospholipase A2 in the Macrophage Antiviral Response of Inducible Nitric-oxide Synthase Expression J. Biol. Chem., October 4, 2002; 277(41): 38449 - 38455. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. MacKenzie, N. Fernandez-Troy, and E. Espel Post-transcriptional regulation of TNF-{alpha} during in vitro differentiation of human monocytes/macrophages in primary culture J. Leukoc. Biol., June 1, 2002; 71(6): 1026 - 1032. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. N. Finck and R. W. Johnson Anti-inflammatory agents inhibit the induction of leptin by tumor necrosis factor-alpha Am J Physiol Regulatory Integrative Comp Physiol, May 1, 2002; 282(5): R1429 - R1435. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Lehner, F. Schwoebel, A. Kotlyarov, M. Leist, M. Gaestel, and T. Hartung Mitogen-Activated Protein Kinase-Activated Protein Kinase 2-Deficient Mice Show Increased Susceptibility to Listeria monocytogenes Infection J. Immunol., May 1, 2002; 168(9): 4667 - 4673. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Q. Xiao, K. Malcolm, G. S. Worthen, S. Gardai, W. P. Schiemann, V. A. Fadok, D. L. Bratton, and P. M. Henson Cross-talk between ERK and p38 MAPK Mediates Selective Suppression of Pro-inflammatory Cytokines by Transforming Growth Factor-beta J. Biol. Chem., April 19, 2002; 277(17): 14884 - 14893. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Pfeilschifter, R. Koditz, M. Pfohl, and H. Schatz Changes in Proinflammatory Cytokine Activity after Menopause Endocr. Rev., February 1, 2002; 23(1): 90 - 119. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.J. Webb, J.R. McPherson, K. Pahan, and S. Koka Regulation of TNF-{alpha}-induced IL-6 Production in MG-63 Human Osteoblast-like Cells Journal of Dental Research, January 1, 2002; 81(1): 17 - 22. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Shimomura, M. Matsuura, S. Saito, Y. Hirai, Y. Isshiki, and K. Kawahara Lipopolysaccharide of Burkholderia cepacia and Its Unique Character To Stimulate Murine Macrophages with Relative Lack of Interleukin-1{beta}-Inducing Ability Infect. Immun., June 1, 2001; 69(6): 3663 - 3669. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-F. Arrighi, M. Rebsamen, F. Rousset, V. Kindler, and C. Hauser A Critical Role for p38 Mitogen-Activated Protein Kinase in the Maturation of Human Blood-Derived Dendritic Cells Induced by Lipopolysaccharide, TNF-{{alpha}}, and Contact Sensitizers J. Immunol., March 15, 2001; 166(6): 3837 - 3845. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schmidt, E. Caron, and A. Hall Lipopolysaccharide-Induced Activation of {beta}2-Integrin Function in Macrophages Requires Irak Kinase Activity, p38 Mitogen- Activated Protein Kinase, and the Rap1 GTPase Mol. Cell. Biol., January 15, 2001; 21(2): 438 - 448. [Abstract] [Full Text] |
||||
![]() |
B. van den Blink, N. P. Juffermans, T. ten Hove, M. J. Schultz, S. J. H. van Deventer, T. van der Poll, and M. P. Peppelenbosch p38 Mitogen-Activated Protein Kinase Inhibition Increases Cytokine Release by Macrophages In Vitro and During Infection In Vivo J. Immunol., January 1, 2001; 166(1): 582 - 587. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ohashi, A. Matsumori, Y. Furukawa, K. Ono, M. Okada, A. Iwasaki, T. Miyamoto, A. Nakano, and S. Sasayama Role of p38 Mitogen-Activated Protein Kinase in Neointimal Hyperplasia After Vascular Injury Arterioscler. Thromb. Vasc. Biol., December 1, 2000; 20(12): 2521 - 2526. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. Lakics, A. E. Medvedev, S. Okada, and S. N. Vogel Inhibition of LPS-induced Cytokines by Bcl-xL in a Murine Macrophage Cell Line J. Immunol., September 1, 2000; 165(5): 2729 - 2737. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Y. Tsai, J. V. Falvo, A. V. Tsytsykova, A. K. Barczak, A. M. Reimold, L. H. Glimcher, M. J. Fenton, D. C. Gordon, I. F. Dunn, and A. E. Goldfeld A Lipopolysaccharide-Specific Enhancer Complex Involving Ets, Elk-1, Sp1, and CREB Binding Protein and p300 Is Recruited to the Tumor Necrosis Factor Alpha Promoter In Vivo Mol. Cell. Biol., August 15, 2000; 20(16): 6084 - 6094. [Abstract] [Full Text] |
||||
![]() |
Y. J. Jeon, Y. K. Kim, M. Lee, S. M. Park, S. B. Han, and H. M. Kim Radicicol Suppresses Expression of Inducible Nitric-Oxide Synthase by Blocking p38 Kinase and Nuclear Factor-kappa B/Rel in Lipopolysaccharide-Stimulated Macrophages J. Pharmacol. Exp. Ther., August 1, 2000; 294(2): 548 - 554. [Abstract] [Full Text] |
||||
![]() |
W. Zhu, J. S. Downey, J. Gu, F. Di Padova, H. Gram, and J. Han Regulation of TNF Expression by Multiple Mitogen-Activated Protein Kinase Pathways J. Immunol., June 15, 2000; 164(12): 6349 - 6358. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Rezzonico, R. Chicheportiche, V. Imbert, and J.-M. Dayer Engagement of CD11b and CD11c beta 2 integrin by antibodies or soluble CD23 induces IL-1beta production on primary human monocytes through mitogen-activated protein kinase-dependent pathways Blood, June 15, 2000; 95(12): 3868 - 3877. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. M. Ndengele, C. J. Bellone, A. J. Lechner, and G. M. Matuschak Brief hypoxia differentially regulates LPS-induced IL-1beta and TNF-alpha gene transcription in RAW 264.7 cells Am J Physiol Lung Cell Mol Physiol, June 1, 2000; 278(6): L1289 - L1296. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. K. Harris, C. M. Coticchia, B. L. Kagan, S. Ahmad, A. Wellstein, and A. T. Riegel Induction of the Angiogenic Modulator Fibroblast Growth Factor-binding Protein by Epidermal Growth Factor Is Mediated through Both MEK/ERK and p38 Signal Transduction Pathways J. Biol. Chem., April 6, 2000; 275(15): 10802 - 10811. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. T. Akama and L. J. Van Eldik beta -Amyloid Stimulation of Inducible Nitric-oxide Synthase in Astrocytes Is Interleukin-1beta - and Tumor Necrosis Factor-alpha (TNFalpha )-dependent, and Involves a TNFalpha Receptor-associated Factor- and NFkappa B-inducing Kinase-dependent Signaling Mechanism J. Biol. Chem., March 10, 2000; 275(11): 7918 - 7924. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Iordanov, J. M. Paranjape, A. Zhou, J. Wong, B. R. G. Williams, E. F. Meurs, R. H. Silverman, and B. E. Magun Activation of p38 Mitogen-Activated Protein Kinase and c-Jun NH2-Terminal Kinase by Double-Stranded RNA and Encephalomyocarditis Virus: Involvement of RNase L, Protein Kinase R, and Alternative Pathways Mol. Cell. Biol., January 15, 2000; 20(2): 617 - 627. [Abstract] [Full Text] |
||||
![]() |
E. Cario, I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H.-C. Reinecker, and D. K. Podolsky Lipopolysaccharide Activates Distinct Signaling Pathways in Intestinal Epithelial Cell Lines Expressing Toll-Like Receptors J. Immunol., January 15, 2000; 164(2): 966 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. Wadsworth, D. E. Cavender, S. A. Beers, P. Lalan, P. H. Schafer, E. A. Malloy, W. Wu, B. Fahmy, G. C. Olini, J. E. Davis, et al. RWJ 67657, a Potent, Orally Active Inhibitor of p38 Mitogen-Activated Protein Kinase J. Pharmacol. Exp. Ther., November 1, 1999; 291(2): 680 - 687. [Abstract] [Full Text] |
||||
![]() |
K. Rutault, C. A. Hazzalin, and L. C. Mahadevan Combinations of ERK and p38 MAPK Inhibitors Ablate Tumor Necrosis Factor-alpha (TNF-alpha ) mRNA Induction. EVIDENCE FOR SELECTIVE DESTABILIZATION OF TNF-alpha TRANSCRIPTS J. Biol. Chem., February 23, 2001; 276(9): 6666 - 6674. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Cattaruzza, I. Eberhardt, and M. Hecker Mechanosensitive Transcription Factors Involved in Endothelin B Receptor Expression J. Biol. Chem., September 28, 2001; 276(40): 36999 - 37003. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |