The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zegarra-Moran, O.
Right arrow Articles by Galietta, L. J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zegarra-Moran, O.
Right arrow Articles by Galietta, L. J. V.
The Journal of Immunology, 1999, 162: 5359-5366.
Copyright © 1999 by The American Association of Immunologists

HIV-1 Nef Expression Inhibits the Activity of a Ca2+-Dependent K+ Channel Involved in the Control of the Resting Potential in CEM Lymphocytes

Olga Zegarra-Moran1,2,*, Andrea Rasola1,{dagger}, Michela Rugolo{ddagger}, Anna M. Porcelli{ddagger}, Bernard Rossi{dagger} and Luis J. V. Galietta*

* Laboratorio di Genetica Molecolare, Istituto Giannina Gaslini, Genova, Italy; {dagger} Unité de Recherches en Immunologie Cellulaire et Moléculaire, Institut National de la Santé et de la Recherche Médicale, Unit 364, Nice, France; and {ddagger} Laboratorio di Biochimica, Dipartimento di Biologia, Università di Bologna, Bologna, Italy


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The HIV-1 Nef protein plays an important role in the development of the pathology associated with AIDS. Despite various studies that have dealt with different aspects of Nef function, the complete mechanism by which it alters the physiology of infected cells remains to be established. Nef can associate with cell membranes, therefore supporting the hypothesis that it might interact with membrane proteins as ionic channels and modify their electrical properties. By using the patch-clamp technique, we found that Nef expression determines a 25-mV depolarization of lymphoblastoid CEM cells. Both charybdotoxin (CTX) and the membrane-permeable Ca2+ chelator BAPTA/AM depolarized the membrane of native cells without modifying that of Nef-transfected cells. These data suggested that the resting potential in native CEM cells is settled by a CTX- and Ca2+-sensitive K+ channel (KCa,CTX), whose activity is absent in Nef-expressing cells. This was confirmed by direct measurements of whole-cell KCa,CTX currents. Single-channel recordings on excised patches showed that a KCa,CTX channel of 35 pS with a half-activation near 400 nM Ca2+ was present in both native and Nef-transfected cells. The measurements of free intracellular Ca2+ were not different in the two cell lines, but Nef-transfected cells displayed an increased Ca2+ content in ionomycin-sensitive stores. Taken together, these results indicate that Nef expression alters the resting membrane potential of the T lymphocyte cell line by inhibiting a KCa,CTX channel, possibly by intervening in the regulation of intracellular Ca2+ homeostasis.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The HIV-1 protein Nef is a key regulator in the development of the pathology associated with AIDS (1, 2). This protein is synthesized in every stage of viral cycle, and in the host cell it is associated with cellular membranes through an N-terminal myristoylation. Nef promotes high titer viral replication in vivo (3), and deletion of the nef gene has been found in HIV-infected, long term nonprogressing individuals (4). At the molecular level, various functions have been assigned to Nef. It down-regulates both the surface expression of CD4, the primary receptor for HIV-1 in T lymphocytes (5), and MHC class I molecules, albeit with somewhat lower efficiency (6). Nef also enhances viral infectivity during the process of virion assembly (7, 8). In terms of signaling, it interferes with transduction pathways by interacting with various cellular proteins. Indeed, Nef can associate with Src-like kinases (9, 10), changing their activity (11, 12), but it can also alter transcription factor activation (13, 14). Although various studies have described some aspects of Nef function, the mechanism(s) by which Nef subverts the normal function of infected cells remains elusive.

T lymphocytes are the major target for HIV-1. It has been proposed that Nef could alter some activation pathway of these cells (15, 16, 17), which largely depend in their early steps on Ca2+ influx (18). The control of membrane potential is an important process in the biology of T lymphocytes. Indeed, the electrical properties of the cell membrane are essential for T lymphocyte activation. The driving force that modulates Ca2+ entry is under the control of membrane potential, finely tuned by Cl- and K+ conductances (19, 20), and recent data indicate that the use of specific blockers of K+ channels inhibits some lymphocyte activation cascades (21, 22).

In this context we sought to determine whether Nef might alter ion channel activity and consequently the membrane potential of T lymphocytes. To test this hypothesis we have studied the electrophysiological properties of the CD4+ lymphoblastoid cell line CEM and compared them with those of Nef-transfected CEM cells. We found that the expression of Nef elicits a 25-mV depolarization of CEM cells and that this depolarization is due to the lack of activity, in the resting state, of a charybdotoxin-sensitive Ca2+-activated K+ channel of intermediate conductance. Furthermore, Nef expression was responsible for an altered Ca2+ homeostasis by enhancing Ca2+ release from internal stores.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cells

Human lymphoblastoid CEM cells were grown in suspension in RPMI 1640 culture medium supplemented with 5% Fetal Clone II (HyClone, Logan, UT) and 2 mM L-glutamine in a humidified 5% CO2 incubator at 37°C. These cells were positive for the surface markers CD4 and CD45 and were negative for the markers CD3, CD8, CD14, and CD19, as assessed by FACScan flow cytometric analysis performed with the FITC-conjugated Abs. Stable Nef-transfected CEM cells, obtained as previously described (23), were grown in the same medium and selected in the presence of G418 (1 mg/ml). Unless otherwise stated, Nef-transfected cells were from the HIV-1LAI strain. HIV-1SF2 or HIV-1A01 strains were also used. Nef expression was assessed both by RT-PCR analysis (see below) and by cytofluorometric detection of CD4 surface down-regulation. For electrophysiological experiments, 2 ml of cell suspension was centrifuged and resuspended in 1 ml of the extracellular working solution. Before each experiment 200 µl of this preparation was added to a petri dish containing 1 ml of the extracellular solution. Patch-clamp experiments started when cells attached to the petri surface (within 5–10 min).

Electrophysiological measurements

Experiments were conducted using standard whole-cell and inside-out recording methods (24). The perforated patch variant of the patch-clamp technique was used in other experiments to prevent the possible washout of essential cytoplasmic factors during whole-cell recording. In these cases the perforating agent amphotericin B was used at concentrations between 100 and 250 µg/ml. In current clamp experiments, resting potential was recorded on a chart recording. As traces showed potential fluctuations within a 20-mV range around an average, this average was considered the resting membrane potential. All experiments were performed at room temperature. Patch pipettes were fabricated from borosilicate glass capillaries on a two-step puller and fire polished. The pipette resistance was 3–4 M{Omega} for macroscopic current measurements or for current-clamp experiments and 6–10 M{Omega} for single-channel recordings. Membrane currents and zero current-clamp membrane potential were measured with an EPC-7 amplifier (List-Medical, Darmstadt, Germany) controlled by a personal computer via an AD/DA converter. Membrane currents were sampled at a bandwidth of 2 kHz and low pass filtered with a four-pole Bessel filter (4302, Ithaca, NY) set at a cut-off frequency of 1 kHz. Capacitative current was removed by analogue compensation.

Solutions

For whole-cell and most perforated patch experiments the composition of the external solution was 130 mM NaCl, 2 mM KCl, 1 mM KH2PO4, 2 mM CaCl2, 2 mM MgCl2, 10 mM sodium-HEPES, 10 mM glucose, and 20 mM mannitol. The intracellular solution was 140 mM KCl, 1 mM MgCl2, 0.18 mM CaCl2, 2 mM EGTA, 10 mM potassium-HEPES, and 20 mM mannitol. For inside-out experiments and for ramps in perforated patch experiments, the extracellular solution was 160 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 10 mM potassium-HEPES. The composition of the internal solution in these experiments was 160 mM KCl, 1 mM MgCl2, 5 mM potassium-HEPES, 0.5 mM EGTA, and 0.297, 0.373, 0.427, 0.440, or 0.461 mM CaCl2. The CaCl2 concentrations were selected (using the Patcher’s Power Tools program developed by Francisco Mendez, Max Planck Institut for Biophysical Chemistry, Göttingen, Germany) to obtain free Ca2+ concentrations of 100, 200, 400, 500, and 800 nM, respectively. Unless otherwise stated, the pH was always 7.3. Each time that charybdotoxin was used, 30 µg/ml of BSA was included in the working solution to avoid adsorption of the toxin to plastic tubes and dishes.

RT-PCR

RT-PCR analysis was performed to detect the expression of HIV-Nef RNA and of the Ca2+-dependent K+ channel hKCa4/hIK1/hSK4 (25, 26, 27) on the cell line studied. Total RNA was extracted from 107 cells with the guanidine thiocyanate method (28). The RT reaction was performed on 2 µg of total RNAs using the cDNA Synthesis System Plus Kit (Amersham, Arlington Heights, IL). PCR was conducted on a fraction of these cDNAs, in a final volume of 25 µl and with an annealing temperature of 58°C. PCR primers were: 1) HIV-Nef: forward, ATGGGTGGCAAGTGGTCAAAA; reverse, TCAGCAGTTCTTGTAGTACTC; and 2) hKCa4/hIK1/hSK4: forward, CACACTTTGGCTGATCCCC; reverse, GTGTTTCAGCCGCACCTGG. The expected amplification products were of 620 and 358 bp, respectively.

Determination of free cytosolic Ca2+ concentration and intracellular pH

Cells (4 x 106/ml) were incubated at 37°C for 30 min with 4 µM fura-2/AM in RPMI 1640 medium (pH 7.35) supplemented with 2 mg/ml BSA and 0.2 mM sulfinpyrazone. Cells were then washed with the same medium in the absence of fura-2/AM and kept in the dark until use. Aliquots (3 x 105 cells) were incubated in Krebs-Ringer saline solution containing 125 mM NaCl, 5 mM KCl, 1 mM MgSO4, 1 mM KH2PO4, 5.5 mM D-glucose, 20 mM sodium-HEPES, 0.2 mM sulfinpyrazone, and 1 mg/ml BSA (pH 7.4). Fura-2 fluorescence was measured at 37°C in a Jasko IP-770 Spectrofluorometer (Tokyo, Japan), with excitation and emission wavelengths set at 340 and 380 nm, respectively. The intracellular Ca2+ concentration ([Ca2+]i)3 was determined after cell lysis with 0.1% Triton X-100 as described by Thomas and Delaville (29).

Intracellular pH (pHi) was determined in cells loaded with 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein tetraacetoxymethylester (BCECF/AM). Cells (4 x 106/ml) were incubated in RPMI 1640 medium containing 4 µM BCECF/AM for 30 min in a CO2 incubator. Cells were then washed twice, resuspended in RPMI 1640 medium, and maintained in the dark until use. BCECF fluorescence was measured in the cuvette compartment (37°C) of a Jasko 770 spectrofluorometer, with excitation and emission wavelengths set at 505 and 530 nm, respectively. Aliquots (3 x 105 cells) were resuspended in Krebs-Ringer saline solution containing 1 mM CaCl2. Calibration curves of pHi against fluorescence were generated by addition of 1.5 µM nigericin in a high K+ saline solution and measuring the fluorescence at known pH values. The calibration curves were linear over the pH range between 6.5 and 7.8. The intracellular buffering capacity was measured from the changes in pHi induced by NH4+ pulses (2–10 mM) and was calculated as described previously (30).

45Ca2+ release

45Ca2+ release from intracellular stores were measured following the procedure described by Fasolato et al. (31). In brief, 5 x 105 cells/ml were incubated in the culture medium with 4 µCi/ml 45Ca2+ for 24 h. Labeled cells were washed three times with nonradioactive medium maintained at 4°C. Cells were then resuspended at 37°C in a Ca2+-free saline solution containing 3 mM EGTA and quickly added with thapsigargin (200 nM) followed 5 min later by ionomycin (5 µM). Immediately before and 5 min after each addition, aliquots of 2 x 106 cells were centrifuged, and the 45Ca2+ released into the medium was estimated using a Beckman LS1800 liquid scintillator (Beckman, Palo Alto, CA). Release values are expressed as a percentage of the total cell 45Ca2+ content, normalized to the protein determined in the corresponding cell pellets.

Chemicals

Charybdotoxin (CTX), kaliotoxin (KTX), {alpha}-dendrotoxin (DTX), and the mast cell degranulating peptide (MCD) were obtained from Latoxan (Rosans, France). Apamin (Apa), 4-amino-pyridine (4-AP), BAPTA/AM, ionomycin, thapsigargin, and other chemicals were purchased from Sigma (St. Louis, MO). Fura-2/AM and BCECF/AM were obtained from Molecular Probes (Eugene, OR). 45Ca2+ was obtained from New England Nuclear-DuPont (Boston, MA).

Statistics

Data are presented as raw representative experiments or as the mean ± SEM. Student’s t test was applied where appropriate.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell resting potential measurements

After clamping to zero the current in the perforated-patch variant of the whole-cell configuration, we found that the resting potential of CEM cells transfected with three different Nef strains was about 25 mV more depolarized than that of native CEM cells. As shown in Fig. 1GoA, the resting potential of CEM cells (VCEM) was -56.8 ± 2.6 mV (n = 19), while the resting potential of Nef-transfected CEM cells (VNef) values in cells transfected with LAI, SF2, and A01 strains were, respectively, -32.7 ± 1.8 mV (n = 7), -31.4 ± 3.4 mV (n = 7), and -31.6 ± 4.6 mV (n = 6). No difference was found in conventional whole-cell (VCEM = -32.4 ± 2.9 mV (n = 12); VNef = -39 ± 3 mV (n = 11); not shown), and in consequence the membrane potential was always determined in perforated-patch experiments. K+ channels have an important role in settling the resting potential of T lymphocytes (19, 20). To investigate whether Nef is causing a reduction of the resting potential of CEM cells by inhibiting K+ conductance, we used extracellular charybdotoxin (CTX), a good blocker of some voltage-dependent and Ca2+-dependent K+ channels in lymphocytes. We found that 50 nM CTX caused a 25-mV depolarization in native CEM cells (Fig. 1GoB) without affecting the membrane potential of Nef-transfected cells (Fig. 1GoC). Other K+ channel blockers, such as KTX, DTX, MCD, Apa, and 4-AP, had no effect on the resting potential of these cell lines (see Fig. 1Go, B and C).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 1. Resting potentials of native and Nef-transfected CEM cells. Potential measurements were obtained after clamping to zero the membrane current in the perforated-patch configuration of the patch-clamp technique. The number of experiments is specified under each column. Asterisks indicate statistically different values (p < 0.01). A, Resting membrane potential in native and Nef-transfected CEM cells. B and C, Effect of K+ channel blockers on the resting potential of native (B) and Nef-transfected (C) CEM cells. The concentrations used were 200 nM for KTX and DTX, 5 mM for 4-AP, and 50 nM for Apa, MCD, and CTX.

 
Voltage-dependent K+ current

To evaluate the hypothesis that a voltage-gated K+ channel sets the CEM resting potential, voltage-clamp experiments were conducted in the perforated-patch configuration. These experiments showed an outward current that peaked in a few milliseconds, depending on the applied potential, and then slowly inactivated (Fig. 2GoA). Recovery from inactivation was slow (not shown); thus, test pulses were separated by long periods (50 s) at a holding potential of -100 mV. The current was blocked by 50 nM CTX or 5 mM 4-AP (not shown). The activation curve (Fig. 2GoB) was fitted to a Boltzmann function of the type G/Gmax = 1/(1 + exp(-(Vm - Vh)/a), were Gmax is the maximal conductance, Vh is the half-activation potential, and a is the slope parameter. The mean values of Gmax, Vh, and a obtained from seven different experiments in native CEM cells were 4.6 ± 1.2 nS, -11.9 ± 2.9 mV, and 6.4 ± 1 mV, respectively. The mean values obtained from seven Nef-transfected CEM cells were 8.6 ± 1 nS, -7.2 ± 1.5 mV, and 6.1 ± 0.6 mV, respectively. While Vh and slope a were not statistically different, the maximal conductance of Nef-transfected cells was twice as high as that of native cells (p < 0.05), indicating a higher voltage-gated K+ current density in the transfected line (see traces in Fig. 2GoA and the current-voltage relationship in Fig. 2GoC). The difference of conductance was not due to a higher membrane surface of transfected cells, since the capacitance was not statistically different (10.2 ± 0.5 and 10.3 ± 0.5 pF for native and Nef-transfected cells, respectively).



View larger version (26K):
[in this window]
[in a new window]
 
FIGURE 2. Voltage-dependent K+ channel. A, Family of voltage-dependent K+ currents from two representative voltage-clamp experiments on a native and a Nef-transfected cell. The holding potential was -100 mV. Test pulses from -60 to +60 mV lasting 200 ms were applied every 50 s. B, Activation curves obtained from the experiments in A. Voltage error correction was applied given the under-optimal access resistance (15–20 M{Omega}) of perforated patches. The values of Gmax, Vh, and a were 4.47 nS, -7.4 mV, and 5.8 mV for the native CEM cell and 7.96 nS, -6.8 mV, and 9.1 mV for the Nef-transfected cell. C, Current-voltage relationships obtained from the means of seven different experiments performed with native ({circ}) and Nef-transfected (•) CEM cells.

 
These results argued against the hypothesis of voltage-activated K+ currents being responsible for the different resting potential of native and Nef-transfected CEM cells. This was also confirmed by the absence of effect of several selective blockers of this class of channels (KTX, DTX, MCD, and 4-AP) on the resting potential of native and Nef-transfected CEM cells (see Fig. 1Go, B and C).

Effects of the [Ca2+]i on the resting potential

Since CTX is also a good blocker of some Ca2+-dependent K+ channels, we asked whether these channels are involved in the control of CEM resting potential. We observed that when native CEM cells were incubated for 1 h with the membrane-permeable Ca2+ chelator BAPTA/AM (20 µM), their resting potential dropped to a value similar to that of untreated Nef-transfected cells (-25.8 ± 4.5 mV; n = 5). In contrast, BAPTA/AM incubation did not change the resting potential of Nef cells (Fig. 3GoA). Two types of Ca2+-activated K+ channels have been described in T lymphocytes, a small-conductance, Apa-sensitive channel and an intermediate-conductance, CTX-sensitive channel (KCa,CTX) (20). Due to the absence of effect of Apa on the resting potential and to the dramatic depolarizing effect of CTX (Fig. 1GoB), the latter type of K+ channel appeared as the best candidate to be involved in the regulation of the resting potential of native CEM cells.



View larger version (19K):
[in this window]
[in a new window]
 
FIGURE 3. Sensitivity of cell resting potential to [Ca2+]i. Resting potential measurements obtained with the perforated-patch variation of the patch-clamp technique. A, Effect of 1-h incubation with the membrane-permeable Ca2+ chelator BAPTA/AM. B, Effect of sequential addition of 1 µM ionomycin and 50 nM CTX on the resting potential of native and Nef-transfected cells. Asterisks indicate potentials that were different from the respective control condition (p < 0.005 in A and p < 0.005 in B). Numbers under columns represent the number of experiments in each condition.

 
To test the sensitivity of the KCa,CTX channel to intracellular Ca2+ increase, current-clamp experiments in the perforated-patch configuration were performed in the presence of 50 nM Apa and 5 mM 4-AP in the bath solution to block the small-conductance, Ca2+-activated K+ channel and the voltage-dependent K+ channel, respectively. The addition of 1 µM ionomycin triggered a cell hyperpolarization to -84 ± 2.3 (n = 4) and -84.8 ± 2.7 mV (n = 6) in native and Nef-transfected cells, respectively. In these conditions the application of 50 nM CTX depolarized CEM and Nef cells to -28 ± 3 and -34 ± 3 mV, respectively (n = 4; Fig. 3GoB).

Ca2+-dependent K+ current

To directly study the KCa,CTX channel, voltage-clamp experiments were performed in the perforated-patch configuration using 50 nM Apa in the bath solution. Cells were stimulated with voltage ramps from -120 to 20 mV in the presence of symmetrical K+ concentrations. Native CEM cells displayed two current components, one linear and voltage-independent and another voltage-dependent, with an activation threshold near -40 mV (Fig. 4GoA). The voltage-dependent component was completely blocked by 5 mM 4-AP (see traces in Fig. 4GoA). The linear component, instead (44.8 ± 12.5 pA/pF at -100 mV with symmetrical K+; n = 4), was reversibly blocked by CTX (see Fig. 4GoB). In contrast to native cells, Nef-transfected cells exhibited a larger, voltage-dependent component in accordance with our previous observations (see Fig. 2Go), but completely lacked the linear, CTX-sensitive component (Fig. 4GoC). Fig. 4GoD depicts the difference between the current before and after the addition of 50 nM CTX in both cell lines.



View larger version (35K):
[in this window]
[in a new window]
 
FIGURE 4. Ca-activated K+ currents. A, Representative voltage-clamp experiment performed on a native CEM cell. Voltage ramps were applied from -120 to +20 mV at 0.5 mV/ms from a holding potential of -120 mV with an interval of 3 s. Experiments were performed in the presence of symmetrical K+ concentrations (see Materials and Methods) with 50 nM apamin in the bath solution. Note that the control current has two components, one linear and voltage independent and a second voltage dependent, with an activation threshold at -40 mV. The voltage-dependent component was blocked by 5 mM 4-AP. B, Reversible block of the voltage-independent component of the current following treatment with 20 nM CTX. C, Representative experiment performed on a Nef-transfected cell using the same protocol as that in A. Note that this cell lacks the linear component, while the voltage-dependent component was larger than that of native cells. D, The plot shows the amount of current blocked by 50 nM CTX, estimated at -100 mV, for each cell line. Numbers above columns are the number of experiments. The asterisk indicates that the difference is statistically significant (p < 0.01).

 
Single-channel recordings of CTX-sensitive Ca2+-activated K+-channel

In an attempt to understand the mechanism underlying the absence of activity of the KCa,CTX channel in Nef-transfected cells, single-channel experiments were performed in the inside-out patch-clamp configuration. Interestingly, Ca2+-activated K+ channels of intermediate conductance were active in patches from both native and Nef-transfected CEM cells (Fig. 5GoA). The conductances in native and Nef-transfected CEM cells were 35.3 ± 3 pS (n = 4) and 34.2 ± 0.54 pS (n = 4; Fig. 5GoB), respectively (not statistically different). The calcium dependence of the channel was estimated by calculating the open probability at -100 mV in continuous records of at least 30 s at each [Ca2+]i. Our results showed that the calcium sensitivity was similar in both cell lines. The threshold for channel activation was near 100 nM, and the half-maximal activation occurred at 431 and 439 nM in native and Nef cells, respectively (Fig. 5GoC). The fit in both cases gave a Hill coefficient of 6, indicating highly cooperative interaction of calcium ions. In native CEM cells, a reduction of the internal (cytosolic) KCl concentration from 165 to 82.5 mM shifted the reversal potential from 0 ± 2 to 15 ± 3 mV (n = 3; see triangles in Fig. 5GoB), as expected for a K+ permeable channel (VNernst = 18.2 mV). The use of 50 nM CTX in the pipette solution in the presence of a [Ca2+]i of 500 nM reduced the open probability of the channel from 0.37 ± 0.014 (n = 4) to 0.00034 ± 0.0002 (n = 4; p < 0.005).



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. Single Ca-activated K+ channels. A, Single-channel recordings in inside-out patch configuration in the presence of symmetrical potassium (see Materials and Methods). Currents from native and Nef-transfected cells were obtained in continuous recordings at different voltages from -120 to -20 mV. B, Current-to-voltage relationship of single Ca-activated K+ channels from native ({circ}; n = 4) and Nef-transfected (•; n = 4) cells. Reduction of the internal K+ concentration from 165 to 82.5 mM causes a shift of the reversal potential from 0 to 16 mV ({triangleup}). C, Dependence of the channel open probability (Po) of native ({circ}) and Nef-transfected (•) cells on the free Ca2+ concentration at the cytosolic side of the patch. Data were fitted to a Hill equation yielding half-maximal activation at Ca2+ concentrations of 431 and 439 nM, respectively. The open probability was never >0.6. D, RT-PCR analysis of the hKCa4/hIK1/hSK4 gene expression in CEM cells. The 358-bp amplification product was observed in both wild-type CEM cells (lane Nef -) and CEM cells transfected with three different strains of the HIV-1 Nef (lanes Nef LAI, A01, and SF2). CTR, control amplification without cDNA; lane M, 100-bp DNA ladder m.w. marker.

 
The properties of this channel closely resembled those of the recently cloned intermediate-conductance, KCa,CTX channel, called hKCa4, hIK1, or hSK4 (25, 26, 27). Actually, an RT-PCR approach showed that a transcript encoding this type of channel was present in both the native and Nef-transfected CEM cells, thus suggesting that it could be responsible for the observed current (Fig. 5GoD).

Together these data ruled out the possibility of a reduced or absent expression of the KCa,CTX channel on the plasma membrane of Nef-expressing cells.

Absence of control of KCa,CTX conductance by kinases, phosphatases, or pHi

The possibility remained that Nef could functionally block or down-regulate the channel, either by direct interaction or via an action on some intracellular factors. As a first step we tested whether Nef effect could be due to a modulation through tyrosine kinases/phosphatases or to changes in pHi, which have been reported to regulate K+ channels in various cell systems (32, 33, 34, 35, 36, 37, 38). One-hour incubation with 100 µM genistein, a wide range tyrosine kinase inhibitor, did not change the resting potential of native and Nef-transfected CEM cells (-63 ± 7.5 mV (n = 3) and -36.7 ± 4.7 mV (n = 3), respectively; not statistically different from control conditions). A longer incubation with genistein (between 6–8 h) was also without effect on the resting potential (-62 ± 4.3 mV (n = 4) and -39 ± 4 mV (n = 3), for native and Nef-transfected CEM cells, respectively). Similarly, after 60- to 150-min incubation with 100 µM sodium orthovanadate, an inhibitor of alkaline phosphatases and of some tyrosine phosphatases, the resting potential was -54.2 ± 6.8 mV (n = 5) in native CEM cells and -33.3 ± 1.4 mV (n = 3) in Nef-transfected cells, not different from that of the same cells under control conditions. Along the same line, CP 118556, a specific inhibitor of Src-like tyrosine kinases, was without any effect on the resting potential if used at a concentration of 30 µM (not shown). Furthermore, pHi measurements were conducted with the fluorescent dye BCECF. No significant difference was observed between the pHi of native and Nef-transfected CEM cells incubated in a saline solution containing sodium-HEPES (7.20 ± 0.05 (n = 7) and 7.23 ± 0.08 (n = 9), respectively). The intracellular buffering capacity measured at pHi 7.2 was also not significantly different (22 ± 6 mM/{Delta}pH (n = 3) and 23 ± 5 mM/{Delta}pH (n = 3), respectively).

Measurements of [Ca2+]i

Another possible effect of Nef on KCa,CTX channel could be an alteration of its sensitivity to Ca2+ or a less direct modulation of the channel mediated by changes in [Ca2+]i. The first hypothesis was ruled out by single-channel and current-clamp recordings. The second hypothesis was tested by measuring [Ca2+]i using fura-2 fluorescence. As shown in Table IGo, the [Ca2+]i at rest was similar in native and Nef-transfected cells. However, the release of Ca2+ caused by addition of 1 µM ionomycin to cells incubated in a Ca2+-free saline solution containing EGTA was significantly higher in Nef-transfected cells. A difference was also observed with 100 nM thapsigargin, an inhibitor of the endoplasmic reticulum Ca2+-ATPase, which causes complete discharge of the rapidly exchanging Ca2+ pool or inositol 1,4,5-trisphosphate-sensitive store (see Table IGo).


View this table:
[in this window]
[in a new window]
 
Table I. [Ca2+]i measurements in CEM and Nef-transfected CEM cells1

 
The fura-2 responses to thapsigargin and ionomycin reported above suggest differences in the calcium content of intracellular stores between control and Nef-transfected cells. The [Ca2+]i values revealed by specific fluorophores represent, however, the result of complex equilibria among multiple events, including not only release from the stores, but also buffering in the cytosol and active pumping at both the plasma and intracellular membranes (31). To obtain quantitative measurements of store capacity, cells were loaded near equilibrium (24 h) with 45Ca2+ and then exposed in sequence to thapsigargin and ionomycin, administered in Ca2+-free saline solution. These two compounds were incubated for 5 min, a time found, in preliminary experiments, to be sufficient for entire response to occur. Basal 45Ca2+ leakage from the cells into the EGTA-containing solution was not different in the two cell lines (40 ± 5% (n = 9) and 35 ± 5% (n = 7) of total cell radioactivity). The amount of 45Ca2+ released into the medium by ionomycin was significantly higher in Nef-transfected cells (22 ± 2% of the total (n = 9) and 29 ± 1% (n = 7), respectively), in accord with data obtained with fura-2 (Fig. 6Go). The amount of 45Ca2+ released by thapsigargin was not statistically different between cell lines.



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 6. 45Ca2+ release from stores of native and Nef-transfected cells. To cells bathed in Ca2+-free saline solution were first added with excess EGTA (3 mM), after 1 min 200 nM thapsigargin was added, and after 5 min 5 µM ionomycin was added. 45Ca2+ release was determined 5 min after the addition of each compound and displayed as a percentage of the total cell 45Ca2+ content after subtraction of that recovered in the preceding collection. Data shown are the average of at least seven experiments. The level of 45Ca2+ released by ionomycin from Nef-transfected cells was significantly higher than that released from the native CEM cell line (p < 0.003).

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The HIV-1 regulatory protein Nef is unique to primate lentiviruses. Its high level of expression during the viral cycle and the low rate of mutation of its open reading frame suggest an important role for Nef during in vivo infection. Among its biological activities, down-regulation of cell surface CD4 could facilitate the release of HIV-1 virions and avoid multiple superinfection phenomena with the same HIV-1, while down-regulation of MHC class I receptors could inhibit CTL-mediated lysis of infected cells (reviewed in 1). In addition, the interactions of Nef with several cellular proteins make possible a more complex pattern of alterations in cell functions. The picture of Nef activities is still incomplete, and their implication in host cell physiology remains to be fully elucidated.

Interestingly, several HIV-1 proteins alter cellular electrophysiological properties. Vpu has been proposed to form cationic channels (39), and if expressed in Xenopus oocytes, it reduces aspecifically a K+ conductance (40). Tat blocks L-type Ca2+ channels in dendritic cells (41). Vpr forms a cationic channel in lipid bilayers (42), and glycoprotein 120 activates the Na+/H+ antiport and indirectly a K+ conductance in astrocytes (43). Together, these data suggest that the control of membrane ion permeability might be an important mechanism in HIV-1 pathogenesis. In the light of these results and the plasma membrane targeting of the myristoylated form of Nef, we considered the possibility that expression of HIV-1 Nef could interfere with the ion channel activity of T lymphocytes. Actually, a recent report indicates that Nef inhibits a large conductance K+ channel in glial cells (44). Our data show that the presence of Nef depolarizes the membrane of CEM lymphoblastoid cells by about 25 mV, from -57 mV in native CEM cells to -33 mV in Nef-transfected cells.

The resting potential of T lymphocytes is settled by the activity of Cl- and K+ channels (19, 20). The fact that the membrane potential in Nef-expressing cells approaches the reversal potential of Cl- suggests a lack of contribution of the K+ channels that normally intervene in the setting of the resting potential of native CEM cells. The depolarized potential of Nef cells is not due to a reduced activity of voltage-gated K+ channels. Actually, the resting potential of CEM cells is not controlled by these channels, since various selective blockers (KTX, DTX, MCD, and 4-AP) were unable to depolarize the cells. This conclusion was confirmed by the superimposition of the activation curve of voltage-gated K+ channels in native and Nef-transfected CEM cells and by the increased density of this kind of K+ current in Nef-expressing cells. In fact, if the observed difference in the resting potential were due to voltage-activated K+ channels, either a rightward shift of their activation curve or a reduced current density had to be expected in the transfected cell line.

The resting potential of native CEM cells was reduced by the scorpion venom peptide CTX or by the membrane-permeable Ca2+ chelator BAPTA/AM, highly suggesting that a CTX-sensitive, Ca2+-dependent K+ channel (KCa,CTX) controls the resting potential in CEM cells. Interestingly, neither CTX nor BAPTA/AM modified the resting potential of Nef-transfected cells. These results indicate that this channel is not active in Nef-transfected cells in the resting state. This hypothesis was confirmed in voltage-clamp experiments in which native CEM cells were found to have a voltage-independent, CTX-sensitive current that was absent from Nef-transfected cells. The single-channel conductance of 35 pS, the lack of voltage dependence, the Ca2+ sensitivity, the sensitivity to nanomolar concentrations of CTX, and the resistance to Apa classify this channel as the intermediate conductance KCa,CTX channels described in human T lymphocytes (45).

It is noteworthy that normal inactive human T lymphocytes have been described to have their resting potential settled by voltage-gated K+ channels (19, 20), while Ca2+-dependent K+ channels were shown to settle the resting potential only after lymphocyte activation. Our findings suggest that this model is not valid for all lymphoblastoid cells, raising the possibility that different lymphocyte subpopulations might control their resting potential in different ways.

The question arises concerning the mechanism through which Nef can preclude the activation of the KCa,CTX channel at rest. The first possibility investigated was whether Nef might down-modulate transcription or translation steps or, alternatively, might affect some post-translational modifications of the channel, resulting in its absence in the plasma membrane level. A candidate for intermediate conductance KCa,CTX channels, termed hKCa4, hIK1, or hSK4, has been recently cloned (25, 26, 27). We have observed in RT-PCR experiments that this channel is indeed expressed in native and Nef-transfected cells. Furthermore, the CTX-sensitive Ca2+-dependent K+ channel can be activated in Nef cells by ionomycin. Finally, single-channel analysis demonstrates that a channel with features very similar to those described for hKCa4/hIK1/hSK4 is indeed present in the plasma membrane of both native and Nef-transfected CEM cells. Taken together, these observations rule out the possibility that Nef down-regulates channel expression.

A second possibility was that the channel does reach the membrane but it is functionally blocked. The single-channel results indicate that Nef is not blocking the channel pore or modifying its sensitivity to Ca2+ through a protein-protein interaction. In fact, the single channel conductance and the Ca2+ sensitivity are equal in Nef-transfected and native cells, and the number of patches with nonactive channels in both cell lines is similar (~60%). If the patch contained a tightly linked inhibitory factor, Nef itself or a Nef-regulated effector, a silent patch or a patch with a very reduced open probability should have been recorded. We cannot exclude that soluble Nef molecules or Nef-associated factors, which could interact with the channel in the intact cell, thus blocking or modifying its activity, might be washed out during inside-out or conventional whole-cell experiments. However, the hyperpolarization induced by ionomycin in current-clamp experiments followed by depolarization after addition of CTX suggests that the KCa,CTX channel is not blocked in Nef-transfected cells and senses the [Ca2+]i increase as in native CEM cells. Otherwise, Nef might indeed block the channel, but this interaction should be so weak that it can be bypassed by increasing [Ca2+]i.

A third possibility is that Nef might interfere with other proteins that are involved in channel regulation, such as proteins responsible for the control of pHi or [Ca2+]i homeostasis, or tyrosine kinases/phosphatases. This hypothesis is based on observations that Ca2+-activated K+ channels can be regulated by intracellular pH (32, 36) and may be either activated (38) or blocked (35) by inhibiting tyrosine kinases depending on the cell system. Moreover, some voltage-dependent K+ channels are blocked by Src kinase family enzymes (34, 37). However, in our model two unrelated tyrosine kinase inhibitors, genistein and CP118,556, and vanadate, a wide range phosphatase inhibitor, had no effect on the resting potential of these cells. In addition, pHi was not different in Nef-transfected and native CEM cells, excluding an effect of pH on channel regulation.

Our data open the possibility that Nef modulates the channel by modifying the [Ca2+]i compartmentalization. In fact, even if the resting values of [Ca2+]i were not significantly different between native and Nef-transfected cells, a significant increase in the Ca2+ storage capacity of non-ER stores was determined in transfected cells, thus suggesting that Nef expression might alter Ca2+ homeostasis. It must be pointed out that Nef can associate with several intracellular structures, as the cytoskeleton and some internal membranes, among which are those of the clathrinic vesicles and the Golgi network (1, 46). Interestingly, the Golgi apparatus itself is a nonacidic Ca2+ store susceptible to depletion by ionomycin (47). Therefore, its involvement in the Nef-dependent increase in the Ca2+ storage capacity is quite likely. Although the Ca2+ store capacity of Nef-expressing cells was only moderately increased, it is conceivable that expression of Nef protein might cause remodeling of internal Ca2+ stores. Even if average estimation of [Ca2+]i does not show a significant difference between native and Nef-transfected cells, we cannot exclude a different Ca2+ concentration near the KCa,CTX channel in the two cell lines. Indeed, measurements over a pool of cells do not take into consideration that inside a single cell, domains with higher and lower Ca2+ concentrations may coexist. Evidence for this explanation comes from studies of signal-secretion coupling (48), where the activity of Ca2+-dependent K+ channels was considered a more sensitive reporter of the actual free Ca2+ concentration close to the plasma membrane than average measurements of [Ca2+]i. In CEM cells the [Ca2+]i at rest is near the threshold for channel activation, and therefore a localized Ca2+ reduction in the low nanomolar range, as a consequence of its sequestration in non-ER stores, may be sufficient to push the KCa,CTX channel to a closed state.

The regulation of Ca2+ signaling in T lymphocytes is a mechanism that modulates the immune response. Therefore, the alteration of Ca2+ homeostasis in a Nef-expressing T cell line could be of primary importance in different cellular processes ranging from activation to apoptosis. Among early activation events, protein tyrosine phosphorylation is important in the initiation of the cellular response, and members of two distinct classes of protein tyrosine kinases, the Src family and the Syk/ZAP-70 family, have been implicated. Interestingly, Nef has been found to interact with different members of the Src family (9, 10, 11, 12). The elements downstream of protein tyrosine phosphorylation include phopholipase C activation, resulting in rapid Ca2+ mobilization from inositol 1,4,5-trisphosphate-sensitive stores. Of interest, it has been reported that activation of T lymphocytes induces the enlargement of both ER-localized as well as non-ER-localized Ca2+ stores (49). As a consequence of Ca2+ release, a sustained or oscillatory Ca2+ signal results in dynamic changes in motility, morphology, and gene expression in T cells (20). Notably, IL-2 gene induction plays a central role in T cell proliferation, and the expression of the {alpha} subunit of its receptor (IL-2R{alpha}) may be used as an indicator of cellular activation. In our hands, preliminary data indicate that after incubation with phorbol esters, Nef-transfected cells express a significantly higher percentage of the IL-2R {alpha}-chain with respect to native CEM cells (our unpublished observations). Also other authors have found that Nef alters the Ca2+ response and the activation status of T lymphocytes. Among them, Skowronski et al. (15) found that Ca2+ accumulation was elevated in Nef-expressing T cells from transgenic mice, and Hanna at al. (50) reported that in thymocytes from Nef-expressing transgenic mice, some proteins involved in cellular activation were hyperphosphorylated on tyrosine residues. Together, these results suggest a model in which Nef expression makes the T cell hyper-responsive to activation stimuli following an increase in Ca2+ accumulation in intracellular stores.

Further studies in single cells are required to unravel the intricate causal relationship among ion channels (Ca2+ and K+), membrane potential, and intracellular Ca2+ homeostasis in Nef-expressing cells and to better understand Nef’s action on T cell physiology. The results presented in this study provide a new perspective to elucidate the process of HIV-1 infection and lead to novel pharmacological strategies against AIDS infection.


    Acknowledgments
 
We thank Dr. O. Schwartz for supplying the three Nef-transfected cell lines used in this study and Dr. D. Farahi Far for cytofluorometric measurements.


    Footnotes
 
1 O.Z.-M and A.R. contributed equally to this work. Back

2 Address correspondence and reprint requests to Dr. Olga Zegarra-Moran, Laboratory of Molecular Genetics, Istituto G. Gaslini, L.go G. Gaslini 5, I-16147 Genova, Italy. E-mail address: Back

3 Abbreviations used in this paper: [Ca2+]i, intracellular Ca2+ concentration; pHi, intracellular pH; BCECF/AM, 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein tetraacetoxymethylester; CTX, charybdotoxin; KTX, kaliotoxin; DTX, {alpha}-dendrotoxin; MCD, the mast cell degranulating peptide; VCEM, resting potential of CEM cells; VNef, resting potential of Nef-transfected CEM cells; Apa, apamin; 4-AP, 4-amino-pyridine; KCa,CTX, CTX- and Ca2+-sensitive K+ channel; ER, endoplasmic reticulum. Back

Received for publication November 13, 1998. Accepted for publication February 12, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Cullen, B. R.. 1998. HIV-1 auxiliary proteins: making connections in a dying cell. Cell 93:685.[Medline]
  2. Trono, D.. 1995. HIV accessory proteins: leading roles for the supporting cast. Cell 82:189.[Medline]
  3. Kestler, H. W., D. J. Ringler, K. Mori, D. L. Panicali, R. C. Desrosiers. 1991. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 65:651.[Medline]
  4. Deacon, N. J., A. Tsykin, A. Solomon, K. Smith, M. Ludford-Menting, D. J. Hooker, D. A. McPhee, A. L. Greenway, A. Ellet, C. Chatfield, et al 1995. Genomic structure of an attenuated quasispecies of HIV-1 from a cohort of a blood transfusion donor and recipients. Science 270:988.[Abstract/Free Full Text]
  5. Garcia, J. V., A. D. Miller. 1991. Serine phosphorylation-independent downregulation of cell-surface CD4 by Nef. Nature 350:508.[Medline]
  6. Schwartz, O., V. Marechal, S. Le Gall, F. Lemonnier, J.-M. Heard. 1996. Endocytosis of a major histocompatibility complex class I molecules is induced by the HIV-1 Nef protein. Nat. Med. 2:338.[Medline]
  7. Miller, M. D., M. T. Warmerdam, I. Gaston, W. C. Green, M. B. Feinberg. 1994. The human immunodeficiency virus-1 nef gene product: a positive factor for viral infection and replication in primary lymphocytes and macrophages. J. Exp. Med. 179:101.[Abstract/Free Full Text]
  8. Spina, C. A., T. J. Kwoh, M. Y. Chowers, J. C. Guatelli, D. D. Richman. 1994. The importance of nefin the induction of human immunodeficiency virus type 1 replication from primary quiescent CD4 lymphocytes. J. Exp. Med. 179:115.[Abstract/Free Full Text]
  9. Saksela, K., G. Cheng, D. Baltimore. 1995. Proline-rich (PxxP) motifs in HIV-1 Nef bind to SH3 domains of a subset of Src kinases and are required for the enhanced growth of Nef+ viruses but not for down-regulation of CD4. EMBO J. 14:484.[Medline]
  10. Lee, C. H., B. Leung, M. A. Lemmon, J. Zheng, D. Cowburn, J. Kuriyan, K. Saksela. 1995. A single amino acid in the SH3 domain of Hck determines its high affinity and specificity in binding to HIV-1 Nef protein. EMBO J. 14:5006.[Medline]
  11. Collette, Y., H. Dutartre, A. Benziane, F. Ramos-Morales, R. Benarous, M. Harris, D. Olive. 1996. Physical and functional interaction of Nef with Lck. J. Biol. Chem. 271:6333.[Abstract/Free Full Text]
  12. Moraefi, I., M. LaFevre-Bernt, F. Sicheri, M. Huse, C.-H. Lee, J. Kuriyan, W. T. Miller. 1997. Activation of the Src-family tyrosine kinase Hck by SH3 domain displacement. Nature 385:650.[Medline]
  13. Niederman, T. M., J. V. Garcia, W. R. Hastings, S. Luria, L. Ratner. 1992. Human immunodeficiency virus type 1 Nef protein inhibits NF-kappa B induction in human T cells. J. Virol. 66:6213.[Abstract/Free Full Text]
  14. Bandres, J. C., L. Ratner. 1994. Human immunodeficiency virus type 1 Nef protein down-regulates transcription factors NF-{kappa}B and AP-1 in human T cells in vitro after T-cell receptor stimulation. J. Virol. 68:3243.[Abstract/Free Full Text]
  15. Skowronski, J., D. Parks, R. Mariani. 1993. Altered T cell activation and development in transgenic mice expressing the HIV-1 nef gene. EMBO J. 12:703.[Medline]
  16. Baur, A. S., E. T. Sawai, P. Dazin, W. J. Fantl, C. Cheng-Mayer, B. M. Peterlin. 1994. HIV-1 Nef leads to inhibition or activation of T cells depending on its intracellular localization. Immunity 1:373.[Medline]
  17. Du, Z., S. M. Lang, V. G. Sasseville, A. A. Lackner, P. O. Ilyinskii, M. D. Daniel, J. U. Jung, R. C. Desrosiers. 1995. Identification of a nef allele that causes lymphocyte activation and acute disease in macaque monkeys. Cell 82:665.[Medline]
  18. Verheugen, J. A. H.. 1997. Contribution of Ca2+-activated K+ channels to the enhancement of the secondary immune response. Cell. Physiol. Biochem. 7:188.
  19. Lewis, R. S., M. D. Cahalan. 1995. Potassium and calcium channels in lymphocytes. Annu. Rev. Immunol. 13:623.[Medline]
  20. Cahalan, M. D., K. G. Chandy. 1997. Ion channels in the immune system as targets for immunosuppression. Curr. Opin. Biotechnol. 8:749.[Medline]
  21. Lin, S. C., R. C. Boltz, J. T. Blake, J. T. Nguyen, A. Talento, P. A. Fischer, M. S. Springer, N. H. Sigal, R. S. Slaughter, M. L. Garcia, et al 1993. Voltage-gated potassium channels regulate calcium-dependent pathways involved in human T lymphocyte activation. J. Exp. Med. 177:637.[Abstract/Free Full Text]
  22. Rader, A. S., L. E. Kahn, G. D. Anderson, C. L. Martin, K. S. Chinn, S. A. Gregory. 1996. T cell activation is regulated by voltage-dependent and calcium-activated potassium channels. Immunology 156:1425.
  23. Schwartz, O., Y. Rivière, J.-M. Heard, O. Danos. 1993. Reduced cell surface expression of processed human immunodeficiency virus type 1 envelope glycoprotein in the presence of Nef. J. Virol. 67:3274.[Abstract/Free Full Text]
  24. Hamill, O. P., A. Marty, E. Neher, B. Sakmann, F. J. Sigworth. 1981. Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pfluegers Arch. 391:85.[Medline]
  25. Joiner, W. J., L.-Y. Wang, M. D. Tang, L. K. Kaczmarek. 1997. hSK4, a member of a novel subfamily of calcium-activated potassium channels. Proc. Natl. Acad. Sci. USA 94:11013.[Abstract/Free Full Text]
  26. Ishii, T. M., C. Silvia, B. Hirschberg, C. T. Bond, J. P. Adelman, J. Maylie. 1997. A human intermediate conductance calcium-activated potassium channel. Proc. Natl. Acad. Sci. USA 94:11651.[Abstract/Free Full Text]
  27. Logsdon, N. J., J. Kang, J. A. Togo, E. P. Christian, J. Aiyar. 1997. A novel gene, hKCa4, encodes the calcium-activated potassium channel in human T lymphocytes. J. Biol. Chem. 272:32723.[Abstract/Free Full Text]
  28. Chirgwin, J., A. Przybila, R. MacDonald, W. Rutter. 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18:5294.[Medline]
  29. Thomas, A. P., F. Delaville. 1991. The use of fluorescent indicators for measurements of cytosolic-free calcium concentration in cell populations and single cells. J. G. McCormack, and P. H. Cobbold, eds. Cellular Calcium 1. Oxford University Press, Oxford.
  30. Roos, A., W. F. Boron. 1981. Intracellular pH. Physiol. Rev. 61:296.[Free Full Text]
  31. Fasolato, C., M. Zottini, E. Clementi, D. Zacchetti, I. Meldolesi, T. Pozzan. 1991. Intracellular Ca2+ pools in PC12 cells. J. Biol. Chem. 266:20159.[Abstract/Free Full Text]
  32. Andersen, H. K., V. Urbach, E. Van Kerkhove, E. Prosser, B. J. Harvey. 1995. Maxi K+ channels in the basolateral membrane of the exocrine frog skin gland regulated by intracellular Ca2+ and pH. Pfluegers Arch. 431:52.[Medline]
  33. Church, J., K. A. Baxter, J. G. McLarnon. 1998. pH modulation of Ca2+ responses and a Ca2+-dependent K+ channel in cultured rat hippocampal neurons. J. Physiol. 511:119.[Abstract/Free Full Text]
  34. Holmes, T. C., D. A. Fadool, R. Ren, I. B. Levitan. 1996. Association of Src tyrosine kinase with a human potassium channel mediated by SH3 domain. Science 274:2089.[Abstract/Free Full Text]
  35. Prevarskaya, N. B., R. N. Skryma, P. Vacher, N. Daniel, J. Djiane, B. Dufy. 1995. Role of tyrosine phosphorylation in potassium channel activation: functional association with prolactin receptor and JAK2 tyrosine kinase. J. Biol. Chem. 270:24292.[Abstract/Free Full Text]
  36. Riquelme, G., M. Diaz, F. V. Sepulveda. 1997. Possible thiol group involvement in intracellular pH effect on low-conductance Ca2+-dependent K+ channels. Am. J. Physiol. 273:C230.[Abstract/Free Full Text]
  37. Szabo, I., E. Gulbins, H. Apfel, X. Zhang, P. Barth, A. E. Busch, K. Schlottmann, O. Pongs, F. Lang. 1996. Tyrosine phosphorylation-dependent suppression of a voltage-gated K+ channel in T lymphocytes upon Fas stimulation. J. Biol. Chem. 271:20465.[Abstract/Free Full Text]
  38. Xiong, Z., E. Burnette, D. W. Cheung. 1995. Modulation of Ca2+-activated K+ channel activity by tyrosine kinase inhibitors in vascular smooth muscle cell. Eur. J. Pharmacol. 290:117.[Medline]
  39. Schubert, U., A. V. Ferrer-Montiel, M. Oblatt-Montal, P. Henklein, K. Strebel, M. Montal. 1996. Identification of an ion channel activity of the Vpu transmembrane domain and its involvement in the regulation of virus release from HIV-1 infected cells. FEBS Lett. 398:12.[Medline]
  40. Coady, M. J., N. G. Daniel, E. Tiganos, B. Allain, J. Friborg, J. V. Lapointe, E. A. Cohen. 1998. Effects of Vpu expression on Xenopus oocyte membrane conductance. Virology 244:39.[Medline]
  41. Poggi, A., A. Rubartelli, M. R. Zocchi. 1998. Involvement of dihydropyridine-sensitive calcium channels in human dendritic cell function: competition by HIV-1 Tat. J. Biol. Chem. 273:7205.[Abstract/Free Full Text]
  42. Piller, S. C., G. D. Ewart, A. Premkumar, G. B. Cox, P. W. Gage. 1996. Vpr protein of human immunodeficiency virus type 1 forms cation-selective channels in planar lipid bilayers. Proc. Natl. Acad. Sci. USA 93:111.[Abstract/Free Full Text]
  43. Bubien, J. K., E. N. Benveniste, D. J. Benos. 1995. HIV-gp120 activates large-conductance apamin-sensitive potassium channels in rat astrocytes. Am. J. Physiol. 268:C1440.[Abstract/Free Full Text]
  44. Kort, J. J., T. O. Jalonen. 1998. The Nef protein of the human immunodeficiency virus type 1 (HIV-1) inhibits a large-conductance potassium channel in human glial cells. Neurosci. Lett. 251:1.[Medline]
  45. Verheugen, J. A. H., H. P. M. Vijverberg, M. Oortgiesen, M. D. Cahalan. 1995. Voltage-gated and Ca2+-activated K+ channels in intact human T lymphocytes. J. Gen. Physiol. 105:765.[Abstract/Free Full Text]
  46. Kaminchik, J., R. Margalit, S. Yaish, D. H., B. Amit, N. Sarver, M. Gorecki, and A. Panet. 1994. Cellular distribution of HIV-1 Nef protein: identification of domains in Nef required for association with membrane and detergent-insoluble cellular matrix. AIDS Res. Hum. Retroviruses 10:1003.
  47. Pinton, P., T. Pozzan, R. Rizzuto. 1998. The Golgi apparatus is an inositol 1,4,5-trisphosphate-sensitive Ca2+ store, with functional properties distinct from those of the endoplasmic reticulum. EMBO J. 17:5298.[Medline]
  48. Osipchuk, Y. V., M. Wakui, D. I. Yule, D. V. Gallacher, O. H. Petersen. 1990. Cytoplasmic Ca2+ oscillations evoked by receptor stimulation, G-protein activation, internal application of inositol trisphosphate or Ca2+: simultaneous microfluorometry and Ca2+ dependent Cl- current recording in single pancreatic acinar cells. EMBO J. 9:697.[Medline]
  49. Clementi, E., G. Martino, L. M. E. Grimaldi, E. Brambilla, J. Meldolesi. 1994. Intracellular Ca2+ stores of T lymphocytes: changes induced by in vitro and in vivo activation. Eur. J. Immunol. 24:1365.[Medline]
  50. Hanna, Z., D. G. Kay, N. Rebai, A. Guimond, S. Jothy, P. Jolicoeur. 1998. Nef harbors a major determinant of pathogenicity for an AIDS-like disease induced by HIV-1 in transgenic mice. Cell 95:163.[Medline]



This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
T. H. Mogensen and S. R. Paludan
Molecular Pathways in Virus-Induced Cytokine Production
Microbiol. Mol. Biol. Rev., March 1, 2001; 65(1): 131 - 150.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Rasola, D. Gramaglia, C. Boccaccio, and P. M. Comoglio
Apoptosis Enhancement by the HIV-1 Nef Protein
J. Immunol., January 1, 2001; 166(1): 81 - 88.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Manninen, G. Herma Renkema, and K. Saksela
Synergistic Activation of NFAT by HIV-1 Nef and the Ras/MAPK Pathway
J. Biol. Chem., May 26, 2000; 275(22): 16513 - 16517.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
A. Manninen and K. Saksela
HIV-1 Nef Interacts with Inositol Trisphosphate Receptor to Activate Calcium Signaling in T Cells
J. Exp. Med., April 15, 2002; 195(8): 1023 - 1032.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zegarra-Moran, O.
Right arrow Articles by Galietta, L. J. V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zegarra-Moran, O.
Right arrow Articles by Galietta, L. J. V.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS