|
|
||||||||




*
Laboratorio di Genetica Molecolare, Istituto Giannina Gaslini, Genova, Italy;
Unité de Recherches en Immunologie Cellulaire et Moléculaire, Institut National de la Santé et de la Recherche Médicale, Unit 364, Nice, France; and
Laboratorio di Biochimica, Dipartimento di Biologia, Università di Bologna, Bologna, Italy
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
T lymphocytes are the major target for HIV-1. It has been proposed that Nef could alter some activation pathway of these cells (15, 16, 17), which largely depend in their early steps on Ca2+ influx (18). The control of membrane potential is an important process in the biology of T lymphocytes. Indeed, the electrical properties of the cell membrane are essential for T lymphocyte activation. The driving force that modulates Ca2+ entry is under the control of membrane potential, finely tuned by Cl- and K+ conductances (19, 20), and recent data indicate that the use of specific blockers of K+ channels inhibits some lymphocyte activation cascades (21, 22).
In this context we sought to determine whether Nef might alter ion channel activity and consequently the membrane potential of T lymphocytes. To test this hypothesis we have studied the electrophysiological properties of the CD4+ lymphoblastoid cell line CEM and compared them with those of Nef-transfected CEM cells. We found that the expression of Nef elicits a 25-mV depolarization of CEM cells and that this depolarization is due to the lack of activity, in the resting state, of a charybdotoxin-sensitive Ca2+-activated K+ channel of intermediate conductance. Furthermore, Nef expression was responsible for an altered Ca2+ homeostasis by enhancing Ca2+ release from internal stores.
| Materials and Methods |
|---|
|
|
|---|
Human lymphoblastoid CEM cells were grown in suspension in RPMI 1640 culture medium supplemented with 5% Fetal Clone II (HyClone, Logan, UT) and 2 mM L-glutamine in a humidified 5% CO2 incubator at 37°C. These cells were positive for the surface markers CD4 and CD45 and were negative for the markers CD3, CD8, CD14, and CD19, as assessed by FACScan flow cytometric analysis performed with the FITC-conjugated Abs. Stable Nef-transfected CEM cells, obtained as previously described (23), were grown in the same medium and selected in the presence of G418 (1 mg/ml). Unless otherwise stated, Nef-transfected cells were from the HIV-1LAI strain. HIV-1SF2 or HIV-1A01 strains were also used. Nef expression was assessed both by RT-PCR analysis (see below) and by cytofluorometric detection of CD4 surface down-regulation. For electrophysiological experiments, 2 ml of cell suspension was centrifuged and resuspended in 1 ml of the extracellular working solution. Before each experiment 200 µl of this preparation was added to a petri dish containing 1 ml of the extracellular solution. Patch-clamp experiments started when cells attached to the petri surface (within 510 min).
Electrophysiological measurements
Experiments were conducted using standard whole-cell and
inside-out recording methods (24). The perforated patch variant of the
patch-clamp technique was used in other experiments to prevent the
possible washout of essential cytoplasmic factors during whole-cell
recording. In these cases the perforating agent amphotericin B was used
at concentrations between 100 and 250 µg/ml. In current clamp
experiments, resting potential was recorded on a chart recording. As
traces showed potential fluctuations within a 20-mV range around an
average, this average was considered the resting membrane potential.
All experiments were performed at room temperature. Patch pipettes were
fabricated from borosilicate glass capillaries on a two-step puller and
fire polished. The pipette resistance was 34 M
for macroscopic
current measurements or for current-clamp experiments and 610 M
for single-channel recordings. Membrane currents and zero current-clamp
membrane potential were measured with an EPC-7 amplifier (List-Medical,
Darmstadt, Germany) controlled by a personal computer via an AD/DA
converter. Membrane currents were sampled at a bandwidth of 2 kHz and
low pass filtered with a four-pole Bessel filter (4302, Ithaca, NY) set
at a cut-off frequency of 1 kHz. Capacitative current was removed by
analogue compensation.
Solutions
For whole-cell and most perforated patch experiments the composition of the external solution was 130 mM NaCl, 2 mM KCl, 1 mM KH2PO4, 2 mM CaCl2, 2 mM MgCl2, 10 mM sodium-HEPES, 10 mM glucose, and 20 mM mannitol. The intracellular solution was 140 mM KCl, 1 mM MgCl2, 0.18 mM CaCl2, 2 mM EGTA, 10 mM potassium-HEPES, and 20 mM mannitol. For inside-out experiments and for ramps in perforated patch experiments, the extracellular solution was 160 mM KCl, 2 mM CaCl2, 1 mM MgCl2, and 10 mM potassium-HEPES. The composition of the internal solution in these experiments was 160 mM KCl, 1 mM MgCl2, 5 mM potassium-HEPES, 0.5 mM EGTA, and 0.297, 0.373, 0.427, 0.440, or 0.461 mM CaCl2. The CaCl2 concentrations were selected (using the Patchers Power Tools program developed by Francisco Mendez, Max Planck Institut for Biophysical Chemistry, Göttingen, Germany) to obtain free Ca2+ concentrations of 100, 200, 400, 500, and 800 nM, respectively. Unless otherwise stated, the pH was always 7.3. Each time that charybdotoxin was used, 30 µg/ml of BSA was included in the working solution to avoid adsorption of the toxin to plastic tubes and dishes.
RT-PCR
RT-PCR analysis was performed to detect the expression of HIV-Nef RNA and of the Ca2+-dependent K+ channel hKCa4/hIK1/hSK4 (25, 26, 27) on the cell line studied. Total RNA was extracted from 107 cells with the guanidine thiocyanate method (28). The RT reaction was performed on 2 µg of total RNAs using the cDNA Synthesis System Plus Kit (Amersham, Arlington Heights, IL). PCR was conducted on a fraction of these cDNAs, in a final volume of 25 µl and with an annealing temperature of 58°C. PCR primers were: 1) HIV-Nef: forward, ATGGGTGGCAAGTGGTCAAAA; reverse, TCAGCAGTTCTTGTAGTACTC; and 2) hKCa4/hIK1/hSK4: forward, CACACTTTGGCTGATCCCC; reverse, GTGTTTCAGCCGCACCTGG. The expected amplification products were of 620 and 358 bp, respectively.
Determination of free cytosolic Ca2+ concentration and intracellular pH
Cells (4 x 106/ml) were incubated at 37°C for 30 min with 4 µM fura-2/AM in RPMI 1640 medium (pH 7.35) supplemented with 2 mg/ml BSA and 0.2 mM sulfinpyrazone. Cells were then washed with the same medium in the absence of fura-2/AM and kept in the dark until use. Aliquots (3 x 105 cells) were incubated in Krebs-Ringer saline solution containing 125 mM NaCl, 5 mM KCl, 1 mM MgSO4, 1 mM KH2PO4, 5.5 mM D-glucose, 20 mM sodium-HEPES, 0.2 mM sulfinpyrazone, and 1 mg/ml BSA (pH 7.4). Fura-2 fluorescence was measured at 37°C in a Jasko IP-770 Spectrofluorometer (Tokyo, Japan), with excitation and emission wavelengths set at 340 and 380 nm, respectively. The intracellular Ca2+ concentration ([Ca2+]i)3 was determined after cell lysis with 0.1% Triton X-100 as described by Thomas and Delaville (29).
Intracellular pH (pHi) was determined in cells loaded with 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein tetraacetoxymethylester (BCECF/AM). Cells (4 x 106/ml) were incubated in RPMI 1640 medium containing 4 µM BCECF/AM for 30 min in a CO2 incubator. Cells were then washed twice, resuspended in RPMI 1640 medium, and maintained in the dark until use. BCECF fluorescence was measured in the cuvette compartment (37°C) of a Jasko 770 spectrofluorometer, with excitation and emission wavelengths set at 505 and 530 nm, respectively. Aliquots (3 x 105 cells) were resuspended in Krebs-Ringer saline solution containing 1 mM CaCl2. Calibration curves of pHi against fluorescence were generated by addition of 1.5 µM nigericin in a high K+ saline solution and measuring the fluorescence at known pH values. The calibration curves were linear over the pH range between 6.5 and 7.8. The intracellular buffering capacity was measured from the changes in pHi induced by NH4+ pulses (210 mM) and was calculated as described previously (30).
45Ca2+ release
45Ca2+ release from intracellular stores were measured following the procedure described by Fasolato et al. (31). In brief, 5 x 105 cells/ml were incubated in the culture medium with 4 µCi/ml 45Ca2+ for 24 h. Labeled cells were washed three times with nonradioactive medium maintained at 4°C. Cells were then resuspended at 37°C in a Ca2+-free saline solution containing 3 mM EGTA and quickly added with thapsigargin (200 nM) followed 5 min later by ionomycin (5 µM). Immediately before and 5 min after each addition, aliquots of 2 x 106 cells were centrifuged, and the 45Ca2+ released into the medium was estimated using a Beckman LS1800 liquid scintillator (Beckman, Palo Alto, CA). Release values are expressed as a percentage of the total cell 45Ca2+ content, normalized to the protein determined in the corresponding cell pellets.
Chemicals
Charybdotoxin (CTX), kaliotoxin (KTX),
-dendrotoxin (DTX),
and the mast cell degranulating peptide (MCD) were obtained from
Latoxan (Rosans, France). Apamin (Apa), 4-amino-pyridine (4-AP),
BAPTA/AM, ionomycin, thapsigargin, and other chemicals were purchased
from Sigma (St. Louis, MO). Fura-2/AM and BCECF/AM were obtained from
Molecular Probes (Eugene, OR). 45Ca2+ was
obtained from New England Nuclear-DuPont (Boston, MA).
Statistics
Data are presented as raw representative experiments or as the mean ± SEM. Students t test was applied where appropriate.
| Results |
|---|
|
|
|---|
After clamping to zero the current in the perforated-patch variant
of the whole-cell configuration, we found that the resting potential of
CEM cells transfected with three different Nef strains was about 25 mV
more depolarized than that of native CEM cells. As shown in Fig. 1
A, the resting potential of
CEM cells (VCEM) was -56.8 ± 2.6 mV
(n = 19), while the resting potential of
Nef-transfected CEM cells (VNef) values in cells
transfected with LAI, SF2, and A01 strains were, respectively,
-32.7 ± 1.8 mV (n = 7), -31.4 ± 3.4 mV
(n = 7), and -31.6 ± 4.6 mV (n =
6). No difference was found in conventional whole-cell
(VCEM = -32.4 ± 2.9 mV (n = 12);
VNef = -39 ± 3 mV (n = 11); not
shown), and in consequence the membrane potential was always determined
in perforated-patch experiments. K+ channels have an
important role in settling the resting potential of T lymphocytes (19, 20). To investigate whether Nef is causing a reduction of the resting
potential of CEM cells by inhibiting K+ conductance, we
used extracellular charybdotoxin (CTX), a good blocker of some
voltage-dependent and Ca2+-dependent K+
channels in lymphocytes. We found that 50 nM CTX caused a 25-mV
depolarization in native CEM cells (Fig. 1
B) without
affecting the membrane potential of Nef-transfected cells (Fig. 1
C). Other K+ channel blockers, such as KTX,
DTX, MCD, Apa, and 4-AP, had no effect on the resting potential of
these cell lines (see Fig. 1
, B and C).
|
To evaluate the hypothesis that a voltage-gated K+
channel sets the CEM resting potential, voltage-clamp experiments were
conducted in the perforated-patch configuration. These experiments
showed an outward current that peaked in a few milliseconds, depending
on the applied potential, and then slowly inactivated (Fig. 2
A). Recovery from
inactivation was slow (not shown); thus, test pulses were separated by
long periods (50 s) at a holding potential of -100 mV. The current was
blocked by 50 nM CTX or 5 mM 4-AP (not shown). The activation curve
(Fig. 2
B) was fitted to a Boltzmann function of the type
G/Gmax = 1/(1 +
exp(-(Vm -
Vh)/a), were
Gmax is the maximal conductance,
Vh is the half-activation potential, and
a is the slope parameter. The mean values of
Gmax, Vh, and
a obtained from seven different experiments in native CEM
cells were 4.6 ± 1.2 nS, -11.9 ± 2.9 mV, and 6.4 ± 1
mV, respectively. The mean values obtained from seven Nef-transfected
CEM cells were 8.6 ± 1 nS, -7.2 ± 1.5 mV, and 6.1 ±
0.6 mV, respectively. While Vh and slope
a were not statistically different, the maximal conductance
of Nef-transfected cells was twice as high as that of native cells
(p < 0.05), indicating a higher voltage-gated
K+ current density in the transfected line (see traces in
Fig. 2
A and the current-voltage relationship in Fig. 2
C). The difference of conductance was not due to a higher
membrane surface of transfected cells, since the capacitance was not
statistically different (10.2 ± 0.5 and 10.3 ± 0.5 pF for
native and Nef-transfected cells, respectively).
|
Effects of the [Ca2+]i on the resting potential
Since CTX is also a good blocker of some
Ca2+-dependent K+ channels, we asked whether
these channels are involved in the control of CEM resting potential. We
observed that when native CEM cells were incubated for 1 h with
the membrane-permeable Ca2+ chelator BAPTA/AM (20 µM),
their resting potential dropped to a value similar to that of untreated
Nef-transfected cells (-25.8 ± 4.5 mV; n = 5).
In contrast, BAPTA/AM incubation did not change the resting potential
of Nef cells (Fig. 3
A). Two
types of Ca2+-activated K+ channels have been
described in T lymphocytes, a small-conductance, Apa-sensitive channel
and an intermediate-conductance, CTX-sensitive channel
(KCa,CTX) (20). Due to the absence of effect of Apa on the
resting potential and to the dramatic depolarizing effect of CTX (Fig. 1
B), the latter type of K+ channel appeared as
the best candidate to be involved in the regulation of the resting
potential of native CEM cells.
|
Ca2+-dependent K+ current
To directly study the KCa,CTX channel, voltage-clamp
experiments were performed in the perforated-patch configuration using
50 nM Apa in the bath solution. Cells were stimulated with voltage
ramps from -120 to 20 mV in the presence of symmetrical K+
concentrations. Native CEM cells displayed two current components, one
linear and voltage-independent and another voltage-dependent, with an
activation threshold near -40 mV (Fig. 4
A). The voltage-dependent
component was completely blocked by 5 mM 4-AP (see traces in Fig. 4
A). The linear component, instead (44.8 ± 12.5 pA/pF
at -100 mV with symmetrical K+; n = 4),
was reversibly blocked by CTX (see Fig. 4
B). In contrast to
native cells, Nef-transfected cells exhibited a larger,
voltage-dependent component in accordance with our previous
observations (see Fig. 2
), but completely lacked the linear,
CTX-sensitive component (Fig. 4
C). Fig. 4
D
depicts the difference between the current before and after the
addition of 50 nM CTX in both cell lines.
|
In an attempt to understand the mechanism underlying the absence
of activity of the KCa,CTX channel in Nef-transfected
cells, single-channel experiments were performed in the inside-out
patch-clamp configuration. Interestingly, Ca2+-activated
K+ channels of intermediate conductance were active in
patches from both native and Nef-transfected CEM cells (Fig. 5
A). The conductances in
native and Nef-transfected CEM cells were 35.3 ± 3 pS
(n = 4) and 34.2 ± 0.54 pS (n =
4; Fig. 5
B), respectively (not statistically different). The
calcium dependence of the channel was estimated by calculating the open
probability at -100 mV in continuous records of at least 30 s at
each [Ca2+]i. Our results showed that the
calcium sensitivity was similar in both cell lines. The threshold for
channel activation was near 100 nM, and the half-maximal activation
occurred at 431 and 439 nM in native and Nef cells, respectively (Fig. 5
C). The fit in both cases gave a Hill coefficient of 6,
indicating highly cooperative interaction of calcium ions. In native
CEM cells, a reduction of the internal (cytosolic) KCl concentration
from 165 to 82.5 mM shifted the reversal potential from 0 ± 2 to
15 ± 3 mV (n = 3; see triangles in Fig. 5
B), as expected for a K+ permeable channel
(VNernst = 18.2 mV). The use of 50 nM CTX in the
pipette solution in the presence of a [Ca2+]i
of 500 nM reduced the open probability of the channel from 0.37 ±
0.014 (n = 4) to 0.00034 ± 0.0002
(n = 4; p < 0.005).
|
Together these data ruled out the possibility of a reduced or absent expression of the KCa,CTX channel on the plasma membrane of Nef-expressing cells.
Absence of control of KCa,CTX conductance by kinases, phosphatases, or pHi
The possibility remained that Nef could functionally block or
down-regulate the channel, either by direct interaction or via an
action on some intracellular factors. As a first step we tested whether
Nef effect could be due to a modulation through tyrosine
kinases/phosphatases or to changes in pHi, which have been
reported to regulate K+ channels in various cell systems
(32, 33, 34, 35, 36, 37, 38). One-hour incubation with 100 µM genistein, a wide range
tyrosine kinase inhibitor, did not change the resting potential of
native and Nef-transfected CEM cells (-63 ± 7.5 mV
(n = 3) and -36.7 ± 4.7 mV (n =
3), respectively; not statistically different from control conditions).
A longer incubation with genistein (between 68 h) was also
without effect on the resting potential (-62 ± 4.3 mV
(n = 4) and -39 ± 4 mV (n = 3),
for native and Nef-transfected CEM cells, respectively). Similarly,
after 60- to 150-min incubation with 100 µM sodium orthovanadate, an
inhibitor of alkaline phosphatases and of some tyrosine phosphatases,
the resting potential was -54.2 ± 6.8 mV (n = 5)
in native CEM cells and -33.3 ± 1.4 mV (n = 3)
in Nef-transfected cells, not different from that of the same cells
under control conditions. Along the same line, CP 118556, a specific
inhibitor of Src-like tyrosine kinases, was without any effect on the
resting potential if used at a concentration of 30 µM (not shown).
Furthermore, pHi measurements were conducted with the
fluorescent dye BCECF. No significant difference was observed between
the pHi of native and Nef-transfected CEM cells incubated
in a saline solution containing sodium-HEPES (7.20 ± 0.05
(n = 7) and 7.23 ± 0.08 (n = 9),
respectively). The intracellular buffering capacity measured at
pHi 7.2 was also not significantly different (22 ± 6
mM/
pH (n = 3) and 23 ± 5 mM/
pH
(n = 3), respectively).
Measurements of [Ca2+]i
Another possible effect of Nef on KCa,CTX channel
could be an alteration of its sensitivity to Ca2+ or a less
direct modulation of the channel mediated by changes in
[Ca2+]i. The first hypothesis was ruled out
by single-channel and current-clamp recordings. The second hypothesis
was tested by measuring [Ca2+]i using fura-2
fluorescence. As shown in Table I
, the
[Ca2+]i at rest was similar in native and
Nef-transfected cells. However, the release of Ca2+ caused
by addition of 1 µM ionomycin to cells incubated in a
Ca2+-free saline solution containing EGTA was significantly
higher in Nef-transfected cells. A difference was also observed with
100 nM thapsigargin, an inhibitor of the endoplasmic reticulum
Ca2+-ATPase, which causes complete discharge of the rapidly
exchanging Ca2+ pool or inositol
1,4,5-trisphosphate-sensitive store (see Table I
).
|
|
| Discussion |
|---|
|
|
|---|
Interestingly, several HIV-1 proteins alter cellular electrophysiological properties. Vpu has been proposed to form cationic channels (39), and if expressed in Xenopus oocytes, it reduces aspecifically a K+ conductance (40). Tat blocks L-type Ca2+ channels in dendritic cells (41). Vpr forms a cationic channel in lipid bilayers (42), and glycoprotein 120 activates the Na+/H+ antiport and indirectly a K+ conductance in astrocytes (43). Together, these data suggest that the control of membrane ion permeability might be an important mechanism in HIV-1 pathogenesis. In the light of these results and the plasma membrane targeting of the myristoylated form of Nef, we considered the possibility that expression of HIV-1 Nef could interfere with the ion channel activity of T lymphocytes. Actually, a recent report indicates that Nef inhibits a large conductance K+ channel in glial cells (44). Our data show that the presence of Nef depolarizes the membrane of CEM lymphoblastoid cells by about 25 mV, from -57 mV in native CEM cells to -33 mV in Nef-transfected cells.
The resting potential of T lymphocytes is settled by the activity of Cl- and K+ channels (19, 20). The fact that the membrane potential in Nef-expressing cells approaches the reversal potential of Cl- suggests a lack of contribution of the K+ channels that normally intervene in the setting of the resting potential of native CEM cells. The depolarized potential of Nef cells is not due to a reduced activity of voltage-gated K+ channels. Actually, the resting potential of CEM cells is not controlled by these channels, since various selective blockers (KTX, DTX, MCD, and 4-AP) were unable to depolarize the cells. This conclusion was confirmed by the superimposition of the activation curve of voltage-gated K+ channels in native and Nef-transfected CEM cells and by the increased density of this kind of K+ current in Nef-expressing cells. In fact, if the observed difference in the resting potential were due to voltage-activated K+ channels, either a rightward shift of their activation curve or a reduced current density had to be expected in the transfected cell line.
The resting potential of native CEM cells was reduced by the scorpion venom peptide CTX or by the membrane-permeable Ca2+ chelator BAPTA/AM, highly suggesting that a CTX-sensitive, Ca2+-dependent K+ channel (KCa,CTX) controls the resting potential in CEM cells. Interestingly, neither CTX nor BAPTA/AM modified the resting potential of Nef-transfected cells. These results indicate that this channel is not active in Nef-transfected cells in the resting state. This hypothesis was confirmed in voltage-clamp experiments in which native CEM cells were found to have a voltage-independent, CTX-sensitive current that was absent from Nef-transfected cells. The single-channel conductance of 35 pS, the lack of voltage dependence, the Ca2+ sensitivity, the sensitivity to nanomolar concentrations of CTX, and the resistance to Apa classify this channel as the intermediate conductance KCa,CTX channels described in human T lymphocytes (45).
It is noteworthy that normal inactive human T lymphocytes have been described to have their resting potential settled by voltage-gated K+ channels (19, 20), while Ca2+-dependent K+ channels were shown to settle the resting potential only after lymphocyte activation. Our findings suggest that this model is not valid for all lymphoblastoid cells, raising the possibility that different lymphocyte subpopulations might control their resting potential in different ways.
The question arises concerning the mechanism through which Nef can preclude the activation of the KCa,CTX channel at rest. The first possibility investigated was whether Nef might down-modulate transcription or translation steps or, alternatively, might affect some post-translational modifications of the channel, resulting in its absence in the plasma membrane level. A candidate for intermediate conductance KCa,CTX channels, termed hKCa4, hIK1, or hSK4, has been recently cloned (25, 26, 27). We have observed in RT-PCR experiments that this channel is indeed expressed in native and Nef-transfected cells. Furthermore, the CTX-sensitive Ca2+-dependent K+ channel can be activated in Nef cells by ionomycin. Finally, single-channel analysis demonstrates that a channel with features very similar to those described for hKCa4/hIK1/hSK4 is indeed present in the plasma membrane of both native and Nef-transfected CEM cells. Taken together, these observations rule out the possibility that Nef down-regulates channel expression.
A second possibility was that the channel does reach the membrane but
it is functionally blocked. The single-channel results indicate that
Nef is not blocking the channel pore or modifying its sensitivity to
Ca2+ through a protein-protein interaction. In fact, the
single channel conductance and the Ca2+ sensitivity are
equal in Nef-transfected and native cells, and the number of patches
with nonactive channels in both cell lines is similar (
60%). If the
patch contained a tightly linked inhibitory factor, Nef itself or a
Nef-regulated effector, a silent patch or a patch with a very reduced
open probability should have been recorded. We cannot exclude that
soluble Nef molecules or Nef-associated factors, which could interact
with the channel in the intact cell, thus blocking or modifying its
activity, might be washed out during inside-out or conventional
whole-cell experiments. However, the hyperpolarization induced by
ionomycin in current-clamp experiments followed by depolarization after
addition of CTX suggests that the KCa,CTX channel is not
blocked in Nef-transfected cells and senses the
[Ca2+]i increase as in native CEM cells.
Otherwise, Nef might indeed block the channel, but this interaction
should be so weak that it can be bypassed by increasing
[Ca2+]i.
A third possibility is that Nef might interfere with other proteins that are involved in channel regulation, such as proteins responsible for the control of pHi or [Ca2+]i homeostasis, or tyrosine kinases/phosphatases. This hypothesis is based on observations that Ca2+-activated K+ channels can be regulated by intracellular pH (32, 36) and may be either activated (38) or blocked (35) by inhibiting tyrosine kinases depending on the cell system. Moreover, some voltage-dependent K+ channels are blocked by Src kinase family enzymes (34, 37). However, in our model two unrelated tyrosine kinase inhibitors, genistein and CP118,556, and vanadate, a wide range phosphatase inhibitor, had no effect on the resting potential of these cells. In addition, pHi was not different in Nef-transfected and native CEM cells, excluding an effect of pH on channel regulation.
Our data open the possibility that Nef modulates the channel by modifying the [Ca2+]i compartmentalization. In fact, even if the resting values of [Ca2+]i were not significantly different between native and Nef-transfected cells, a significant increase in the Ca2+ storage capacity of non-ER stores was determined in transfected cells, thus suggesting that Nef expression might alter Ca2+ homeostasis. It must be pointed out that Nef can associate with several intracellular structures, as the cytoskeleton and some internal membranes, among which are those of the clathrinic vesicles and the Golgi network (1, 46). Interestingly, the Golgi apparatus itself is a nonacidic Ca2+ store susceptible to depletion by ionomycin (47). Therefore, its involvement in the Nef-dependent increase in the Ca2+ storage capacity is quite likely. Although the Ca2+ store capacity of Nef-expressing cells was only moderately increased, it is conceivable that expression of Nef protein might cause remodeling of internal Ca2+ stores. Even if average estimation of [Ca2+]i does not show a significant difference between native and Nef-transfected cells, we cannot exclude a different Ca2+ concentration near the KCa,CTX channel in the two cell lines. Indeed, measurements over a pool of cells do not take into consideration that inside a single cell, domains with higher and lower Ca2+ concentrations may coexist. Evidence for this explanation comes from studies of signal-secretion coupling (48), where the activity of Ca2+-dependent K+ channels was considered a more sensitive reporter of the actual free Ca2+ concentration close to the plasma membrane than average measurements of [Ca2+]i. In CEM cells the [Ca2+]i at rest is near the threshold for channel activation, and therefore a localized Ca2+ reduction in the low nanomolar range, as a consequence of its sequestration in non-ER stores, may be sufficient to push the KCa,CTX channel to a closed state.
The regulation of Ca2+ signaling in T lymphocytes is a
mechanism that modulates the immune response. Therefore, the alteration
of Ca2+ homeostasis in a Nef-expressing T cell line could
be of primary importance in different cellular processes ranging from
activation to apoptosis. Among early activation events, protein
tyrosine phosphorylation is important in the initiation of the cellular
response, and members of two distinct classes of protein tyrosine
kinases, the Src family and the Syk/ZAP-70 family, have been
implicated. Interestingly, Nef has been found to interact with
different members of the Src family (9, 10, 11, 12). The elements downstream of
protein tyrosine phosphorylation include phopholipase C activation,
resulting in rapid Ca2+ mobilization from inositol
1,4,5-trisphosphate-sensitive stores. Of interest, it has been reported
that activation of T lymphocytes induces the enlargement of both
ER-localized as well as non-ER-localized Ca2+ stores (49).
As a consequence of Ca2+ release, a sustained or
oscillatory Ca2+ signal results in dynamic changes in
motility, morphology, and gene expression in T cells (20). Notably,
IL-2 gene induction plays a central role in T cell proliferation, and
the expression of the
subunit of its receptor (IL-2R
) may be
used as an indicator of cellular activation. In our hands, preliminary
data indicate that after incubation with phorbol esters,
Nef-transfected cells express a significantly higher percentage of the
IL-2R
-chain with respect to native CEM cells (our unpublished
observations). Also other authors have found that Nef alters the
Ca2+ response and the activation status of T lymphocytes.
Among them, Skowronski et al. (15) found that Ca2+
accumulation was elevated in Nef-expressing T cells from transgenic
mice, and Hanna at al. (50) reported that in thymocytes from
Nef-expressing transgenic mice, some proteins involved in cellular
activation were hyperphosphorylated on tyrosine residues. Together,
these results suggest a model in which Nef expression makes the T cell
hyper-responsive to activation stimuli following an increase in
Ca2+ accumulation in intracellular stores.
Further studies in single cells are required to unravel the intricate causal relationship among ion channels (Ca2+ and K+), membrane potential, and intracellular Ca2+ homeostasis in Nef-expressing cells and to better understand Nefs action on T cell physiology. The results presented in this study provide a new perspective to elucidate the process of HIV-1 infection and lead to novel pharmacological strategies against AIDS infection.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Olga Zegarra-Moran, Laboratory of Molecular Genetics, Istituto G. Gaslini, L.go G. Gaslini 5, I-16147 Genova, Italy. E-mail address: ![]()
3 Abbreviations used in this paper: [Ca2+]i, intracellular Ca2+ concentration; pHi, intracellular pH; BCECF/AM, 2',7'-bis(2-carboxyethyl)-5(6)-carboxyfluorescein tetraacetoxymethylester; CTX, charybdotoxin; KTX, kaliotoxin; DTX,
-dendrotoxin; MCD, the mast cell degranulating peptide; VCEM, resting potential of CEM cells; VNef, resting potential of Nef-transfected CEM cells; Apa, apamin; 4-AP, 4-amino-pyridine; KCa,CTX, CTX- and Ca2+-sensitive K+ channel; ER, endoplasmic reticulum. ![]()
Received for publication November 13, 1998. Accepted for publication February 12, 1999.
| References |
|---|
|
|
|---|
B and AP-1 in human T cells in vitro after T-cell receptor stimulation. J. Virol. 68:3243.This article has been cited by other articles:
![]() |
T. H. Mogensen and S. R. Paludan Molecular Pathways in Virus-Induced Cytokine Production Microbiol. Mol. Biol. Rev., March 1, 2001; 65(1): 131 - 150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Rasola, D. Gramaglia, C. Boccaccio, and P. M. Comoglio Apoptosis Enhancement by the HIV-1 Nef Protein J. Immunol., January 1, 2001; 166(1): 81 - 88. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Manninen, G. Herma Renkema, and K. Saksela Synergistic Activation of NFAT by HIV-1 Nef and the Ras/MAPK Pathway J. Biol. Chem., May 26, 2000; 275(22): 16513 - 16517. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Manninen and K. Saksela HIV-1 Nef Interacts with Inositol Trisphosphate Receptor to Activate Calcium Signaling in T Cells J. Exp. Med., April 15, 2002; 195(8): 1023 - 1032. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |