The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaffer, A.
Right arrow Articles by Casali, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaffer, A.
Right arrow Articles by Casali, P.
The Journal of Immunology, 1999, 162: 5327-5336.
Copyright © 1999 by The American Association of Immunologists

The Evolutionarily Conserved Sequence Upstream of the Human Ig Heavy Chain S{gamma}3 Region Is an Inducible Promoter: Synergistic Activation by CD40 Ligand and IL-4 Via Cooperative NF-{kappa}B and STAT-6 Binding Sites1

András Schaffer*,{dagger}, Andrea Cerutti*, Shefali Shah*, Hong Zan* and Paolo Casali2,*,{dagger}

* Division of Molecular Immunology, Department of Pathology, Weill Medical College of Cornell University, and {dagger} The Immunology Program, Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Germline C{gamma} gene transcription is a crucial event in the process that leads to switch DNA recombination to IgG, but its regulation in the human is poorly understood. We took advantage of our monoclonal model of germinal center B cell differentiation, IgM+ IgD+ CL-01 cells, to define the role of the I{gamma}3 evolutionarily conserved sequence (ECS) in the germline transcriptional activation of the human C{gamma}3 gene. The I{gamma}3 ECS lies upstream of the major I{gamma}3 transcription initiation site and displays more than 90% identity with the corresponding human I{gamma}1, I{gamma}2, and I{gamma}4 regions. Reporter luciferase gene vectors containing the human {gamma}3 ECS were used to transfect CL-01 cells, which have been shown to undergo Sµ->S{gamma}3 DNA recombination, upon engagement of CD40 by CD40 ligand (CD40L) and exposure to IL-4. In these transfected CL-01 cells, CD40:CD40L engagement and exposure to IL-4 synergistically induced {gamma}3 ECS-dependent luciferase reporter gene activation. Targeted mutational analysis demonstrated that a tandem NF-{kappa}B/Rel binding motif is critical for the {gamma}3 ECS responsiveness to both CD40L and IL-4, while a STAT-6-binding site is additionally required for IL-4 inducibility. Electrophoretic mobility shift assays showed that p50/p65/c-Rel and STAT-6 are effectively induced by CD40L and IL-4, respectively, and bind to specific DNA motifs within the ECS. These partially overlapping CD40L and IL-4 responsive elements are functionally cooperative as the disruption of one of them prevents synergistic promoter activation. Thus, the {gamma}3 ECS is an inducible promoter containing cis elements that critically mediate CD40L and IL-4-triggered transcriptional activation of the human C{gamma}3 gene.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Class switching modulates the biological effector functions of Igs and contributes to the maturation of the Ab response (reviewed in Refs. 1 and 2). The substitution of the Ig µ heavy chain constant region in the primary response with a C{gamma}, C{alpha}, or C{epsilon} region in the secondary response is critical for the efficient clearance of Ag by conferring to Abs the ability to enter the extravascular space, being secreted across digestive or respiratory surfaces, and interact with phagocytic, histamine-releasing, and cytotoxic effector cells. Ig class switching is effected by deletional DNA recombination between switch (S)3 regions located 5' of each CH gene (3, 4, 5, 6). Switching to a given downstream CH gene is preceded by transcription of the targeted gene in the form of an intermediate RNA encompassing a noncoding exon, called intervening (I) region, the S region, and the CH gene itself (7, 8, 9, 10, 11). Splicing of the intermediate IH-SH-CH RNA juxtaposes the IH with the CH exon and leads to the formation of IH-CH RNA (germline transcript), which is thought to be critical for S DNA recombination by increasing the recombinogenic activity of the S region and/or its accessibility to the S recombinase machinery (12).

CD40 engagement by CD40 ligand (CD40L, CD154) critically triggers Ig class switching (13, 14, 15). Patients lacking an intact CD40L gene display elevated serum IgM and no secondary IgG, IgA, and IgE isotypes (hyperIgM syndrome) (16). As we have shown, upon CD40 engagement by CD40L, human B cells express germline I{gamma}-C{gamma}, and I{alpha}-C{alpha} transcripts, and eventually undergo Sµ->S{gamma}1, ->S{alpha}1, and Sµ->S{alpha}2 DNA recombination, which is mediated by (endogenous) TGF-ß secreted by the CD40-induced B cells (13, 14, 15). As we have also shown, switch DNA recombination to S{gamma}3, S{gamma}2, S{gamma}4, or S{epsilon} requires IL-4, possibly due to its synergistic effect on the CD40-induced transcription of the corresponding germline genes (13, 14, 15). Studies in murine B cell lines have suggested that the germline transcription of the C{gamma}1 and the C{epsilon} genes is associated with the nuclear translocation of NF-{kappa}B/Rel and STAT-6, which bind to highly conserved cis promoter elements located upstream of the I{gamma}1 and I{epsilon} regions (17, 18, 19, 20). The importance of these transcription factors in the regulation of Ig class switching has been further suggested by findings showing the reduced ability of B cells from mice genetically deficient in p50, c-Rel, or STAT-6 protein to switch to IgG1, or IgE, upon appropriate stimulation in vivo or in vitro (21, 22, 23, 24).

Reporter assays utilizing human DG75, DND39, Raji, and SDL-M1 cell lines have led to the identification of the human germline C{epsilon}, C{alpha}1, and C{alpha}2 gene promoters and to the delineation of their respective IL-4 or TGF-ß responsive elements (REs) (25, 26, 27, 28, 29, 30, 31). However, distinct CD40 REs within these promoters have not been defined, and their corresponding CD40-induced trans-factors have not been identified. The utilization of SSK41 cells has allowed the identification of a PMA- and IL-4-inducible DNA fragment upstream of the major human I{gamma}3-C{gamma}3 transcriptional initiation site, but PMA is not a switch-inducing stimulus, and PMA and IL-4 REs were not defined within the tested DNA region (32). Furthermore, since none of the above human cell lines can be induced to undergo switch DNA recombination, the above studies could not address the correlation between the transcriptional potential of the tested CH gene promoters and the induction of switch DNA recombination, thereby failing to provide information on the CD40 and cytokine-dependent transcriptional regulation of the human C{gamma} genes. The identification of germline C{gamma} gene promoters would require the availability of a B cell line that is readily transfectable and that can undergo IgG switching in response to physiological stimuli, that is, CD40L:CD40 engagement and exposure to appropriate cytokines.

Previous studies have shown that sequences lying upstream of S{gamma} regions show a high degree of conservation among all four human C{gamma} isotypes and are highly homologous (65%) within a 175-bp region to the corresponding sequence of the mouse C{gamma} promoters (evolutionarily conserved sequence, ECS) (6, 9). Based on these observations, the human ECS-I{gamma} regions have been hypothesized to regulate the transcriptional activation of the corresponding germline C{gamma} genes (6, 9). In this study, we have taken advantage of IgM+ IgD+ CL-01 cells, our recently identified human monoclonal model of Ig class switching, germinal center (GC) differentiation (13, 14, 15), and somatic hypermutation (33), to address the functionality of the ECS lying upstream of the human C{gamma}3 gene. Upon CD40L:CD40 engagement and exposure to IL-4, CL-01 cells initiate germline I{gamma}3-C{gamma}3 transcription and undergo Sµ->S{gamma}3 DNA recombination. By transient luciferase gene reporter assays, we demonstrate that a DNA fragment encompassing the ECS and the major I{gamma}3 transcriptional initiation site is a functional promoter. This ECS is synergistically induced by CD40L and IL-4 through the induction of NF-{kappa}B/Rel and STAT-6 proteins and their binding to functionally cooperative CD40L and IL-4 responsive cis regulatory elements.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
B cells

The human monoclonal IgM+ IgD+ CL-01 cell line has been described (13, 14, 15). Tonsillar B cells were separated by Ficoll gradient and rosetting with 2-aminoethylisothiouronium bromide-treated SRBCs (15). Nonrosetting cells were reacted with a FITC-conjugated mouse mAb to human IgD (Southern Biotechnology Associates, Birmingham, AL) and then with anti-FITCisomer 1 Microbeads (Miltenyi Biotech, Auburn, CA) to positively select sIgD+ B cells using the MiniMACS magnetic sorter (Miltenyi Biotech). Cells were maintained in RPMI 1640 medium supplemented with 5% heat inactivated FBS (Life Technologies, Grand Island, NY), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Human trimeric CD40L leucine-zipper fusion protein (htCD40L) (Immunex, Seattle, WA) was used at 1 µg/ml. Recombinant human IL-4 (Schering Plough, Kenilworth, NJ) was used at 500 U/ml. The higher amount of IL-4 as compared with previous experiments (13, 14, 15) was necessary to optimize the IL-4-dependent response in transfected B cells.

PCR amplification of I{gamma}3-C{gamma}3, VHDJH-C{gamma}3, and ß-actin cDNA transcripts

RNA was isolated from 3 x 106 CL-01 or purified tonsillar B cells using the RNeasy Total RNA Kit (Qiagen, Chatsworth, CA) and then reverse transcribed using the Superscript Preamplification System for first strand cDNA synthesis (Life Technologies). I{gamma}3-C{gamma}3, VHDJH-C{gamma}3, and ß-actin transcript cDNAs were PCR amplified for 25 cycles as described (13, 15).

Luciferase reporter vectors

pGL3-Basic, pGL3-Promoter, and pRL-CMV reporter vectors were from Promega (Madison, WI). The -449/+265 ECS-I{gamma}3 DNA fragment was PCR amplified from the HindIII/BamHI subclone of the 5' human S{gamma}3 region (GenBank Accession No. S79588) (6) using primers with 5' overhangs containing KpnI (sense) and BglII (antisense) sites. Digested PCR products were cloned into the pGL3-Basic vector. The -352/+265, -239/+265, -157/+265, and -42/+265 5' progressive deletional mutants of the ECS-I{gamma}3 sequence were PCR amplified using appropriate sense primers with 5' KpnI and antisense primers with BglII site overhangs. Site-directed mutants were generated by ligating 5' and 3' PCR fragments flanking the targeted motifs. The 5' and 3' DNA fragments were amplified using appropriate primers with 5' overhangs containing KpnI (sense)/SacI (antisense) and SacI (sense)/BglII (antisense) sites, respectively. The amplified 5' and 3' DNA fragments were digested with KpnI/SacI, and SacI/BglII, respectively, and cloned into the KpnI/BglII-digested pGL-3-Basic vector. This strategy disrupted the targeted motif by replacing 6 nucleotides of the wild-type (wt) sequence with a SacI restriction site. The {kappa}B3- {kappa}B4- mutant was generated by amplifying the 5' and 3' fragments from the {kappa}B3- -449/+265 ECS-I{gamma}3 pGL3 construct. All constructs were analyzed by digestion with restriction endonucleases and by sequencing using a TaqTrack DNA Sequencing System (Promega). Plasmids were separated by CsCl gradient centrifugation. The pGL3-Promoter plasmid contains the SV40 minimal promoter segment. DNA fragment encompassing the -239/-65 ECS sequence was PCR amplified from the wt -449/+265 ECS-I{gamma}3 pGL3 template. Targeted mutant ECS fragments were amplified from corresponding mutant templates using primers with 5' overhangs containing KpnI (sense) and BglII (antisense) sites, respectively. Digested PCR products were cloned into the pGL3-Promoter vector.

Transfection and dual luciferase assay

CL-01 cells (8 x 106) in 500 µl RPMI-FBS were mixed with 40 µl TE (50 mM Tris, 10 mM EDTA) solution containing 20 µg of pGL3 reporter construct and 10 ng of pRL-CMV control vector. Electroporation was performed at 725 V/cm and 950 µF using a Gene Pulser II apparatus (Bio-Rad Laboratories, Hercules, CA). Each transfection was performed in duplicate. After electroporation, cells were resuspended in complete medium (2 x 106/ml), split into aliquots, and cultured in the presence or absence of IL-4 (500 U/ml) and/or htCD40L (1 µg/ml). After 24 h, firefly and ranilla luciferase activities were measured using the Dual-Luciferase Assay System (Promega) to assess promoter activity and transfection efficiency, respectively. All measures were corrected by subtracting the baseline activity of lysates from nontransfected cells.

Nuclear extract preparation and electrophoretic mobility shift assays

CL-01 (5 x 106) or purified tonsillar (107) B cells were cultured in the presence of appropriate stimuli for 12 h and then lysed to extract nuclear proteins according to a modified small scale extraction method (20). Bradford assay (Bio-Rad) was performed to determine protein concentration. Double stranded oligonucleotides (consensus sequences are underlined) overlapping the {kappa}B3 (residues -236 to -216, GTGTCTGGACTCCCCCTCGCC), or the GAS (residues -96 to -69, GAGCTGTGATTTCCTAGGAAGACAAA) sites were end labeled with [{gamma}-32P]ATP by T4 kinase and used at approximately 30,000 cpm in each electrophoretic mobility shift analysis (EMSA) reaction. For competition, the following double stranded oligonucleotides were used (bold face letters indicate mutated residues): Ig {kappa}B, 5'-AGCTTCAGAGGGACTTTCCTCTGA-3'; mutant Ig {kappa}B, 5'-AGCTTCAGAAAAACTTTCCTCTGA-3'; I{epsilon} GAS, 5'-GATCCACTTCCCAAGAACAGA-3'; and mutant I{epsilon} GAS, 5'-GATCCACCCCCCAAGGCAGA-3'. The EMSA reaction mixtures (20 µl) contained 1 ng DNA probe, 4 µg nuclear protein extracts, 2 µg poly(dI-dC) (Sigma, St. Louis, MO), and 2 µl binding buffer (12.5 mM HEPES (pH 7.9), 50 mM KCl, 0.1 mM EDTA, 1 mM DDT, and 0.05% Nonidet P-40). The reaction samples were incubated at room temperature for 15 min and then electrophoresed through a 6% nondenaturing polyacrylamide gel in 0.25 x Tris-borate EDTA buffer at 150 V. In competition, inhibition, and supershift experiments, nuclear extracts were incubated for 30 min at room temperature with specific Abs or competing oligonucleotides before addition of the radiolabeled probe. Rabbit Abs to human NF-{kappa}B p50, p52, p65, c-Rel, Rel B, STAT-3, STAT-5, and STAT-6 proteins were from Santa Cruz Biotechnology (San Diego, CA) and were used in the amount of 1 µl for a 20-µl reaction.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Human IgM+ IgD+ B cells express germline I{gamma}3-C{gamma}3 and productive VHDJH-C{gamma}3 transcripts upon incubation with CD40L and IL-4

To verify the relative contribution of CD40L and IL-4 to the induction of switching to C{gamma}3, IgM+ IgD+ CL-01 cells and purified IgM+ IgD+ tonsillar B cells were cultured in medium alone or in medium containing htCD40L (1 µg/ml), IL-4 (500 U/ml), or both htCD40L and IL-4. cDNAs from cells cultured for 2 and 5 days were used as templates to PCR amplify germline I{gamma}3-C{gamma}3 (670 bp) and productive VHDJH-C{gamma}3 (416 bp) transcripts, respectively. The specificity of the amplified cDNAs was verified by restriction digestion and sequencing (13). B cells in medium alone failed to express germline I{gamma}3-C{gamma}3 and productive VHDJH-C{gamma}3 transcripts. htCD40L or IL-4 alone were sufficient to initiate I{gamma}3-C{gamma}3 transcription, but not switch DNA recombination to C{gamma}3, as VHDJH-C{gamma}3 transcripts were not detected (Fig. 1Go). However, in agreement with our previous findings, the combination of htCD40L and IL-4 synergistically up-regulated the expression of germline I{gamma}3-C{gamma}3 transcripts and induced related DNA recombination, as indicated by the detection of both VHDJH-C{gamma}3 transcripts (Fig. 1Go) and S{gamma}3-Sµ switch circles (not shown). Thus, in human B cells, exposure to CD40L or IL-4 is sufficient to induce C{gamma}3 germline transcription, but switching to C{gamma}3 requires both CD40L and IL-4.



View larger version (37K):
[in this window]
[in a new window]
 
FIGURE 1. Expression of germline I{gamma}3-C{gamma}3 and mature VHDJH-C{gamma}3 transcripts by IgM+ IgD+ CL-01 and normal naive IgM+ IgD+ B cells. CL-01 and naive B cells were incubated in medium only, or in medium containing htCD40L (1 µg/ml), IL-4 (500 U/ml), or both htCD40L and IL-4. cDNAs from cells cultured for 2 or 5 days were used as templates to PCR amplify I{gamma}3-C{gamma}3 (670-bp) and VHDJH-C{gamma}3 (416-bp) transcripts, respectively. ß-Actin cDNA was amplified as control. Amplified cDNAs were fractionated through a 1% ethidium bromide agarose gel. The findings depicted here were obtained from one of three independent experiments yielding similar results.

 
The human ECS-I{gamma}3 sequence upstream of S{gamma}3 contains putative CD40L and IL-4 REs

Previous studies have shown that the regulation of the mouse C{gamma}1 and the mouse and the human C{epsilon} gene promoters are highly dependent on binding sites for NF-{kappa}B/Rel, C/EBP, BSAP, and STAT-6 (NF-IL-4) transcription factors (17, 19, 20, 28, 34, 35). The ECS-I{gamma} sequences upstream of the human S{gamma} regions show a high degree of conservation among all four C{gamma} isotypes and are highly homologous in the ECS region to the mouse C{gamma} promoters (6, 9). An analysis of the human ECS-I{gamma}3 sequence (Fig. 2GoA) allowed us to identify putative binding sites for the following transcription factors, from 5' to 3': six {kappa}B ({kappa}B1 to {kappa}B6), a C/EBP, a BSAP, and a GAS site (Fig. 2GoB). The three {kappa}B sites ({kappa}B3, {kappa}B4, and {kappa}B5) within the C{gamma}3 ECS are collinear with the CD40 RE of the mouse C{gamma}1 promoter (19). The palindromic GAS site, also located within the ECS, contains a core spacer similar to that of the IL-4 RE of the human C{epsilon} and CD23 gene promoters (25, 26, 36).



View larger version (18K):
[in this window]
[in a new window]
 
FIGURE 2. A, Germline configuration and restriction map of the DNA region upstream of the human C{gamma}3 gene, and encompassing the ECS, the I{gamma}3 exon, the S{gamma}3 region, and the C{gamma}3 gene. Arrowheads indicate the DNA fragment (from residue -449 to residue +265, where +1 marks the major I{gamma}3 transcriptional initiation site) cloned into the pGL3-Basic reporter vector. B, Sequence of the HindIII-StuI ECS-I{gamma}3 region (residues -449 to +288). The HindIII and StuI restriction sites are underlined, and arrowheads mark the 5' and 3' ends of the DNA segment cloned into the pGL3-Basic vector (-449/+265 ECS-I{gamma}3 region) and that of the ECS (-239/-65), respectively. The major I{gamma}3 transcriptional initiation site (32) is marked by a turned arrow. The ECS is shaded, and the putative transcription factor binding motifs are boxed. The consensus sequences for the depicted motifs are detailed in the text.

 
The ECS-I{gamma}3 region is a functional promoter that is synergistically induced by CD40L and IL-4

The CD40L and IL-4-dependent inducibility of a 714-bp DNA fragment encompassing the ECS, as well as the major I{gamma}3 transcriptional initiation site (ECS-I{gamma}3 region, residues -449 to +265) (Fig. 2GoB), was tested in luciferase reporter assays after insertion of this DNA fragment into the pGL3 vector, and transient transfection of CL-01 cells (Fig. 3Go). ECS-I{gamma}3-pGL-3-transfected CL-01 cells were cultured in medium alone or in medium containing htCD40L (1 µg/ml), IL-4 (500 U/ml), or both htCD40L and IL-4. After 24 h, the luciferase activity was measured. Upon exposure to htCD40L or IL-4, luciferase activity was induced in CL-01 cells transfected with the ECS-I{gamma}3-pGL3, but not the pGL3-Basic vector (Fig. 3Go, A and B). This induction was synergistically enhanced by the combination of htCD40L and IL-4. Interestingly, the ECS-I{gamma}3-pGL3 construct displayed a basal activity lower than that associated with the empty pGL3-Basic vector (Fig. 3GoA), suggesting that the tested DNA fragment contains a potent silencer region. Thus, the human ECS-I{gamma}3 region possesses a transcription-promoting activity that is inducible by either CD40L or IL-4 and that is synergistically enhanced by the combination of CD40L and IL-4.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Inducibility of the human ECS-I{gamma}3 region by htCD40L and/or IL-4. CL-01 cells were transfected with either the empty pGL-3-Basic vector (20 µg) or the ECS-I{gamma}3-pGL-3 vector (20 µg). pRL-CMV control plasmid (10 ng) was cotransfected with the reporter constructs to normalize the transfection efficiency. Transfected CL-01 cells were cultured in medium only, or in medium containing htCD40L, IL-4, or both htCD40L and IL-4, and the luciferase gene activity was assessed after 24 h. Data are expressed as relative light units normalized to a cotransfected pRL-CMV control plasmid (A), and as fold induction (B), i.e., ratio of the luciferase activity of extracts from induced cells compared with that of extracts from cells incubated in medium only. Results represent the mean ± SD of three independent transfection experiments.

 
The -239/-157 ECS is critical in conferring both CD40L and IL-4-dependent transcriptional inducibility to the ECS-I{gamma}3 region

To narrow down the portion of the ECS-I{gamma}3 region involved in the CD40L and IL-4 inducibility, 5' progressive D1, D2, D3, and D4 ECS-I{gamma}3 deletion mutants were generated by taking into consideration the distribution of the putative {kappa}B, BSAP, and GAS sites (Figs. 2GoB and 4). These deletion mutants were separately inserted into pGL3 vectors that were used to transfect CL-01 cells. Transfected CL-01 cells were incubated in medium only, or in medium containing htCD40L, IL-4, or both, and luciferase activity was measured 24 h later. Notably, while the D1 and D2 mutants displayed a basal reporter activity comparable to that associated with the ECS-I{gamma}3-pGL3 construct, the D3 and D4 mutants displayed a 3.9-fold lower and a 4.5-fold higher basal reporter activity, respectively (Fig. 4Go), suggesting that, while the -239/-157 ECS fragment is critical in conferring basal transcriptional activity to the ECS-I{gamma}3 sequence, the -157/-65 ECS fragment contains a silencer element. When compared with the wt ECS-I{gamma}3 region, the D1 and D2 mutants retained full htCD40L- or IL-4-dependent inducibility but showed significantly reduced synergistic responsiveness to the combined htCD40L and IL-4 stimulation (Fig. 4Go). The D3 and D4 mutants, which lacked the 5' half or the whole ECS, did not respond to either htCD40L, IL-4, or both htCD40L and IL-4. All together, these data suggest that the -239 to -157 region of the ECS is crucial to confer both CD40L and IL-4-dependent transcriptional inducibility to the ECS-I{gamma}3 sequence and that elements located upstream of the ECS (residues -449 to -352) are necessary for a full synergistic response to CD40L and IL-4.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 4. Approximate location of the CD40 and IL-4 REs within the ECS-I{gamma}3 region. Diagrams depict the configuration of wt -449/+265 ECS-I{gamma}3 region, and -352/+265 D1, -239/+265 D2, -157/+265 D3, or -42/+265 D4 5' progressive deletional mutants. Boxes correspond to putative {kappa}B ({kappa}B1 to {kappa}B6), BSAP and GAS sites. Turned arrow marks the major I{gamma}3 transcriptional initiation site (32). The names and the schematic structure of the plasmids are indicated. Reporter vectors containing the wt or mutated ECS-I{gamma}3 region were electroporated into CL-01 cells. Transfected cells were then incubated in medium only, or in medium containing htCD40L, IL-4, or both htCD40L and IL-4, and the luciferase gene activity was assessed after 24 h. Data are expressed as relative light units (left panel) and fold induction (right panel). Results represent the mean ± SD of three independent transfection experiments.

 
Identification of the CD40L and IL-4 REs within the ECS-I{gamma}3 region

To identify the CD40L and the IL-4 responsive cis regulatory elements within the ECS, we generated ECS-I{gamma}3 (residues -449 to +265) mutants bearing mutated {kappa}B3 ({kappa}B3-), {kappa}B4 ({kappa}B4-), ISRE/{kappa}B5/C/EBP (ISRE-/{kappa}B5-/C/EBP-), {kappa}B3/{kappa}B4 ({kappa}B3-/{kappa}B4-), BSAP (BSAP-), or GAS (GAS-) sites (Fig. 5GoA). CL-01 cells were transfected with the wt or mutated ECS-I{gamma}3-pGL3 constructs, and incubated in medium only, or in medium containing htCD40L, IL-4, or both. Luciferase activity was measured after 24 h. The basal reporter activity of {kappa}B3-, ISRE-/{kappa}B5-/C/EBP-, BSAP-, or GAS- mutated constructs was comparable to that of the wt ECS-I{gamma}3 construct (Fig. 5GoB, left panel). In contrast, the {kappa}B4- and the {kappa}B3-/{kappa}B4- mutants displayed a 4-fold lower basal transcriptional activity as compared with that associated with the wt ECS-I{gamma}3 sequence, indicating that the {kappa}B4 site is critical for the basal promoter activity. Compared with the wt construct, the {kappa}B3-, {kappa}B4-, and {kappa}B3-/{kappa}B4- mutants, but not the ISRE-/{kappa}B5-/C/EBP-, BSAP-, and GAS- mutants, reduced the htCD40L-dependent inducibility by 45%, 20%, and 95%, respectively (Fig. 5GoB, second left panel), indicating that the tandem {kappa}B3 and {kappa}B4 sites constitute the CD40 RE of the ECS-I{gamma}3 region. Compared with the wt construct, the {kappa}B3- and the {kappa}B3-/{kappa}B4- mutants reduced the IL-4-dependent inducibility by 75% and 98%, respectively, whereas the {kappa}B4- and BSAP- mutants showed a 25% and 50% reduction, respectively (Fig. 5GoB, second right panel). The virtual abrogation of the IL-4 inducibility in the GAS- and {kappa}B3-/{kappa}B4- mutants, but not in the ISRE-/{kappa}B5-/C/EBP-, and BSAP- mutants, suggested that the IL-4 RE encompasses the GAS site as well as the {kappa}B3 and {kappa}B4 elements within the ECS-I{gamma}3 region. As expected, the {kappa}B3-, the {kappa}B3-/{kappa}B4-, or the GAS-, but not the ISRE-/{kappa}B5-/C/EBP- or BSAP- mutants displayed a complete loss of the synergistic activation elicited by the combination of htCD40L and IL-4 (Fig. 5GoB, right panel). Mutations disrupting the BSAP binding consensus element reduced the synergistic inducibility by about 50%. By demonstrating that the CD40 RE consists of the {kappa}B3 and {kappa}B4 sites and that the IL-4 RE encompasses not only the GAS, but also the {kappa}B3/{kappa}B4 sites, these experiments define partially overlapping CD40 and IL-4 REs within the ECS-I{gamma}3. The BSAP binding consensus element enhances the IL-4 and CD40L plus IL-4-induced, but not the CD40L-induced, activation of the ECS-I{gamma}3 sequence.



View larger version (25K):
[in this window]
[in a new window]
 
FIGURE 5. Definition of the CD40 and the IL-4 REs within the human ECS-I{gamma}3 region. A, The diagram depicts the ECS-I{gamma}3 region with the putative {kappa}B3, {kappa}B4, ISRE/{kappa}B5/C/EBP, BSAP, and GAS sites. The major I{gamma}3 transcriptional initiation site is indicated by a turned arrow. Partial DNA sequences of (-449/+265) ECS-I{gamma}3 constructs containing wt or mutant {kappa}B3, {kappa}B4, ISRE/{kappa}B5/C/EBP, BSAP, and GAS sites (boxed). Replacement mutations are indicated by lower case italic letters and correspond to SacI restriction sites. B, The wt or mutant ({kappa}B3-, {kappa}B4-, ISRE-/{kappa}B5-/C/EBP-, {kappa}B3- {kappa}B4-, BSAP-, and GAS-) ECS-I{gamma}3 region constructs were electroporated into CL-01 cells. Transfected cells were cultured in medium only, or in medium containing htCD40L, IL-4, or both htCD40L and IL-4, and the luciferase activity was measured after 24 h. Results are expressed as relative light units (left panel) and fold induction (right three panels). Results represent the mean ± SD of three independent transfection experiments.

 
The isolated ECS fragment is sufficient to confer CD40L and IL-4 responsiveness to a heterologous promoter

To verify the principal function of the {kappa}B3, {kappa}B4, BSAP, and GAS sites within the C{gamma}3 ECS, we compared the ability of the wt, {kappa}B3-/{kappa}B4-, BSAP-, and GAS- ECS fragments to confer CD40L and/or IL-4 inducibility to the SV40 minimal promoter-driven reporter construct (Fig. 6Go). An SV40-pGL3 reporter construct lacking the ECS was used as a control. CL-01 cells were independently transfected with each of these constructs and incubated in medium alone, or in medium containing htCD40L, IL-4, or both. The luciferase activity was measured after 24 h and expressed as relative light units (Fig. 6Go, left panel), and as fold induction (Fig. 6Go, right panel). The basal reporter activities displayed by the {kappa}B3-/{kappa}B4-, BSAP-, and GAS- ECS mutant constructs were comparable to that of the wt ECS-SV40-pGL3 minimal promoter construct, which was significantly induced by either htCD40L or IL-4 (Fig. 6Go, left and right panels). As expected, the {kappa}B3-/{kappa}B4- ECS mutant was not responsive to htCD40L and/or IL-4, whereas the GAS- ECS mutant lost IL-4 but retained htCD40L-dependent inducibility. The CD40L-mediated inducibility of the BSAP- ECS fragment was comparable to that of the wt ECS construct but consistently showed decreased IL-4 responsiveness (1.5- vs 2.6-fold induction). Finally, while the wt ECS fragment was able to mediate synergistic reporter activation by CD40L and IL-4, the {kappa}B3-/{kappa}B4- or GAS- ECS mutants were not, and the BSAP- ECS mutant displayed about 50% reduction. These experiments demonstrate that the isolated ECS fragment is sufficient to confer CD40L and IL-4 inducibility to a heterologous promoter and further verify the cis-element composition of the CD40 and IL-4 REs within the C{gamma}3 ECS.



View larger version (23K):
[in this window]
[in a new window]
 
FIGURE 6. Inducibility of the human C{gamma}3 ECS segment by CD40L and/or IL-4 using a heterologous minimal promoter construct. Wild-type or mutant {kappa}B3- {kappa}B4-, BSAP-, or GAS- ECS fragments (extending from relative position -239 to -65) were cloned into a pGL-3 vector containing a SV40 minimal promoter. Transfected CL-01 cells were incubated in medium only, or in medium containing htCD40L, IL-4, or both htCD40L and IL-4, and the luciferase gene activity was measured after 24 h. Readings are expressed as relative light units (left panel) and fold induction (right panel). Results represent the mean ± SD of three independent transfection experiments.

 
NF-{kappa}B/Rel and STAT-6 proteins are induced by CD40 and IL-4, respectively, and bind to their respective REs within the human ECS-I{gamma}3 region

NF-{kappa}B/Rel and STAT-6 transcription factors have been shown to bind to the CD40 and IL-4 REs of the mouse C{gamma}1 and C{epsilon} genes (17, 18, 19, 20, 35). Appropriate EMSAs were performed to verify whether these proteins can be induced by htCD40L and/or IL-4 and bind to the CD40 and IL-4 REs of the human ECS-I{gamma}3 region. CL-01 cells and naive B cells were incubated in medium only or in medium containing htCD40L, IL-4, or both. After 12 h, the nuclear proteins were extracted and incubated with radiolabeled {kappa}B3 or GAS probes before fractionation through a 6% polyacrylamide gel. Nuclear proteins from unstimulated CL-01 cells showed a weak {kappa}B3-binding activity as revealed by three shifted bands with slower (complexes A and B) and faster (complex C) mobility (Fig. 7GoA, lane 2). Induction of B cells by htCD40L, but not IL-4, greatly increased the intensity of complexes A, B, and C (lanes 3 and 4). Addition of IL-4 to htCD40L further enhanced the htCD40L-induced {kappa}B3-binding activity (lane 5). Nuclear extracts from naive B cells cultured under the above conditions displayed similar {kappa}B3-binding and induction patterns, with a somewhat more pronounced formation of complex C following htCD40L and IL-4 stimulation (lanes 6–9). The htCD40L-induced binding to the radiolabeled {kappa}B3 probe was specific, as it was inhibited by a "cold" wt {kappa}B3 oligonucleotide (lanes 10 and 11). It was also inhibited by a wt consensus NF-{kappa}B binding site from the Ig {kappa} promoter (lane 12), but not by a mutated form of the latter (lane 13), indicating that complexes A, B, and C contain NF-{kappa}B/Rel proteins. To identify the composition of these complexes, htCD40L-induced nuclear extracts were incubated for 30 min with Abs to human thyroglobulin (control), as well as human p65, p50, p52, c-Rel, and Rel B proteins. Complex A was inhibited by Abs to p50 and p65; complex B by Abs to p50 and c-Rel; and complex C only by Ab to p50; none of the complexes were inhibited by the control Ab or by Abs to p52 or Rel B (lanes 14–19). When the {kappa}B4 sequence was utilized as a probe, DNA binding complexes with similar electrophoretic mobility were detected (data not shown). Thus, CD40 engagement induces the binding of p50/p65, p50/c-Rel, and p50/p50 NF-{kappa}B/Rel complexes to the CD40 RE of the human ECS-I{gamma}3 region. The CD40-dependent induction of these complexes and their specific DNA binding are enhanced by IL-4.



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 7. EMSA analysis of nucleoprotein complexes binding to the {kappa}B3 and GAS sites of the CD40 and IL-4 REs within the ECS. CL-01 and normal naive B cells were incubated in medium only, or in medium containing htCD40L, IL-4, or both htCD40L and IL-4 for 12 h. Nuclear extracts were first incubated for 15 min with radiolabeled oligonucleotides encompassing the ECS {kappa}B3 site (A) or the GAS site (B), and subsequently fractionated into a 6% polyacrylamide gel (lanes 2 to 9; lane 1 contains the protein-free probe). The specificity of shifted bands and their identity to NF-{kappa}B (complexes A, B, and C) or STAT-6 were established by preincubating nuclear proteins with competitors, as detailed in the text (lanes 11 to 13). The immunoreactivity of the shifted bands was determined by preincubating nuclear proteins with blocking Abs to human p50, p52, p65, c-Rel, and Rel B proteins (A, lanes 15 to 19), or with supershifting Abs to human STAT-3, STAT-5, and STAT-6 proteins (B, lanes 15 to 17). An Ab to human thyroglobulin was used as control (A and B, lanes 14).

 
Nuclear proteins from unstimulated or htCD40L-induced CL-01 cells did not show any specific binding to the GAS probe (Fig. 7GoB, lanes 2 and 3); incubation of CL-01 cells with IL-4 induced a slowly migrating band that was slightly enhanced by costimulation with htCD40L (lanes 4 and 5). Similar DNA binding patterns were reproduced using nuclear extracts from freshly isolated B cells in identical experimental conditions (lanes 6 to 9). The IL-4-induced DNA-protein complex was specific, as it was cleared by a nonlabeled I{gamma}3 GAS oligo (lane 11). A wt STAT-6-binding oligonucleotide, but not a nonfunctional mutant derived from the human C{epsilon} promoter, inhibited the IL-4-induced band shift, indicating that the IL-4-induced complex contained STAT-6 (lanes 12 and 13). Furthermore, preincubation of IL-4-induced nuclear proteins with Abs to human STAT-6, but not thyroglobulin, STAT-3, and STAT-5 proteins supershifted the IL-4-induced complex (lanes 14 to 17). Thus, IL-4 induces STAT-6 binding to the GAS site of the IL-4 RE of the human C{gamma}3 ECS, and this binding is enhanced by CD40 coengagement.


    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
These studies show that the ECS upstream of the human S{gamma}3 region is a promoter that is synergistically activated by CD40L and IL-4 through the induction of NF-{kappa}B/Rel and STAT-6 proteins. They show that two tandem {kappa}B elements within the ECS are critical for the CD40-dependent promoter activation as they constitute the target of CD40L-induced NF-{kappa}B/Rel transcription factors (CD40 RE). They define a canonical GAS site that, together with the CD40RE, confers IL-4-dependent inducibility to the ECS, as it provides a specific target for the IL-4-induced STAT-6 (IL-4 RE). They demonstrate a BSAP binding site residing between the {kappa}B and GAS elements to be important for IL-4, but not for CD40L-dependent inducibility. Finally, they indicate that the partially overlapping organization of these CD40 and IL-4 REs is a critical structural feature for the synergistic promoter activation by enabling functional cooperation between NF-{kappa}B/Rel, BSAP, and STAT-6 binding sites.

In murine B cells, CD40 engagement, in the absence of additional stimuli, induces germline I{gamma}1-C{gamma}1 and I{epsilon}-C{epsilon} gene transcription through the activation of the corresponding promoters (19, 20). This transcriptional inducibility is dependent on distinct CD40 REs composed of tandemly arrayed NF-{kappa}B binding sites. Likewise, human B cells stimulated through CD40 have been shown to express multiple IH-CH germline transcripts, including I{gamma}3-C{gamma}3 (13, 14, 37, 38), but CD40-induced activation of the corresponding CH gene promoters has not been formally demonstrated, and the related CD40 REs have not been defined. Here, we show that the CD40-dependent induction of germline I{gamma}3-C{gamma}3 transcription is associated with the transcriptional activation of the ECS-I{gamma}3 promoter region via two tandem {kappa}B sites ({kappa}B3 and {kappa}B4). The sequence of these NF-{kappa}B binding sites and the intervening DNA are identical in all human C{gamma} ECS regions (6), suggesting that CD40 signaling is critical not only for I{gamma}3-C{gamma}3, but also for I{gamma}1-C{gamma}1, I{gamma}2-C{gamma}2, and I{gamma}4-C{gamma}4 germline transcription.

Our experiments show that, upon CD40 triggering, p50/p65, p50/c-Rel, and p50/p50 NF-{kappa}B/Rel complexes bind to the {kappa}B3 site of the C{gamma}3 CD40 RE. This NF-{kappa}B binding pattern is reminiscent of that of the mouse C{gamma}1 CD40 RE, which binds p50/Rel B heterodimers (19). While the probe used to analyze the NF-{kappa}B binding pattern of the mouse C{gamma}1 CD40 RE encompassed three tandem {kappa}B sites (collinear with our {kappa}B3, {kappa}B4, and {kappa}B5 sites), our probe spanned only the functionally dominant {kappa}B3 site. We did not verify whether Rel B binds to the {kappa}B4 or {kappa}B5 sites or to a sequence spanning both {kappa}B3 and {kappa}B4 sites, but a recent report in murine B cells made genetically deficient in Rel B suggests that this NF-{kappa}B family member is not critical for the induction of germline I{gamma}3-C{gamma}3 transcription (39). As we show here, efficient activation of the ECS by CD40 ligation requires the presence of the two tandemly arrayed {kappa}B3 and {kappa}B4 sites. Accordingly, targeted disruption of one of these sites partially reduces the ECS responsiveness to CD40 signaling, whereas disruption of both sites results in the complete loss of CD40-dependent inducibility. In addition, oligonucleotides spanning the individual {kappa}B3 or {kappa}B4 motifs possess a weaker NF-{kappa}B/Rel-binding affinity than a composite oligonucleotide encompassing both the {kappa}B3 and the {kappa}B4 sites (our unpublished observations), suggesting that the functional cooperation between the {kappa}B3 and the {kappa}B4 elements reflects the cooperative binding of NF-{kappa}B/Rel proteins to these sites.

We speculate that the tandem organization of the relatively low affinity {kappa}B3 and {kappa}B4 sites enhances the trans-activational potential of the C{gamma}3 CD40 RE by allowing dimer:dimer NF-{kappa}B/Rel interactions. Our data indicate that the {kappa}B3 and {kappa}B4 motifs also possess distinct regulatory functions. While the {kappa}B3 site is dominant over the {kappa}B4 site in mediating CD40-triggered transcriptional activation, the {kappa}B4, but not the {kappa}B3 site, seems to be involved in the maintenance of the basal promoter activity. These functional differences might stem from the different NF-{kappa}B/Rel composition on the {kappa}B3 and {kappa}B4 motifs, as suggested from the analysis of the human C{epsilon} promoter (29), in which two closely positioned NF-{kappa}B binding sites with distinct NF-{kappa}B/Rel-binding properties possess different functions. While a p50/Rel B-binding {kappa}B site was shown to be critical for basal transcriptional activity, the adjacent p50/p65-binding {kappa}B site was indispensable for the IL-4-dependent germline C{epsilon} gene expression.

We have not examined the binding of BSAP to the putative ECS-I{gamma}3 BSAP consensus site, but disruption of this element did not reduce the CD40L-dependent inducibility. This is in contrast with the essential role of BSAP in the response of the human C{epsilon} promoter to CD40 engagement (28). Several critical experimental parameters may account for this discrepancy, including the sequence of DNA fragment tested in reporter assays, the transfection protocol, and the B cell lines used for transfections.

Exposure of B cells to IL-4 activates the ECS promoter and induces germline I{gamma}3-C{gamma}3 transcription. Targeted ECS-I{gamma}3 deletional mutants and EMSAs revealed that the C{gamma}3 IL-4 RE includes two critical elements, i.e., the NF-{kappa}B/Rel-binding {kappa}B3 and {kappa}B4 sites and the downstream STAT-6-binding GAS site. Since the disruption of either of these elements abolishes the IL-4 responsiveness, functional cooperation between NF-{kappa}B/Rel and STAT-6 transcription factors seems to be critical for IL-4-dependent inducibility. These findings extend previous reports showing that STAT-6 binding sites within the mouse C{gamma}1 or the mouse and the human C{epsilon} promoters require the presence of contiguous NF-{kappa}B/Rel or C/EBP binding sites to confer IL-4-dependent transcriptional activation (17, 28, 29, 40). In contrast to the mouse C{gamma}1 promoter, the IL-4-dependent inducibility of the human C{gamma}3 promoter is not dependent on C/EBP, as mutation of the ISRE/{kappa}B5/C/EBP composite element does not lead to the reduction of IL-4 inducibility, possibly reflecting the distinct organization of STAT-6 and C/EBP binding sites in the mouse C{gamma}1 and in the human C{gamma}3 gene promoter. We speculate that the functional cooperation between GAS, {kappa}B3, and {kappa}B4 sites within the IL-4 RE of the C{gamma}3 promoter underlies a physical interaction between NF-{kappa}B/Rel and IL-4-induced STAT-6 proteins. Consistent with this hypothesis is the demonstration that NF-{kappa}B/Rel and STAT proteins interact with non-STAT transcription factors, including basic-leucin zipper family members (41, 42, 43, 44), and the finding that the cytokine-dependent activation of E-selectin and IFN-ß gene promoters may require the interaction between NF-{kappa}B and activating transcription factor-2 or STAT proteins, respectively (44, 45). Although able to induce the C{gamma}3 promoter in the absence of additional stimuli, IL-4 activates STAT-6, but not NF-{kappa}B. It is conceivable that, upon binding to the GAS element, IL-4-induced STAT-6 interacts with NF-{kappa}B proteins constitutively bound to the {kappa}B3 and {kappa}B4 sites (see Fig. 7GoA).

Several mechanisms can account for the CD40- and IL-4R-dependent transcriptional synergism. First, the overlapping organization of the CD40 and IL-4 REs within the C{gamma}3 promoter may provide the structural basis for the transcriptional cooperation between CD40- and IL-4R-induced signals. For instance, the synergistic activation of the C{gamma}3 promoter might result from the physical and/or functional interaction between CD40L-induced NF-{kappa}B/Rel and IL-4-induced STAT-6 proteins. Interestingly, B cell receptor (BCR)-induced NF-{kappa}B/Rel activation does not synergize with IL-4R co-signaling (our unpublished data), implying that the functionality of NF-{kappa}/Rel complexes induced by CD40 and BCR are distinct. It is also conceivable that other CD40-specific, but not BCR-specific, transcription factors interacting with NF-{kappa}B/Rel complexes are involved in the synergistic response. An alternative but not mutually exclusive hypothesis is that a DNA segment within the ECS-I{gamma}3 region contains a CD40L- or a CD40L and IL-4-dependent enhancer that would amplify the transcriptional synergism brought about by the functional interplay between the {kappa}B3, {kappa}B4, and GAS sites. Accordingly, the deletion of the -449 to -352 ECS-I{gamma}3 region results in about 50% reduction of the CD40L- and IL-4-induced synergism.

In both CL-01 and naive B cells, CD40L-induced NF-{kappa}B binding to the C{gamma}3 CD40 RE is strongly enhanced by IL-4. This enhancement may rely on the ability of IL-4 to amplify the recruitment of TNFR-associated signal transducers, including TNFR-associated factor-2 (TRAF-2), a well-known NF-{kappa}B activator, to the CD40-signaling complex (46, 47). Alternatively, IL-4 might increase the levels of active NF-{kappa}B/Rel by enhancing the CD40-mediated degradation of I{kappa}Bß molecules. Consistent with this hypothesis is the demonstration that IFN-{gamma} enhances the TNF-{alpha}-induced NF-{kappa}B activation by amplifying the TNF-{alpha}-dependent degradation of I{kappa}Bß proteins (48). Whether the IL-4-mediated enhancement of NF-{kappa}B/Rel binding to the C{gamma}3 CD40 RE is due directly to enhanced NF-{kappa}B activation or augmented degradation of I{kappa}Bß proteins is presently addressed in our laboratory using human CL-01 cells. In conclusion, our demonstration that CD40L and IL-4 cooperatively induce the ECS and activate I{gamma}3-C{gamma}3 germline transcription provides a mechanistic explanation for the documented synergism between CD40L and IL-4-induced signals in effecting Sµ-> S{gamma}3 DNA recombination and may constitute a paradigm for the structure-function analysis of other human C{gamma} gene regulatory regions.


    Acknowledgments
 
We thank Mei-Tsuey Hwang for her help and most stimulating discussions. We acknowledge the critical advice of our longtime collaborator Dr. Edward E. Max (Food and Drug Administration, Bethesda, MD) and his gift of the plasmid containing the HindIII/BamHI subclone of the 5' human S{gamma}3 region.We thank Dr. Satwant Narula (Schering-Plough) for providing us with rIL-4.


    Footnotes
 
1 This work was supported by U.S. Public Health Service Grant AR 40908 (to P.C.) A.S. was supported by a predoctoral fellowship from the Cancer Research Institute (New York, NY) and by a Summer Student Fellowship from the Arthritis Foundation (New York Chapter, New York, NY). Back

2 Address correspondence and reprint requests to Dr. Paolo Casali, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: Back

3 Abbreviations used in this paper: S, switch (region); I, intervening (region); IH-CH, germline Ig transcript; CD40L, CD40 ligand; RE, responsive element; ECS, evolutionarily conserved sequence; VHDJH-CH, productive Ig transcript; C/EBP, CCAAT/enhancer-binding protein; BSAP, B cell lineage-specific activator protein; GAS, IFN-{gamma} activation site; wt, wild type; ISRE, IFN-stimulated responsive element; BCR, B cell receptor. Back

Received for publication September 15, 1998. Accepted for publication February 3, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Stavnezer, J.. 1996. Antibody class switching. Adv. Immunol. 61:79.[Medline]
  2. Snapper, C. M., K. B. Marcu, P. Zelazowski. 1997. The immunoglobulin class switch: beyond "accessibility.". Immunity 6:217.[Medline]
  3. Rabbitts, T. H., A. Forster, W. Dunnick, D. L. Bentley. 1980. The role of gene deletion in the immunoglobulin heavy chain switch. Nature 283:351.[Medline]
  4. Matsuoka, M., K. Yoshida, T. Maeda, S. Usuda, H. Sakano. 1990. Switch circular DNA formed in cytokine-treated mouse splenocytes: evidence for intramolecular DNA deletion in immunoglobulin class switching. Cell 62:135.[Medline]
  5. Schwedler, V. U., H. M. Jack, M. Wabl. 1990. Circular DNA is a product of the immunoglobulin class switch rearrangement. Nature 345:452.[Medline]
  6. Mills, F. C., M. P. Mitchell, N. Harindranath, E. E. Max. 1995. Human Ig S{gamma} regions and their participation in sequential switching to IgE. J. Immunol. 155:3021.[Abstract]
  7. Lutzker, S., P. Rothman, R. Pollock, R. Coffman, F. W. Alt. 1988. Mitogen- and IL-4-regulated expression of germ-line Ig {gamma}2b transcripts: evidence for directed heavy chain class switching. Cell 53:177.[Medline]
  8. Lutzker, S., F. W. Alt. 1988. Structure and expression of germ line immunoglobulin {gamma}2b transcripts. Mol. Cell. Biol. 8:1849.[Abstract/Free Full Text]
  9. Sideras, P., T. R. Mizuta, H. Kanamori, N. Suzuki, M. Okamoto, K. Kuze, H. Ohno, S. Doi, S. Fukuhara, M. S. Hassan, L. Hammarstrom, E. Smith, A. Shimizu, T. Honjo. 1989. Production of sterile transcripts of C{gamma} genes in an IgM-producing human neoplastic B cell line that switches to IgG-producing cells. Int. Immunol. 1:631.[Abstract/Free Full Text]
  10. Rothman, P., Y. Y, S. Chen, S. C. Lutzker, V. Li, R. Stewart, R. Coffman, F. W. Alt. 1990. Structure and expression of germ line immunoglobulin heavy-chain {epsilon} transcripts: interleukin-4 plus lipopolysaccharide-directed switching to C{epsilon}. Mol. Cell. Biol. 10:1672.[Abstract/Free Full Text]
  11. Gerondakis, S.. 1990. Structure and expression of murine germ-line immunoglobulin {epsilon} heavy chain transcripts induced by interleukin 4. Proc. Natl. Acad. Sci. USA 87:1581.[Abstract/Free Full Text]
  12. Lorenz, M., S. Jung, A. Radbruch. 1995. Switch transcripts in immunoglobulin class switching. Science 267:1825.[Abstract/Free Full Text]
  13. Cerutti, A., H. Zan, A. Schaffer, L. Bergsagel, N. Harindranath, E. E. Max, P. Casali. 1998. CD40 ligand and appropriate cytokines induce switching to IgG, IgA, and IgE and coordinated germinal center and plasmacytoid phenotypic differentiation in a human monoclonal IgM+ IgD+ B cell line. J. Immunol. 160:2145.[Abstract/Free Full Text]
  14. Cerutti, A., A. Schaffer, S. Shah, H. Zan, H.-C. Liou, R. G. Goodwin, P. Casali. 1998. CD30 is a CD40-inducible molecule that negatively regulates CD40-mediated immunoglobulin class switching in non antigen-selected human B cells. Immunity 9:247.[Medline]
  15. Zan, H., A. Cerutti, P. Dramitinos, A. Schaffer, P. Casali. 1998. CD40 engagement triggers switching to IgA1 and IgA2 in human B cells through induction of endogenous TGF-ß1: evidence for TGF-ß but not IL-10-dependent direct Sµ-S{alpha} and sequential Sµ-S{gamma}, S{gamma}-S{alpha} DNA recombination. J. Immunol. 161:5217.[Abstract/Free Full Text]
  16. DiSanto, J. P., J. Y. Bonnefoy, J. F. Gauchat, A. Fischer, G. d. S. Basile. 1993. CD40 ligand mutations in X-linked immunodeficiency with hyper-IgM. Nature 361:541.[Medline]
  17. Delphin, S., J. Stavnezer. 1995. Characterization of an interleukin 4 (IL-4) responsive region in the immunoglobulin heavy chain germline {epsilon} promoter: regulation by NF-IL-4, a C/EBP family member and NF-{kappa}B/p50. J. Exp. Med. 181:181.[Abstract/Free Full Text]
  18. Berton, M. T., L. A. Linehan. 1995. IL-4 activates a latent DNA-binding factor that binds a shared IFN-{gamma} and IL-4 response element present in the germ-line {gamma}1 Ig promoter. J. Immunol. 154:4513.[Abstract]
  19. Lin, S.-C., J. Stavnezer. 1996. Activation of NF-{kappa}B/Rel by CD40 engagement induces the mouse germ line immunoglobulin C{gamma}1 promoter. Mol. Cell. Biol. 16:4591.[Abstract]
  20. Iciek, L. A., S. A. Delphin, J. Stavnezer. 1997. CD40 cross-linking induces Ig{epsilon} germline transcripts in B cells via activation of NF-{kappa} B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
  21. Shimoda, K., J. van Deursen, M. Y. Sangster, S. R, R. T. Sarawar, R. A. Carson, C. Tripp, F. W. Chu, T. Quelle, D. A. Nosaka, P. C. Vignali, G. Doherty, W. E. Grosveld, W. E. Paul, J. N. Ihle. 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630.[Medline]
  22. Zelazowski, P., D. Carrasco, F. R. Rosas, M. A. Moorman, R. Bravo, C. M. Snapper. 1997. B cell genetically deficient in the c-Rel transactivation domain have selective defects in germline CH transcription and Ig class switching. J. Immunol. 159:3133.[Abstract]
  23. Snapper, C. M., P. Zelazowski, F. R. Rosas, M. R. Kehry, M. Tian, D. Baltimore, W. C. Sha. 1996. B cells from p50/NF-{kappa}B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
  24. Linehan, L. A., W. D. Warren, P. A. Thompson, M. J. Grusby, M. T. Berton. 1998. STAT6 is required for IL-4-induced germline Ig gene transcription and switch recombination. J. Immunol. 161:302.[Abstract/Free Full Text]
  25. Ichiki, T., W. Takahashi, T. Watanabe. 1993. Regulation of the expression of human C{epsilon} germline transcript: identification of a novel IL-4 responsive element. J. Immunol. 150:5408.[Abstract]
  26. Albrecht, B., S. Peiritsch, M. Woisetschlager. 1994. A bifunctional control element in the human IgE germline promoter involved in repression and IL-4 activation. Int. Immunol. 6:1143.[Abstract/Free Full Text]
  27. Fujita, K., M. D. Jumper, K. Meek, P. E. Lipsky. 1995. Evidence for a CD40 response element, distinct from the IL-4 response element, in the germline {epsilon} promoter. Int. Immunol. 7:1529.[Abstract/Free Full Text]
  28. Thienes, C. P., L. De Monte, S. Monticelli, M. Busslinger, H. J. Gould, D. Vercelli. 1997. The transcription factor B cell-specific activator protein (BSAP) enhances both IL-4- and CD40-mediated activation of the human {epsilon} germline promoter. J. Immunol. 158:5874.[Abstract]
  29. Messner, B., A. M. Stütz, B. Albrecht, S. Peiritsch, M. Woisetschläger. 1997. Cooperation of binding sites for STAT6 and NF-{kappa}B/Rel in the IL-4-induced up-regulation of the human IgE germline promoter. J. Immunol. 159:3330.[Abstract]
  30. Lars, N., S. Paschalis. 1993. The human I{alpha}1 and I{alpha}2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C{alpha}1 and C{alpha}2 germline transcripts. Int. Immunol. 5:271.[Abstract/Free Full Text]
  31. Nilsson, L., P. Grant, I. Larsson, S. Pettersson, P. Sideras. 1995. The human I{alpha}1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 7:1191.[Abstract/Free Full Text]
  32. Kuze, K., A. Shimizu, T. Honjo. 1991. Characterization of the enhancer region for germline transcription of the {gamma}3 constant region gene of human immunoglobulin. Int. Immunol. 3:647.[Abstract/Free Full Text]
  33. Zan, H., A. Cerutti, P. Dramitinos, A. Schaffer, Z. Li, P. Casali. 1999. Induction of Ig somatic hypermutation and class switching in a human monoclonal IgM+ IgD+ B cell line in vitro: definition of the requirements and modalities of hypermutation. J. Immunol. 162:3437.[Abstract/Free Full Text]
  34. Liao, F., B. K. Birshtein, M. Busslinger, P. Rothman. 1994. The transcription factor BSAP (NF-HB) is essential for immunoglobulin germ-line {epsilon} transcription. J. Immunol. 152:2904.[Abstract]
  35. Lundgren, M., C. Larsson, A. Femino, M. Xu, J. Stavnezer, E. Severinson. 1994. Activation of the Ig germ-line {gamma}1 promoter: involvement of C/enhancer-binding protein transcription factors and their possible interaction with an NF-IL-4 site. J. Immunol. 153:2983.[Abstract]
  36. Kotanides, H., M. Moczygemba, M. F. White, N. C. Reich. 1995. Characterization of the interleukin-4 nuclear activated factor/STAT and its activation independent of the insulin receptor substrate proteins. J. Biol. Chem. 270:19481.[Abstract/Free Full Text]
  37. Jumper, M. D., J. B. Splawski, P. E. Lipsky, K. Meek. 1994. Ligation of CD40 induces sterile transcripts of multiple Ig H chain isotypes in human B cells. J. Immunol. 152:438.[Abstract]
  38. Fujieda, S., K. Zhang, A. Saxon. 1995. IL-4 plus CD40 monoclonal antibody induces human B cells {gamma} subclass-specific isotype switch: switching to {gamma}1, {gamma}3, and {gamma}4, but not {gamma}2. J. Immunol. 155:2318.[Abstract]
  39. Snapper, C. M., F. R. Rosas, P. Zelazowski, M. A. Moorman, M. R. Kehry, R. Bravo, F. Weih. 1996. B cells lacking RelB are defective in proliferative responses, but undergo normal B cell maturation to Ig secretion and Ig class switching. J. Exp. Med. 184:1537.[Abstract/Free Full Text]
  40. Mikita, T., D. Campbell, P. Wu, K. Williamson, U. Schindler. 1996. Requirements for interleukin-4-induced gene expression and functional characterization of Stat6. Mol. Cell. Biol. 16:5811.[Abstract]
  41. LeClair, K. P., M. A. Blanar, P. A. Sharp. 1992. The p50 subunit of NF-{kappa}B associates with the NF-IL6 transcription factor. Proc. Natl. Acad. Sci. USA 89:8145.[Abstract/Free Full Text]
  42. Stein, B., P. C. Cogswell, Jr A. S. Baldwin. 1993. Functional and physical associations between NF-{kappa}B and C/EBP family members: a Rel domain-bZIP interaction. Mol. Cell. Biol. 13:3964.[Abstract/Free Full Text]
  43. Stein, B., Jr A. S. Baldwin. 1993. Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-{kappa}B. Mol. Cell. Biol. 13:7191.[Abstract/Free Full Text]
  44. Kaszubska, W. R., R. H. van Huijsduijnen, P. Ghersa, A.-M. deRaemy-Schenk, B. P. C. Chen, T. Hai, J. F. de Lamarter, J. Whelan. 1993. Cyclic AMP-independent ATF family members interact with NF-{kappa}B and function in the activation of the E-selectin promoter in response to cytokines. Mol. Cell. Biol. 13:7180.[Abstract/Free Full Text]
  45. Whitley, M. Z., D. Thanos, M. A. Read, T. Maniatis, T. Collins. 1994. A striking similarity in the organization of the E-selectin and ß-interferon gene promoters. Mol. Cell Biol. 14:6464.[Abstract/Free Full Text]
  46. Rothe, M., V. Sarma, V. M. Dixit, D. V. Goeddel. 1995. TRAF2-mediated activation of NF-{kappa}B by TNF receptor 2 and CD40. Science 269:1424.[Abstract/Free Full Text]
  47. Kuhne, M. R., M. Robbins, J. E. Hambor, M. F. Mackey, Y. Kosaka, T. Nishimura, J. P. Gigley, R. J. Noelle, M. Calderhead. 1998. Assembly and regulation of the CD40 receptor complex in human B cells. J. Exp. Med. 186:337.[Abstract/Free Full Text]
  48. Cheshire, J. L., J. A. S. Baldwin. 1997. Synergistic activation of NF-{kappa}B by tumor necrosis factor {alpha} and {gamma} interferon via enhanced I{kappa}B{alpha} degradation and de novo I{kappa}Bß degradation. Mol. Cell. Biol. 17:6746.[Abstract]



This article has been cited by other articles:


Home page
J. Immunol.Home page
W. Xu, P. A. Santini, A. J. Matthews, A. Chiu, A. Plebani, B. He, K. Chen, and A. Cerutti
Viral Double-Stranded RNA Triggers Ig Class Switching by Activating Upper Respiratory Mucosa B Cells through an Innate TLR3 Pathway Involving BAFF
J. Immunol., July 1, 2008; 181(1): 276 - 287.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
V. T. Thieu, E. T. Nguyen, B. P. McCarthy, H. A. Bruns, R. Kapur, C.-H. Chang, and M. H. Kaplan
IL-4-stimulated NF-{kappa}B activity is required for Stat6 DNA binding
J. Leukoc. Biol., August 1, 2007; 82(2): 370 - 379.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
G. Martin, J. Roy, C. Barat, M. Ouellet, C. Gilbert, and M. J. Tremblay
Human Immunodeficiency Virus Type 1-Associated CD40 Ligand Transactivates B Lymphocytes and Promotes Infection of CD4+ T Cells
J. Virol., June 1, 2007; 81(11): 5872 - 5881.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. L. Dryer and L. R. Covey
A Novel NF-{kappa}B-Regulated Site within the Human I{gamma}1 Promoter Requires p300 for Optimal Transcriptional Activity
J. Immunol., October 1, 2005; 175(7): 4499 - 4507.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. He, X. Qiao, and A. Cerutti
CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-10
J. Immunol., October 1, 2004; 173(7): 4479 - 4491.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. C. Kim, C. R. Edmonston, X. Wu, A. Schaffer, and P. Casali
The HoxC4 Homeodomain Protein Mediates Activation of the Immunoglobulin Heavy Chain 3' hs1,2 Enhancer in Human B Cells: RELEVANCE TO CLASS SWITCH DNA RECOMBINATION
J. Biol. Chem., October 1, 2004; 279(40): 42258 - 42269.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
F. Dedeoglu, B. Horwitz, J. Chaudhuri, F. W. Alt, and R. S. Geha
Induction of activation-induced cytidine deaminase gene expression by IL-4 and CD40 ligation is dependent on STAT6 and NF{kappa}B
Int. Immunol., March 1, 2004; 16(3): 395 - 404.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. He, N. Raab-Traub, P. Casali, and A. Cerutti
EBV-Encoded Latent Membrane Protein 1 Cooperates with BAFF/BLyS and APRIL to Induce T Cell-Independent Ig Heavy Chain Class Switching
J. Immunol., November 15, 2003; 171(10): 5215 - 5224.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa
Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes
J. Immunol., October 1, 2003; 171(7): 3627 - 3635.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Schaffer, E. C. Kim, X. Wu, H. Zan, L. Testoni, S. Salamon, A. Cerutti, and P. Casali
Selective Inhibition of Class Switching to IgG and IgE by Recruitment of the HoxC4 and Oct-1 Homeodomain Proteins and Ku70/Ku86 to Newly Identified ATTT cis-Elements
J. Biol. Chem., June 13, 2003; 278(25): 23141 - 23150.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Cerutti, H. Zan, E. C. Kim, S. Shah, E. J. Schattner, A. Schaffer, and P. Casali
Ongoing In Vivo Immunoglobulin Class Switch DNA Recombination in Chronic Lymphocytic Leukemia B Cells
J. Immunol., December 1, 2002; 169(11): 6594 - 6603.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C.-s. Mao and J. Stavnezer
Differential Regulation of Mouse Germline Ig {gamma}1 and {epsilon} Promoters by IL-4 and CD40
J. Immunol., August 1, 2001; 167(3): 1522 - 1534.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. Cerutti, A. Schaffer, R. G. Goodwin, S. Shah, H. Zan, S. Ely, and P. Casali
Engagement of CD153 (CD30 Ligand) by CD30+ T Cells Inhibits Class Switch DNA Recombination and Antibody Production in Human IgD+ IgM+ B Cells
J. Immunol., July 15, 2000; 165(2): 786 - 794.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Zan, Z. Li, K. Yamaji, P. Dramitinos, A. Cerutti, and P. Casali
B Cell Receptor Engagement and T Cell Contact Induce bcl-6 Somatic Hypermutation in Human B Cells: Identity with Ig Hypermutation
J. Immunol., July 15, 2000; 165(2): 830 - 839.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher
DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES
J. Biol. Chem., February 23, 2001; 276(9): 6675 - 6688.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schaffer, A.
Right arrow Articles by Casali, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schaffer, A.
Right arrow Articles by Casali, P.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS