|
|
||||||||
3 Region Is an Inducible Promoter: Synergistic Activation by CD40 Ligand and IL-4 Via Cooperative NF-
B and STAT-6 Binding Sites1


*
Division of Molecular Immunology, Department of Pathology, Weill Medical College of Cornell University, and
The Immunology Program, Weill Graduate School of Medical Sciences of Cornell University, New York, NY 10021
| Abstract |
|---|
|
|
|---|
gene transcription is a crucial event in the process
that leads to switch DNA recombination to IgG, but its regulation in
the human is poorly understood. We took advantage of our monoclonal
model of germinal center B cell differentiation, IgM+
IgD+ CL-01 cells, to define the role of the I
3
evolutionarily conserved sequence (ECS) in the germline transcriptional
activation of the human C
3 gene. The I
3 ECS lies upstream of the
major I
3 transcription initiation site and displays more than 90%
identity with the corresponding human I
1, I
2, and I
4 regions.
Reporter luciferase gene vectors containing the human
3 ECS were
used to transfect CL-01 cells, which have been shown to undergo
Sµ
S
3 DNA recombination, upon engagement of CD40 by CD40 ligand
(CD40L) and exposure to IL-4. In these transfected CL-01 cells,
CD40:CD40L engagement and exposure to IL-4 synergistically induced
3
ECS-dependent luciferase reporter gene activation. Targeted mutational
analysis demonstrated that a tandem NF-
B/Rel binding motif is
critical for the
3 ECS responsiveness to both CD40L and IL-4, while
a STAT-6-binding site is additionally required for IL-4 inducibility.
Electrophoretic mobility shift assays showed that p50/p65/c-Rel and
STAT-6 are effectively induced by CD40L and IL-4, respectively, and
bind to specific DNA motifs within the ECS. These partially overlapping
CD40L and IL-4 responsive elements are functionally cooperative as the
disruption of one of them prevents synergistic promoter activation.
Thus, the
3 ECS is an inducible promoter containing
cis elements that critically mediate CD40L and
IL-4-triggered transcriptional activation of the human C
3
gene. | Introduction |
|---|
|
|
|---|
, C
, or C
region in the secondary
response is critical for the efficient clearance of Ag by conferring to
Abs the ability to enter the extravascular space, being secreted across
digestive or respiratory surfaces, and interact with phagocytic,
histamine-releasing, and cytotoxic effector cells. Ig class switching
is effected by deletional DNA recombination between switch
(S)3 regions located 5' of each
CH gene (3, 4, 5, 6). Switching to a given downstream
CH gene is preceded by transcription of the targeted gene
in the form of an intermediate RNA encompassing a noncoding exon,
called intervening (I) region, the S region, and the CH
gene itself (7, 8, 9, 10, 11). Splicing of the intermediate
IH-SH-CH RNA juxtaposes the
IH with the CH exon and leads to the formation
of IH-CH RNA (germline transcript), which is
thought to be critical for S DNA recombination by increasing the
recombinogenic activity of the S region and/or its accessibility to the
S recombinase machinery (12).
CD40 engagement by CD40 ligand (CD40L, CD154) critically triggers Ig
class switching (13, 14, 15). Patients lacking an intact CD40L gene display
elevated serum IgM and no secondary IgG, IgA, and IgE isotypes
(hyperIgM syndrome) (16). As we have shown, upon CD40 engagement by
CD40L, human B cells express germline I
-C
, and I
-C
transcripts, and eventually undergo Sµ
S
1, Sµ
S
1, and
Sµ
S
2 DNA recombination, which is mediated by (endogenous)
TGF-ß secreted by the CD40-induced B cells (13, 14, 15). As we have also
shown, switch DNA recombination to S
3, S
2, S
4, or S
requires IL-4, possibly due to its synergistic effect on the
CD40-induced transcription of the corresponding germline genes
(13, 14, 15). Studies in murine B cell lines have suggested that the
germline transcription of the C
1 and the C
genes is associated
with the nuclear translocation of NF-
B/Rel and STAT-6, which bind to
highly conserved cis promoter elements located upstream of
the I
1 and I
regions (17, 18, 19, 20). The importance of these
transcription factors in the regulation of Ig class switching has been
further suggested by findings showing the reduced ability of B cells
from mice genetically deficient in p50, c-Rel, or STAT-6 protein to
switch to IgG1, or IgE, upon appropriate stimulation in vivo or in
vitro (21, 22, 23, 24).
Reporter assays utilizing human DG75, DND39, Raji, and SDL-M1 cell
lines have led to the identification of the human germline C
, C
1,
and C
2 gene promoters and to the delineation of their respective
IL-4 or TGF-ß responsive elements (REs) (25, 26, 27, 28, 29, 30, 31). However, distinct
CD40 REs within these promoters have not been defined, and their
corresponding CD40-induced trans-factors have not been
identified. The utilization of SSK41 cells has allowed the
identification of a PMA- and IL-4-inducible DNA fragment upstream of
the major human I
3-C
3 transcriptional initiation site, but PMA is
not a switch-inducing stimulus, and PMA and IL-4 REs were not defined
within the tested DNA region (32). Furthermore, since none of the above
human cell lines can be induced to undergo switch DNA recombination,
the above studies could not address the correlation between the
transcriptional potential of the tested CH gene promoters
and the induction of switch DNA recombination, thereby failing to
provide information on the CD40 and cytokine-dependent transcriptional
regulation of the human C
genes. The identification of germline C
gene promoters would require the availability of a B cell line that is
readily transfectable and that can undergo IgG switching in response to
physiological stimuli, that is, CD40L:CD40 engagement and exposure to
appropriate cytokines.
Previous studies have shown that sequences lying upstream of S
regions show a high degree of conservation among all four human C
isotypes and are highly homologous (65%) within a 175-bp region to the
corresponding sequence of the mouse C
promoters (evolutionarily
conserved sequence, ECS) (6, 9). Based on these observations, the human
ECS-I
regions have been hypothesized to regulate the transcriptional
activation of the corresponding germline C
genes (6, 9). In this
study, we have taken advantage of IgM+ IgD+
CL-01 cells, our recently identified human monoclonal model of Ig class
switching, germinal center (GC) differentiation (13, 14, 15), and somatic
hypermutation (33), to address the functionality of the ECS lying
upstream of the human C
3 gene. Upon CD40L:CD40 engagement and
exposure to IL-4, CL-01 cells initiate germline I
3-C
3
transcription and undergo Sµ
S
3 DNA recombination. By transient
luciferase gene reporter assays, we demonstrate that a DNA fragment
encompassing the ECS and the major I
3 transcriptional initiation
site is a functional promoter. This ECS is synergistically induced by
CD40L and IL-4 through the induction of NF-
B/Rel and STAT-6 proteins
and their binding to functionally cooperative CD40L and IL-4 responsive
cis regulatory elements.
| Materials and Methods |
|---|
|
|
|---|
The human monoclonal IgM+ IgD+ CL-01 cell line has been described (13, 14, 15). Tonsillar B cells were separated by Ficoll gradient and rosetting with 2-aminoethylisothiouronium bromide-treated SRBCs (15). Nonrosetting cells were reacted with a FITC-conjugated mouse mAb to human IgD (Southern Biotechnology Associates, Birmingham, AL) and then with anti-FITCisomer 1 Microbeads (Miltenyi Biotech, Auburn, CA) to positively select sIgD+ B cells using the MiniMACS magnetic sorter (Miltenyi Biotech). Cells were maintained in RPMI 1640 medium supplemented with 5% heat inactivated FBS (Life Technologies, Grand Island, NY), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin. Human trimeric CD40L leucine-zipper fusion protein (htCD40L) (Immunex, Seattle, WA) was used at 1 µg/ml. Recombinant human IL-4 (Schering Plough, Kenilworth, NJ) was used at 500 U/ml. The higher amount of IL-4 as compared with previous experiments (13, 14, 15) was necessary to optimize the IL-4-dependent response in transfected B cells.
PCR amplification of I
3-C
3,
VHDJH-C
3, and ß-actin cDNA transcripts
RNA was isolated from 3 x 106 CL-01 or
purified tonsillar B cells using the RNeasy Total RNA Kit (Qiagen,
Chatsworth, CA) and then reverse transcribed using the Superscript
Preamplification System for first strand cDNA synthesis (Life
Technologies). I
3-C
3, VHDJH-C
3, and
ß-actin transcript cDNAs were PCR amplified for 25 cycles as
described (13, 15).
Luciferase reporter vectors
pGL3-Basic, pGL3-Promoter, and pRL-CMV reporter vectors were
from Promega (Madison, WI). The -449/+265 ECS-I
3 DNA fragment was
PCR amplified from the HindIII/BamHI subclone of
the 5' human S
3 region (GenBank Accession No. S79588) (6) using
primers with 5' overhangs containing KpnI (sense) and
BglII (antisense) sites. Digested PCR products were cloned
into the pGL3-Basic vector. The -352/+265, -239/+265, -157/+265, and
-42/+265 5' progressive deletional mutants of the ECS-I
3 sequence
were PCR amplified using appropriate sense primers with 5'
KpnI and antisense primers with BglII site
overhangs. Site-directed mutants were generated by ligating 5' and 3'
PCR fragments flanking the targeted motifs. The 5' and 3' DNA fragments
were amplified using appropriate primers with 5' overhangs containing
KpnI (sense)/SacI (antisense) and SacI
(sense)/BglII (antisense) sites, respectively. The amplified
5' and 3' DNA fragments were digested with
KpnI/SacI, and SacI/BglII,
respectively, and cloned into the
KpnI/BglII-digested pGL-3-Basic vector. This
strategy disrupted the targeted motif by replacing 6 nucleotides of the
wild-type (wt) sequence with a SacI restriction site. The
B3-
B4- mutant was generated by
amplifying the 5' and 3' fragments from the
B3-
-449/+265 ECS-I
3 pGL3 construct. All constructs were analyzed by
digestion with restriction endonucleases and by sequencing using a
TaqTrack DNA Sequencing System (Promega). Plasmids were separated by
CsCl gradient centrifugation. The pGL3-Promoter plasmid contains the
SV40 minimal promoter segment. DNA fragment encompassing the -239/-65
ECS sequence was PCR amplified from the wt -449/+265 ECS-I
3 pGL3
template. Targeted mutant ECS fragments were amplified from
corresponding mutant templates using primers with 5' overhangs
containing KpnI (sense) and BglII (antisense)
sites, respectively. Digested PCR products were cloned into the
pGL3-Promoter vector.
Transfection and dual luciferase assay
CL-01 cells (8 x 106) in 500 µl RPMI-FBS were mixed with 40 µl TE (50 mM Tris, 10 mM EDTA) solution containing 20 µg of pGL3 reporter construct and 10 ng of pRL-CMV control vector. Electroporation was performed at 725 V/cm and 950 µF using a Gene Pulser II apparatus (Bio-Rad Laboratories, Hercules, CA). Each transfection was performed in duplicate. After electroporation, cells were resuspended in complete medium (2 x 106/ml), split into aliquots, and cultured in the presence or absence of IL-4 (500 U/ml) and/or htCD40L (1 µg/ml). After 24 h, firefly and ranilla luciferase activities were measured using the Dual-Luciferase Assay System (Promega) to assess promoter activity and transfection efficiency, respectively. All measures were corrected by subtracting the baseline activity of lysates from nontransfected cells.
Nuclear extract preparation and electrophoretic mobility shift assays
CL-01 (5 x 106) or purified tonsillar
(107) B cells were cultured in the presence of appropriate
stimuli for 12 h and then lysed to extract nuclear proteins
according to a modified small scale extraction method (20). Bradford
assay (Bio-Rad) was performed to determine protein concentration.
Double stranded oligonucleotides (consensus sequences are underlined)
overlapping the
B3 (residues -236 to -216,
GTGTCTGGACTCCCCCTCGCC), or the GAS (residues -96 to
-69, GAGCTGTGATTTCCTAGGAAGACAAA) sites were end
labeled with [
-32P]ATP by T4 kinase and used at
approximately 30,000 cpm in each electrophoretic mobility shift
analysis (EMSA) reaction. For competition, the following double
stranded oligonucleotides were used (bold face letters indicate mutated
residues): Ig
B, 5'-AGCTTCAGAGGGACTTTCCTCTGA-3'; mutant
Ig
B, 5'-AGCTTCAGAAAAACTTTCCTCTGA-3'; I
GAS,
5'-GATCCACTTCCCAAGAACAGA-3'; and mutant I
GAS,
5'-GATCCACCCCCCAAGGCAGA-3'. The EMSA reaction mixtures
(20 µl) contained 1 ng DNA probe, 4 µg nuclear protein extracts, 2
µg poly(dI-dC) (Sigma, St. Louis, MO), and 2 µl binding buffer
(12.5 mM HEPES (pH 7.9), 50 mM KCl, 0.1 mM EDTA, 1 mM DDT, and 0.05%
Nonidet P-40). The reaction samples were incubated at room temperature
for 15 min and then electrophoresed through a 6% nondenaturing
polyacrylamide gel in 0.25 x Tris-borate EDTA buffer at 150 V. In
competition, inhibition, and supershift experiments, nuclear extracts
were incubated for 30 min at room temperature with specific Abs or
competing oligonucleotides before addition of the radiolabeled probe.
Rabbit Abs to human NF-
B p50, p52, p65, c-Rel, Rel B, STAT-3,
STAT-5, and STAT-6 proteins were from Santa Cruz Biotechnology (San
Diego, CA) and were used in the amount of 1 µl for a 20-µl
reaction.
| Results |
|---|
|
|
|---|
3-C
3 and productive VHDJH-C
3
transcripts upon incubation with CD40L and IL-4
To verify the relative contribution of CD40L and IL-4 to the
induction of switching to C
3, IgM+ IgD+
CL-01 cells and purified IgM+ IgD+ tonsillar B
cells were cultured in medium alone or in medium containing htCD40L (1
µg/ml), IL-4 (500 U/ml), or both htCD40L and IL-4. cDNAs from cells
cultured for 2 and 5 days were used as templates to PCR amplify
germline I
3-C
3 (670 bp) and productive
VHDJH-C
3 (416 bp) transcripts, respectively.
The specificity of the amplified cDNAs was verified by restriction
digestion and sequencing (13). B cells in medium alone failed to
express germline I
3-C
3 and productive
VHDJH-C
3 transcripts. htCD40L or IL-4 alone
were sufficient to initiate I
3-C
3 transcription, but not switch
DNA recombination to C
3, as VHDJH-C
3
transcripts were not detected (Fig. 1
).
However, in agreement with our previous findings, the combination of
htCD40L and IL-4 synergistically up-regulated the expression of
germline I
3-C
3 transcripts and induced related DNA recombination,
as indicated by the detection of both
VHDJH-C
3 transcripts (Fig. 1
) and S
3-Sµ
switch circles (not shown). Thus, in human B cells, exposure to CD40L
or IL-4 is sufficient to induce C
3 germline transcription, but
switching to C
3 requires both CD40L and IL-4.
|
3 sequence upstream of S
3 contains putative
CD40L and IL-4 REs
Previous studies have shown that the regulation of the mouse C
1
and the mouse and the human C
gene promoters are highly dependent on
binding sites for NF-
B/Rel, C/EBP, BSAP, and STAT-6 (NF-IL-4)
transcription factors (17, 19, 20, 28, 34, 35). The ECS-I
sequences
upstream of the human S
regions show a high degree of conservation
among all four C
isotypes and are highly homologous in the ECS
region to the mouse C
promoters (6, 9). An analysis of the human
ECS-I
3 sequence (Fig. 2
A)
allowed us to identify putative binding sites for the following
transcription factors, from 5' to 3': six
B (
B1 to
B6), a
C/EBP, a BSAP, and a GAS site (Fig. 2
B). The three
B
sites (
B3,
B4, and
B5) within the C
3 ECS are collinear with
the CD40 RE of the mouse C
1 promoter (19). The palindromic GAS site,
also located within the ECS, contains a core spacer similar to that of
the IL-4 RE of the human C
and CD23 gene promoters (25, 26, 36).
|
3 region is a functional promoter that is
synergistically induced by CD40L and IL-4
The CD40L and IL-4-dependent inducibility of a 714-bp DNA fragment
encompassing the ECS, as well as the major I
3 transcriptional
initiation site (ECS-I
3 region, residues -449 to +265) (Fig. 2
B), was tested in luciferase reporter assays after
insertion of this DNA fragment into the pGL3 vector, and transient
transfection of CL-01 cells (Fig. 3
).
ECS-I
3-pGL-3-transfected CL-01 cells were cultured in medium alone
or in medium containing htCD40L (1 µg/ml), IL-4 (500 U/ml), or both
htCD40L and IL-4. After 24 h, the luciferase activity was
measured. Upon exposure to htCD40L or IL-4, luciferase activity was
induced in CL-01 cells transfected with the ECS-I
3-pGL3, but not the
pGL3-Basic vector (Fig. 3
, A and B). This
induction was synergistically enhanced by the combination of htCD40L
and IL-4. Interestingly, the ECS-I
3-pGL3 construct displayed a basal
activity lower than that associated with the empty pGL3-Basic vector
(Fig. 3
A), suggesting that the tested DNA fragment contains
a potent silencer region. Thus, the human ECS-I
3 region possesses a
transcription-promoting activity that is inducible by either CD40L or
IL-4 and that is synergistically enhanced by the combination of CD40L
and IL-4.
|
3 region
To narrow down the portion of the ECS-I
3 region involved in the
CD40L and IL-4 inducibility, 5' progressive D1, D2, D3, and D4
ECS-I
3 deletion mutants were generated by taking into consideration
the distribution of the putative
B, BSAP, and GAS sites (Figs. 2
B and 4). These deletion
mutants were separately inserted into pGL3 vectors that were used to
transfect CL-01 cells. Transfected CL-01 cells were incubated in medium
only, or in medium containing htCD40L, IL-4, or both, and luciferase
activity was measured 24 h later. Notably, while the D1 and D2
mutants displayed a basal reporter activity comparable to that
associated with the ECS-I
3-pGL3 construct, the D3 and D4 mutants
displayed a 3.9-fold lower and a 4.5-fold higher basal reporter
activity, respectively (Fig. 4
), suggesting that, while the -239/-157
ECS fragment is critical in conferring basal transcriptional activity
to the ECS-I
3 sequence, the -157/-65 ECS fragment contains a
silencer element. When compared with the wt ECS-I
3 region, the D1
and D2 mutants retained full htCD40L- or IL-4-dependent inducibility
but showed significantly reduced synergistic responsiveness to the
combined htCD40L and IL-4 stimulation (Fig. 4
). The D3 and D4 mutants,
which lacked the 5' half or the whole ECS, did not respond to either
htCD40L, IL-4, or both htCD40L and IL-4. All together, these data
suggest that the -239 to -157 region of the ECS is crucial to confer
both CD40L and IL-4-dependent transcriptional inducibility to the
ECS-I
3 sequence and that elements located upstream of the ECS
(residues -449 to -352) are necessary for a full synergistic response
to CD40L and IL-4.
|
3
region
To identify the CD40L and the IL-4 responsive cis
regulatory elements within the ECS, we generated ECS-I
3 (residues
-449 to +265) mutants bearing mutated
B3 (
B3-),
B4 (
B4-), ISRE/
B5/C/EBP
(ISRE-/
B5-/C/EBP-),
B3/
B4 (
B3-/
B4-), BSAP
(BSAP-), or GAS (GAS-) sites (Fig. 5
A). CL-01 cells were
transfected with the wt or mutated ECS-I
3-pGL3 constructs, and
incubated in medium only, or in medium containing htCD40L, IL-4, or
both. Luciferase activity was measured after 24 h. The basal
reporter activity of
B3-,
ISRE-/
B5-/C/EBP-,
BSAP-, or GAS- mutated constructs was
comparable to that of the wt ECS-I
3 construct (Fig. 5
B,
left panel). In contrast, the
B4- and
the
B3-/
B4- mutants displayed a 4-fold
lower basal transcriptional activity as compared with that associated
with the wt ECS-I
3 sequence, indicating that the
B4 site is
critical for the basal promoter activity. Compared with the wt
construct, the
B3-,
B4-, and
B3-/
B4- mutants, but not the
ISRE-/
B5-/C/EBP-,
BSAP-, and GAS- mutants, reduced the
htCD40L-dependent inducibility by 45%, 20%, and 95%, respectively
(Fig. 5
B, second left panel),
indicating that the tandem
B3 and
B4 sites constitute the CD40 RE
of the ECS-I
3 region. Compared with the wt construct, the
B3- and the
B3-/
B4-
mutants reduced the IL-4-dependent inducibility by 75% and 98%,
respectively, whereas the
B4- and BSAP-
mutants showed a 25% and 50% reduction, respectively (Fig. 5
B, second right panel). The virtual
abrogation of the IL-4 inducibility in the GAS- and
B3-/
B4- mutants, but not in the
ISRE-/
B5-/C/EBP-, and
BSAP- mutants, suggested that the IL-4 RE encompasses the
GAS site as well as the
B3 and
B4 elements within the ECS-I
3
region. As expected, the
B3-, the
B3-/
B4-, or the GAS-, but
not the ISRE-/
B5-/C/EBP- or
BSAP- mutants displayed a complete loss of the synergistic
activation elicited by the combination of htCD40L and IL-4 (Fig. 5
B, right panel). Mutations disrupting the
BSAP binding consensus element reduced the synergistic inducibility by
about 50%. By demonstrating that the CD40 RE consists of the
B3 and
B4 sites and that the IL-4 RE encompasses not only the GAS, but also
the
B3/
B4 sites, these experiments define partially overlapping
CD40 and IL-4 REs within the ECS-I
3. The BSAP binding consensus
element enhances the IL-4 and CD40L plus IL-4-induced, but not the
CD40L-induced, activation of the ECS-I
3 sequence.
|
To verify the principal function of the
B3,
B4, BSAP, and
GAS sites within the C
3 ECS, we compared the ability of the wt,
B3-/
B4-, BSAP-, and
GAS- ECS fragments to confer CD40L and/or IL-4
inducibility to the SV40 minimal promoter-driven reporter construct
(Fig. 6
). An SV40-pGL3 reporter construct
lacking the ECS was used as a control. CL-01 cells were independently
transfected with each of these constructs and incubated in medium
alone, or in medium containing htCD40L, IL-4, or both. The luciferase
activity was measured after 24 h and expressed as relative light
units (Fig. 6
, left panel), and as fold induction
(Fig. 6
, right panel). The basal reporter activities
displayed by the
B3-/
B4-,
BSAP-, and GAS- ECS mutant constructs were
comparable to that of the wt ECS-SV40-pGL3 minimal promoter construct,
which was significantly induced by either htCD40L or IL-4 (Fig. 6
, left and right panels). As expected, the
B3-/
B4- ECS mutant was not responsive
to htCD40L and/or IL-4, whereas the GAS- ECS mutant lost
IL-4 but retained htCD40L-dependent inducibility. The CD40L-mediated
inducibility of the BSAP- ECS fragment was comparable to
that of the wt ECS construct but consistently showed decreased IL-4
responsiveness (1.5- vs 2.6-fold induction). Finally, while the wt ECS
fragment was able to mediate synergistic reporter activation by CD40L
and IL-4, the
B3-/
B4- or
GAS- ECS mutants were not, and the BSAP- ECS
mutant displayed about 50% reduction. These experiments demonstrate
that the isolated ECS fragment is sufficient to confer CD40L and IL-4
inducibility to a heterologous promoter and further verify the
cis-element composition of the CD40 and IL-4 REs within the
C
3 ECS.
|
B/Rel and STAT-6 proteins are induced by CD40 and IL-4,
respectively, and bind to their respective REs within the human
ECS-I
3 region
NF-
B/Rel and STAT-6 transcription factors have been shown to
bind to the CD40 and IL-4 REs of the mouse C
1 and C
genes
(17, 18, 19, 20, 35). Appropriate EMSAs were performed to verify whether these
proteins can be induced by htCD40L and/or IL-4 and bind to the CD40 and
IL-4 REs of the human ECS-I
3 region. CL-01 cells and naive B cells
were incubated in medium only or in medium containing htCD40L, IL-4, or
both. After 12 h, the nuclear proteins were extracted and
incubated with radiolabeled
B3 or GAS probes before fractionation
through a 6% polyacrylamide gel. Nuclear proteins from unstimulated
CL-01 cells showed a weak
B3-binding activity as revealed by three
shifted bands with slower (complexes A and B) and faster (complex C)
mobility (Fig. 7
A, lane
2). Induction of B cells by htCD40L, but not IL-4, greatly
increased the intensity of complexes A, B, and C (lanes
3 and 4). Addition of IL-4 to htCD40L further enhanced
the htCD40L-induced
B3-binding activity (lane 5).
Nuclear extracts from naive B cells cultured under the above conditions
displayed similar
B3-binding and induction patterns, with a somewhat
more pronounced formation of complex C following htCD40L and IL-4
stimulation (lanes 69). The htCD40L-induced binding
to the radiolabeled
B3 probe was specific, as it was inhibited by a
"cold" wt
B3 oligonucleotide (lanes 10 and
11). It was also inhibited by a wt consensus NF-
B binding
site from the Ig
promoter (lane 12), but not by a
mutated form of the latter (lane 13), indicating that
complexes A, B, and C contain NF-
B/Rel proteins. To identify the
composition of these complexes, htCD40L-induced nuclear extracts were
incubated for 30 min with Abs to human thyroglobulin (control), as well
as human p65, p50, p52, c-Rel, and Rel B proteins. Complex A was
inhibited by Abs to p50 and p65; complex B by Abs to p50 and c-Rel; and
complex C only by Ab to p50; none of the complexes were inhibited by
the control Ab or by Abs to p52 or Rel B (lanes
1419). When the
B4 sequence was utilized as a probe, DNA
binding complexes with similar electrophoretic mobility were detected
(data not shown). Thus, CD40 engagement induces the binding of
p50/p65, p50/c-Rel, and p50/p50 NF-
B/Rel complexes to the CD40
RE of the human ECS-I
3 region. The CD40-dependent induction of these
complexes and their specific DNA binding are enhanced by IL-4.
|
3 GAS oligo (lane 11). A wt
STAT-6-binding oligonucleotide, but not a nonfunctional mutant derived
from the human C
promoter, inhibited the IL-4-induced band shift,
indicating that the IL-4-induced complex contained STAT-6
(lanes 12 and 13). Furthermore,
preincubation of IL-4-induced nuclear proteins with Abs to human
STAT-6, but not thyroglobulin, STAT-3, and STAT-5 proteins supershifted
the IL-4-induced complex (lanes 14 to 17).
Thus, IL-4 induces STAT-6 binding to the GAS site of the IL-4 RE of the
human C
3 ECS, and this binding is enhanced by CD40 coengagement. | Discussion |
|---|
|
|
|---|
3 region
is a promoter that is synergistically activated by CD40L and IL-4
through the induction of NF-
B/Rel and STAT-6 proteins. They show
that two tandem
B elements within the ECS are critical for the
CD40-dependent promoter activation as they constitute the target of
CD40L-induced NF-
B/Rel transcription factors (CD40 RE). They define
a canonical GAS site that, together with the CD40RE, confers
IL-4-dependent inducibility to the ECS, as it provides a specific
target for the IL-4-induced STAT-6 (IL-4 RE). They demonstrate a BSAP
binding site residing between the
B and GAS elements to be important
for IL-4, but not for CD40L-dependent inducibility. Finally, they
indicate that the partially overlapping organization of these CD40 and
IL-4 REs is a critical structural feature for the synergistic promoter
activation by enabling functional cooperation between NF-
B/Rel,
BSAP, and STAT-6 binding sites.
In murine B cells, CD40 engagement, in the absence of additional
stimuli, induces germline I
1-C
1 and I
-C
gene transcription
through the activation of the corresponding promoters (19, 20). This
transcriptional inducibility is dependent on distinct CD40 REs composed
of tandemly arrayed NF-
B binding sites. Likewise, human B cells
stimulated through CD40 have been shown to express multiple
IH-CH germline transcripts, including
I
3-C
3 (13, 14, 37, 38), but CD40-induced activation of the
corresponding CH gene promoters has not been formally
demonstrated, and the related CD40 REs have not been defined. Here, we
show that the CD40-dependent induction of germline I
3-C
3
transcription is associated with the transcriptional activation of the
ECS-I
3 promoter region via two tandem
B sites (
B3 and
B4).
The sequence of these NF-
B binding sites and the intervening DNA are
identical in all human C
ECS regions (6), suggesting that CD40
signaling is critical not only for I
3-C
3, but also for
I
1-C
1, I
2-C
2, and I
4-C
4 germline transcription.
Our experiments show that, upon CD40 triggering, p50/p65, p50/c-Rel,
and p50/p50 NF-
B/Rel complexes bind to the
B3 site of the C
3
CD40 RE. This NF-
B binding pattern is reminiscent of that of the
mouse C
1 CD40 RE, which binds p50/Rel B heterodimers (19). While the
probe used to analyze the NF-
B binding pattern of the mouse C
1
CD40 RE encompassed three tandem
B sites (collinear with our
B3,
B4, and
B5 sites), our probe spanned only the functionally
dominant
B3 site. We did not verify whether Rel B binds to the
B4
or
B5 sites or to a sequence spanning both
B3 and
B4 sites,
but a recent report in murine B cells made genetically deficient in Rel
B suggests that this NF-
B family member is not critical for the
induction of germline I
3-C
3 transcription (39). As we show here,
efficient activation of the ECS by CD40 ligation requires the presence
of the two tandemly arrayed
B3 and
B4 sites. Accordingly,
targeted disruption of one of these sites partially reduces the ECS
responsiveness to CD40 signaling, whereas disruption of both sites
results in the complete loss of CD40-dependent inducibility. In
addition, oligonucleotides spanning the individual
B3 or
B4
motifs possess a weaker NF-
B/Rel-binding affinity than a composite
oligonucleotide encompassing both the
B3 and the
B4 sites (our
unpublished observations), suggesting that the functional cooperation
between the
B3 and the
B4 elements reflects the cooperative
binding of NF-
B/Rel proteins to these sites.
We speculate that the tandem organization of the relatively low
affinity
B3 and
B4 sites enhances the
trans-activational potential of the C
3 CD40 RE by
allowing dimer:dimer NF-
B/Rel interactions. Our data indicate that
the
B3 and
B4 motifs also possess distinct regulatory functions.
While the
B3 site is dominant over the
B4 site in mediating
CD40-triggered transcriptional activation, the
B4, but not the
B3
site, seems to be involved in the maintenance of the basal promoter
activity. These functional differences might stem from the different
NF-
B/Rel composition on the
B3 and
B4 motifs, as suggested
from the analysis of the human C
promoter (29), in which two closely
positioned NF-
B binding sites with distinct NF-
B/Rel-binding
properties possess different functions. While a p50/Rel B-binding
B
site was shown to be critical for basal transcriptional activity, the
adjacent p50/p65-binding
B site was indispensable for the
IL-4-dependent germline C
gene expression.
We have not examined the binding of BSAP to the putative ECS-I
3 BSAP
consensus site, but disruption of this element did not reduce the
CD40L-dependent inducibility. This is in contrast with the essential
role of BSAP in the response of the human C
promoter to CD40
engagement (28). Several critical experimental parameters may account
for this discrepancy, including the sequence of DNA fragment tested in
reporter assays, the transfection protocol, and the B cell lines used
for transfections.
Exposure of B cells to IL-4 activates the ECS promoter and induces
germline I
3-C
3 transcription. Targeted ECS-I
3 deletional
mutants and EMSAs revealed that the C
3 IL-4 RE includes two critical
elements, i.e., the NF-
B/Rel-binding
B3 and
B4 sites and the
downstream STAT-6-binding GAS site. Since the disruption of either of
these elements abolishes the IL-4 responsiveness, functional
cooperation between NF-
B/Rel and STAT-6 transcription factors seems
to be critical for IL-4-dependent inducibility. These findings extend
previous reports showing that STAT-6 binding sites within the mouse
C
1 or the mouse and the human C
promoters require the presence of
contiguous NF-
B/Rel or C/EBP binding sites to confer IL-4-dependent
transcriptional activation (17, 28, 29, 40). In contrast to the mouse
C
1 promoter, the IL-4-dependent inducibility of the human C
3
promoter is not dependent on C/EBP, as mutation of the ISRE/
B5/C/EBP
composite element does not lead to the reduction of IL-4 inducibility,
possibly reflecting the distinct organization of STAT-6 and C/EBP
binding sites in the mouse C
1 and in the human C
3 gene promoter.
We speculate that the functional cooperation between GAS,
B3, and
B4 sites within the IL-4 RE of the C
3 promoter underlies a
physical interaction between NF-
B/Rel and IL-4-induced STAT-6
proteins. Consistent with this hypothesis is the demonstration that
NF-
B/Rel and STAT proteins interact with non-STAT transcription
factors, including basic-leucin zipper family members (41, 42, 43, 44), and the
finding that the cytokine-dependent activation of E-selectin and
IFN-ß gene promoters may require the interaction between NF-
B and
activating transcription factor-2 or STAT proteins, respectively (44, 45). Although able to induce the C
3 promoter in the absence of
additional stimuli, IL-4 activates STAT-6, but not NF-
B. It is
conceivable that, upon binding to the GAS element, IL-4-induced STAT-6
interacts with NF-
B proteins constitutively bound to the
B3 and
B4 sites (see Fig. 7
A).
Several mechanisms can account for the CD40- and IL-4R-dependent
transcriptional synergism. First, the overlapping organization of the
CD40 and IL-4 REs within the C
3 promoter may provide the structural
basis for the transcriptional cooperation between CD40- and
IL-4R-induced signals. For instance, the synergistic activation of the
C
3 promoter might result from the physical and/or functional
interaction between CD40L-induced NF-
B/Rel and IL-4-induced STAT-6
proteins. Interestingly, B cell receptor (BCR)-induced NF-
B/Rel
activation does not synergize with IL-4R co-signaling (our unpublished
data), implying that the functionality of NF-
/Rel complexes induced
by CD40 and BCR are distinct. It is also conceivable that other
CD40-specific, but not BCR-specific, transcription factors interacting
with NF-
B/Rel complexes are involved in the synergistic response. An
alternative but not mutually exclusive hypothesis is that a DNA segment
within the ECS-I
3 region contains a CD40L- or a CD40L and
IL-4-dependent enhancer that would amplify the transcriptional
synergism brought about by the functional interplay between the
B3,
B4, and GAS sites. Accordingly, the deletion of the -449 to -352
ECS-I
3 region results in about 50% reduction of the CD40L- and
IL-4-induced synergism.
In both CL-01 and naive B cells, CD40L-induced NF-
B
binding to the C
3 CD40 RE is strongly enhanced by IL-4.
This enhancement may rely on the ability of IL-4 to amplify the
recruitment of TNFR-associated signal transducers, including
TNFR-associated factor-2 (TRAF-2), a well-known NF-
B activator, to
the CD40-signaling complex (46, 47). Alternatively, IL-4 might increase
the levels of active NF-
B/Rel by enhancing the CD40-mediated
degradation of I
Bß molecules. Consistent with this hypothesis is
the demonstration that IFN-
enhances the TNF-
-induced NF-
B
activation by amplifying the TNF-
-dependent degradation of I
Bß
proteins (48). Whether the IL-4-mediated enhancement of NF-
B/Rel
binding to the C
3 CD40 RE is due directly to enhanced NF-
B
activation or augmented degradation of I
Bß proteins is presently
addressed in our laboratory using human CL-01 cells. In conclusion, our
demonstration that CD40L and IL-4 cooperatively induce the ECS and
activate I
3-C
3 germline transcription provides a mechanistic
explanation for the documented synergism between CD40L and IL-4-induced
signals in effecting Sµ
S
3 DNA recombination and may constitute
a paradigm for the structure-function analysis of other human C
gene
regulatory regions.
| Acknowledgments |
|---|
3
region.We thank Dr. Satwant Narula (Schering-Plough) for providing us
with rIL-4. | Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Paolo Casali, Weill Medical College of Cornell University, 1300 York Avenue, New York, NY 10021. E-mail address: ![]()
3 Abbreviations used in this paper: S, switch (region); I, intervening (region); IH-CH, germline Ig transcript; CD40L, CD40 ligand; RE, responsive element; ECS, evolutionarily conserved sequence; VHDJH-CH, productive Ig transcript; C/EBP, CCAAT/enhancer-binding protein; BSAP, B cell lineage-specific activator protein; GAS, IFN-
activation site; wt, wild type; ISRE, IFN-stimulated responsive element; BCR, B cell receptor. ![]()
Received for publication September 15, 1998. Accepted for publication February 3, 1999.
| References |
|---|
|
|
|---|
regions and their participation in sequential switching to IgE. J. Immunol. 155:3021.[Abstract]
2b transcripts: evidence for directed heavy chain class switching. Cell 53:177.[Medline]
2b transcripts. Mol. Cell. Biol. 8:1849.
genes in an IgM-producing human neoplastic B cell line that switches to IgG-producing cells. Int. Immunol. 1:631.
transcripts: interleukin-4 plus lipopolysaccharide-directed switching to C
. Mol. Cell. Biol. 10:1672.
heavy chain transcripts induced by interleukin 4. Proc. Natl. Acad. Sci. USA 87:1581.
and sequential Sµ-S
, S
-S
DNA recombination. J. Immunol. 161:5217.
promoter: regulation by NF-IL-4, a C/EBP family member and NF-
B/p50. J. Exp. Med. 181:181.
and IL-4 response element present in the germ-line
1 Ig promoter. J. Immunol. 154:4513.[Abstract]
B/Rel by CD40 engagement induces the mouse germ line immunoglobulin C
1 promoter. Mol. Cell. Biol. 16:4591.[Abstract]
germline transcripts in B cells via activation of NF-
B: synergy with IL-4 induction. J. Immunol. 158:4769.[Abstract]
B knockout mice have selective defects in proliferation, differentiation, germ-line CH transcription, and Ig class switching. J. Immunol. 156:183.[Abstract]
germline transcript: identification of a novel IL-4 responsive element. J. Immunol. 150:5408.[Abstract]
promoter. Int. Immunol. 7:1529.
germline promoter. J. Immunol. 158:5874.[Abstract]
B/Rel in the IL-4-induced up-regulation of the human IgE germline promoter. J. Immunol. 159:3330.[Abstract]
1 and I
2 germline promoter elements: proximal positive and distal negative elements may regulate the tissue specific expression of C
1 and C
2 germline transcripts. Int. Immunol. 5:271.
1 region contains a TGF-ß1 responsive enhancer and a putative recombination hotspot. Int. Immunol. 7:1191.
3 constant region gene of human immunoglobulin. Int. Immunol. 3:647.
transcription. J. Immunol. 152:2904.[Abstract]
1 promoter: involvement of C/enhancer-binding protein transcription factors and their possible interaction with an NF-IL-4 site. J. Immunol. 153:2983.[Abstract]
subclass-specific isotype switch: switching to
1,
3, and
4, but not
2. J. Immunol. 155:2318.[Abstract]
B associates with the NF-IL6 transcription factor. Proc. Natl. Acad. Sci. USA 89:8145.
B and C/EBP family members: a Rel domain-bZIP interaction. Mol. Cell. Biol. 13:3964.
B. Mol. Cell. Biol. 13:7191.
B and function in the activation of the E-selectin promoter in response to cytokines. Mol. Cell. Biol. 13:7180.
B by TNF receptor 2 and CD40. Science 269:1424.
B by tumor necrosis factor
and
interferon via enhanced I
B
degradation and de novo I
Bß degradation. Mol. Cell. Biol. 17:6746.[Abstract]
This article has been cited by other articles:
![]() |
W. Xu, P. A. Santini, A. J. Matthews, A. Chiu, A. Plebani, B. He, K. Chen, and A. Cerutti Viral Double-Stranded RNA Triggers Ig Class Switching by Activating Upper Respiratory Mucosa B Cells through an Innate TLR3 Pathway Involving BAFF J. Immunol., July 1, 2008; 181(1): 276 - 287. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. T. Thieu, E. T. Nguyen, B. P. McCarthy, H. A. Bruns, R. Kapur, C.-H. Chang, and M. H. Kaplan IL-4-stimulated NF-{kappa}B activity is required for Stat6 DNA binding J. Leukoc. Biol., August 1, 2007; 82(2): 370 - 379. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Martin, J. Roy, C. Barat, M. Ouellet, C. Gilbert, and M. J. Tremblay Human Immunodeficiency Virus Type 1-Associated CD40 Ligand Transactivates B Lymphocytes and Promotes Infection of CD4+ T Cells J. Virol., June 1, 2007; 81(11): 5872 - 5881. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. L. Dryer and L. R. Covey A Novel NF-{kappa}B-Regulated Site within the Human I{gamma}1 Promoter Requires p300 for Optimal Transcriptional Activity J. Immunol., October 1, 2005; 175(7): 4499 - 4507. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, X. Qiao, and A. Cerutti CpG DNA Induces IgG Class Switch DNA Recombination by Activating Human B Cells through an Innate Pathway That Requires TLR9 and Cooperates with IL-10 J. Immunol., October 1, 2004; 173(7): 4479 - 4491. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. C. Kim, C. R. Edmonston, X. Wu, A. Schaffer, and P. Casali The HoxC4 Homeodomain Protein Mediates Activation of the Immunoglobulin Heavy Chain 3' hs1,2 Enhancer in Human B Cells: RELEVANCE TO CLASS SWITCH DNA RECOMBINATION J. Biol. Chem., October 1, 2004; 279(40): 42258 - 42269. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Dedeoglu, B. Horwitz, J. Chaudhuri, F. W. Alt, and R. S. Geha Induction of activation-induced cytidine deaminase gene expression by IL-4 and CD40 ligation is dependent on STAT6 and NF{kappa}B Int. Immunol., March 1, 2004; 16(3): 395 - 404. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. He, N. Raab-Traub, P. Casali, and A. Cerutti EBV-Encoded Latent Membrane Protein 1 Cooperates with BAFF/BLyS and APRIL to Induce T Cell-Independent Ig Heavy Chain Class Switching J. Immunol., November 15, 2003; 171(10): 5215 - 5224. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Chen, R. Lund, T. Aittokallio, M. Kosonen, O. Nevalainen, and R. Lahesmaa Identification of Novel IL-4/Stat6-Regulated Genes in T Lymphocytes J. Immunol., October 1, 2003; 171(7): 3627 - 3635. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Schaffer, E. C. Kim, X. Wu, H. Zan, L. Testoni, S. Salamon, A. Cerutti, and P. Casali Selective Inhibition of Class Switching to IgG and IgE by Recruitment of the HoxC4 and Oct-1 Homeodomain Proteins and Ku70/Ku86 to Newly Identified ATTT cis-Elements J. Biol. Chem., June 13, 2003; 278(25): 23141 - 23150. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cerutti, H. Zan, E. C. Kim, S. Shah, E. J. Schattner, A. Schaffer, and P. Casali Ongoing In Vivo Immunoglobulin Class Switch DNA Recombination in Chronic Lymphocytic Leukemia B Cells J. Immunol., December 1, 2002; 169(11): 6594 - 6603. [Abstract] [Full Text] [PDF] |
||||
![]() |
C.-s. Mao and J. Stavnezer Differential Regulation of Mouse Germline Ig {gamma}1 and {epsilon} Promoters by IL-4 and CD40 J. Immunol., August 1, 2001; 167(3): 1522 - 1534. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cerutti, A. Schaffer, R. G. Goodwin, S. Shah, H. Zan, S. Ely, and P. Casali Engagement of CD153 (CD30 Ligand) by CD30+ T Cells Inhibits Class Switch DNA Recombination and Antibody Production in Human IgD+ IgM+ B Cells J. Immunol., July 15, 2000; 165(2): 786 - 794. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zan, Z. Li, K. Yamaji, P. Dramitinos, A. Cerutti, and P. Casali B Cell Receptor Engagement and T Cell Contact Induce bcl-6 Somatic Hypermutation in Human B Cells: Identity with Ig Hypermutation J. Immunol., July 15, 2000; 165(2): 830 - 839. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES J. Biol. Chem., February 23, 2001; 276(9): 6675 - 6688. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |