The JI PBL Intereron Source
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kojima, H.
Right arrow Articles by Kurimoto, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kojima, H.
Right arrow Articles by Kurimoto, M.
The Journal of Immunology, 1999, 162: 5063-5069.
Copyright © 1999 by The American Association of Immunologists

An Essential Role for NF-{kappa}B in IL-18-Induced IFN-{gamma} Expression in KG-1 Cells

Hirotada Kojima1, Yasushi Aizawa, Yoshiaki Yanai, Katsue Nagaoka, Makoto Takeuchi, Tsunetaka Ohta, Hakuo Ikegami, Masao Ikeda and Masashi Kurimoto

Fujisaki Institute, Hayashibara Biochemical Laboratories Inc., Fujisaki, Okayama, Japan


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 is a multifunctional cytokine playing various regulatory roles in the immune system including induced cytokine production. As a part of our ongoing studies on the molecular mechanisms of IL-18-induced IFN-{gamma} production, we have examined the transcriptional regulation of the IFN-{gamma} gene by IL-18 in a human myelomonocytic cell line, KG-1. On the basis of DNA/protein binding, we have determined an IL-18-inducible NF-{kappa}B binding site located at -786 to -776 of the IFN-{gamma} gene regulatory region (designated KBBsite). Transient transfection of promoter-reporter gene constructs revealed that the KBBsite is required for full IL-18-induced activation of the IFN-{gamma} gene transcription induced by IL-18. In addition, stable transformants of a dominant-negative form of the I{kappa}B{alpha} showed an inhibition of IL-18-dependent I{kappa}B{alpha} degradation, NF-{kappa}B activation, and expression of IFN-{gamma}. These results are the first to show the actual significance of the NF-{kappa}B pathway in the regulation of IFN-{gamma} gene expression by IL-18.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
Interleukin-18 was identified as an IFN-{gamma}-inducing factor, which induced IFN-{gamma} in the sera of mice preinjected with heat-killed Propionibacterium acnes and LPS (1). IL-18 induces IFN-{gamma} production from T, B, and NK cells (2, 3, 4, 5, 6), enhances NK cell activity (2, 3), activates Fas ligand-mediated cytotoxicity (7, 8), and augments antitumor immunity (9, 10, 11). These findings suggest that IL-18 acts as an important immunomodulator (reviewed in 12). However, the intracellular pathways by which IL-18 exerts such diverse functions remain largely unknown. To understand the mechanisms of action of IL-18, it is important to elucidate the molecular basis of the IL-18/IL-18R-mediated signal transduction pathways leading to the expression of a specific phenotype. We have been focusing on IL-18-induced early events in both the cytoplasm and the nucleus, which result in the transcriptional activation of IL-18-inducible cytokine genes. We have demonstrated that IL-18 rapidly induces the degradation of I{kappa}B{alpha} and the activation of NF-{kappa}B in a Th1 clone (13). Recently, we also identified IL-18R, which was known previously as the orphan receptor, IL-1R-related protein (14, 15). The transfection of IL-18R cDNA into COS cells resulted in functional receptor expression that was capable of initiating responses leading to NF-{kappa}B activation (15). Recently, we and others have shown that IL-18/IL-18R-mediated signaling may share the IL-1R-associated kinase/TNF-{alpha} receptor-associated factor-6 (TRAF6)2 pathway through NF-{kappa}B activation with the IL-1/IL-1R system (16, 17). There are many reports showing that NF-{kappa}B is critical for the expression of IL-1-induced target genes (e.g., IL-8 and endothelial leukocyte adhesion molecule-1) (reviewed in 18). Thus, considering the IFN-{gamma} expression induced by IL-18, we hypothesized that IL-18-induced NF-{kappa}B activation is involved in the regulation of IFN-{gamma} gene expression. Although the involvement of NF-{kappa}B in the regulation of IFN-{gamma} gene expression has been proposed previously, there was little direct evidence in support of this possibility. In this study, we provide evidence for and report on the significance of the NF-{kappa}B pathway in IL-18-induced IFN-{gamma} gene expression.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Cells and cell culture

KG-1 human myelomonocytic cells (CCL246; American Type Culture Collection, Manassas, VA) were grown in RPMI 1640 medium supplemented with 10% FCS (Dainippon Pharmaceutical, Osaka, Japan), 60 µg/ml penicillin, and 50 µg/ml streptomycin.

Cytokines, Abs, and reagents

Human rIL-18 was prepared from cultures of human IL-18 cDNA-expressing Escherichia coli as described previously (3). The purity of rIL-18 was >95% as assessed by SDS-PAGE, and the endotoxin content was less than the detectable limit of 1 ng/mg as measured by the Limulus amebocyte lysate assay (Seikagaku Kogyo, Tokyo, Japan). Anti-I{kappa}B{alpha} Ab and Abs to the NF-{kappa}B family members p50 and p65 were obtained from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-FLAG M2 Ab was purchased from IBI-Kodak (Rochester, NY).

Electrophoretic mobility shift assays

EMSAs were performed as described previously (13) using radio-labeled double-stranded oligonucleotides. The following oligonucleotides were used as probes or competitors: KBBsite wild-type (wt), CGTCTGGAACTCCCCCTGGG; KBBsite mutant, CGTCTGGAACTCggggTGGG; CD28 response element (CD28RE), GTCTAAAGGAAACTCTAACTAC; C3, AGGGATTTATGAATTTTCCAAAAGATGGG; and collagenase 12-O-tetradecanoylphorbol 13-acetate-responsive element (TRE), CTAGTGATGAGGTCAGCCGGATC.

Plasmid construction

The human IFN-{gamma} promoter-driven luciferase construct was established by PCR amplification of the IFN-{gamma} promoter region from the genomic DNA of KG-1 cells. The PCR product encoding the region from -791 to +64 of the IFN-{gamma} 5' flanking region with or without the KBBsite mutant depicted in Fig. 3GoB was inserted into a KpnI/SacI site of the PGL-3 basic vector (Promega, Madison, WI) and was designated IFN-{gamma}(-791/+64)Luc and IFN-{gamma}(-791/+64 mKBBsite)Luc, respectively. Sequences of both constructs were verified by dideoxy DNA sequencing methods. To make a minimal IL-8 promoter-luciferase construct (19), plasmid IL-8 (pIL-8) mini Luc, -50 to +44 of the human IL-8 promoter containing a TATA box was cloned by PCR and inserted at BglII/HindIII sites of the PGL-3 basic vector. The oligonucleotides containing NF-{kappa}B binding elements or mutants inserted into the pIL-8 mini Luc were as follows: 3XNF-{kappa}B wt, GGAACTCCCCCTGGAACTCCCCCTGGAACTCCCCCT; 3XNF-{kappa}B mutant, GGAACTCggggTGGAACTCggggTGGAACTCggggT.



View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 3. Functional analysis of KBBsite. A, Functional analysis using a heterogeneous promoter system. KG-1 cells were transfected with one of the indicated luciferase reporter plasmids containing the minimal IL-8 promoter driven by three repeats of either KBBsite wt (KBBsite/IL-8 mini Luc), mutant (mKBBsite/IL-8 mini Luc), IL-8 mini Luc, or PGL-3 basic vector (without promoter). B, Functional analysis using an endogenous IFN-{gamma} promoter system. KG-1 cells were transfected with IFN-{gamma}(-791/+64)Luc, IFN-{gamma}(-791/+64 mKBBsite)Luc, or parental PGL-3 basic vector. pEF/Rluc was cotransfected in both experiments to normalize the transfection efficiency. At 24 h posttransfection, the transfected cells were stimulated with 50 ng/ml of IL-18 for 5 h and examined for luciferase activity. All firefly luciferase activities were normalized with Renilla luciferase activities; next, an average from triplicate independent samples was determined. The SD was always within 10% of the average value. Similar results were obtained in more than two independent experiments.

 
Complementary oligonucleotides were made to give a KpnI restriction site at the 5' end and a SacI site at the 3' end, respectively. These oligonucleotides were annealed and inserted upstream of the minimal IL-8 promoter at the KpnI/SacI sites of pIL-8 mini Luc. To normalize the efficiency of transfection, we constructed a Renilla reniforms luciferase expression vector with an elongation factor-1 promoter derived from pEF-BOS (20) and PRL-null vector (Promega) and designated this pEF/Rluc.

The I{kappa}B{alpha} double-point mutants (I{kappa}B{alpha}M) were generated by PCR (21). The oligonucleotide sequence CACGACgccGGCCTGGACgccATGA was used as a sense primer. Epitope-tagged derivatives of I{kappa}B{alpha}M were constructed by PCR-assisted amplification with 5' primers that fused Kozak’s sequence (22) and the sequence encoding the FLAG (DYKDDDDK) in frame with the N-terminal coding sequence of I{kappa}B{alpha}. The mutated PCR fragments were cloned into the eukaryotic expression vector pcDNA3 (Invitrogen, San Diego, CA) and verified by DNA sequence analysis (designated pCDI{kappa}B{alpha}M).

Luciferase assay

KG-1 cells (2 x 107) suspended in RPMI 1640 medium were transfected by electroporation (250 V, 960 µF) with 40 µg of the reporter gene and 0.4 µg of pEF/Rluc using a Bio-Rad Gene Pulser equipped with a capacitance extender (Bio-Rad, Hercules, CA). pEF/Rluc was used to normalize the transfection efficiency. Electroporated cells were transferred to RPMI 1640 medium and subsequently expanded for 24 h. Luciferase activity was examined by a dual-luciferase reporter assay system (Promega) according to the manufacturer’s instructions.

Transformation of KG-1 cells

To make stable transformants of KG-1 cells expressing dominant-negative I{kappa}B{alpha}, pCDI{kappa}B{alpha}M was transfected into KG-1 cells by the electroporation technique; transformants were selected with 400 µg/ml of G418. A total of 11 positive clones were obtained. Results with a representative clone, I{kappa}B{alpha}M no. 12, are shown throughout this study.

Western blotting

Cells (2 x 107) were harvested after stimulation with IL-18 and suspended in 1 ml of lysis buffer (0.2% Nonidet P-40, 20 mM HEPES-KOH (pH 7.8), 150 mM NaCl, 1 mM sodium vanadate, 5 µg/ml aprotinin, and 5 µg/ml leupeptin). The lysates were cleared by centrifugation, separated on an SDS 10–20% polyacrylamide gel, and transferred to polyvinylidene difluoride membranes (Immobilon P, Millipore, Bradford, MA). The membranes were incubated with either 0.5 µg/ml anti-I{kappa}B{alpha} Ab or 1 µg/ml anti-FLAG M2 Ab for 1 h at room temperature, washed three times with TBST (20 mM Tris-HCl (pH 7.4), 150 mM NaCl, and 0.1% Tween 20), and incubated with 1/5000 diluted HRP-conjugated swine anti-rabbit or anti-mouse Abs (Dako, Glostrup, Denmark). After washing, immunocomplexes were visualized using an enhanced chemiluminescence system (Amersham, Buckinghamshire, U.K.).

IFN-{gamma} ELISA

Cells (3 x 106) were seeded in 2 ml of complete medium in 12-well culture plates; next, IL-18 was added. The plates were incubated for 24 h, and culture supernatants were collected. The assay for IFN-{gamma} was performed using a sandwich ELISA system that was specific for human IFN-{gamma} and developed at our institute (23).

Total RNA extraction and RT-PCR

The preparation of total cellular RNA, first-strand cDNA synthesis, and PCR amplification were performed as described previously (24). The sequences of the 5' and 3' oligonucleotide primers and the sizes of their products, respectively, are: IFN-{gamma}, 5'-CAGGTCATTCAGATGTAGCG-3', 5'-TGGGATGCTCTTCGACCTCG-3', 380 bp; IL-6, 5'-AGAGAAGCTCTATCTCCCCTC-3', 5'-CAACAATCTGAGGTGCCCATG-3', 302 bp; p53, 5'-TAGTGTGGTGGTGCCCTATGAGCCG-3', 5'-TTCTGCAGTGCTCGCTTAGTGCTCC-3', 289 bp; and ß-actin, 5'-TCCTGTGGCATCCACGAAACT-3', 5'-GAAGCATTTGCGGTGGACGAT-3', 314 bp. Amplification was conducted as follows: step 1: 30 cycles at 94°C for 1 min, at 52°C for 1 min, and at 72°C for 1 min; step 2: at 72°C for 10 min. An aliquot of each reaction mixture was electrophoresed on 1.5% agarose gels, stained with ethidium bromide, and photographed. Bands were scanned and quantified with a densitometer (Image Master DTS, Pharmacia, Uppsala, Sweden).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Effects of cycloheximide (CHX) on IL-18-induced IFN-{gamma} expression

We reported previously that a human acute myelogenous leukemic cell line, KG-1, produces IFN-{gamma} in response to IL-18 even in the absence of any costimulatory signal (23, 24). To determine whether de novo protein synthesis is required for the expression of the IFN-{gamma} gene, we performed RT-PCR on total RNA from KG-1 cells. KG-1 cells were stimulated with IL-18 for either 30 min or 2 h (Fig. 1Go, lanes 2 and 3) or with IL-18 plus CHX for 30 min after a 30-min pretreatment with CHX (Fig. 1Go, lanes 5 and 6). As shown in Fig. 1Go, IL-18 stimulation for 2 h induced a 10-fold increase in the IFN-{gamma} transcript over that in unstimulated control cells (Fig. 1Go, upper panel, compare lane 1 with lane 3). Furthermore, CHX did not block the IL-18-induced transcription of IFN-{gamma} (Fig. 1Go, lanes 5 and 6). The quality of CHX was guaranteed, because the accumulation of IL-18-induced p53 mRNA was abolished in the presence of CHX (Fig. 1Go, middle panel). This result suggests that a rapid induction of IFN-{gamma} gene expression in KG-1 cells by IL-18 does not require ongoing protein synthesis.



View larger version (31K):
[in this window]
[in a new window]
  		FIGURE 1. Effects of CHX on IL-18-induced IFN-{gamma} expression. RT-PCR was performed on total RNA from unstimulated KG-1 cells (lane 1), KG-1 cells stimulated with 50 ng/ml of IL-18 for 30 min (lane 2) or 2 h (lane 3), and KG-1 cells pretreated with 10 µg/ml of CHX for 30 min (lane 4) followed by IL-18 stimulation for 30 min (lane 5) or 2 h (lane 6). Following reverse transcription, PCR was conducted with specific primers for IFN-{gamma} (upper panel), p53 (middle panel), and ß-actin (lower panel). The data shown are representative of one experiment of two.

 
DNA binding activities induced by IL-18 on various potential NF-{kappa}B binding sites in the IFN-{gamma} gene regulatory region

As mentioned in the introduction, we have shown previously that IL-18 activates NF-{kappa}B. NF-{kappa}B participates in the regulation of genes encoding proteins involved in immune or inflammatory responses and cell growth control (25). Thus, we asked whether IL-18-activated NF-{kappa}B protein binds to the regulatory region of the IFN-{gamma} gene. There are some reports on putative NF-{kappa}B family binding sites in the IFN-{gamma} gene regulatory region (Table IGo), such as region -786 to -776 of the NF-{kappa}B binding site (26), designated KBBsite, region -162 to -154 of the CD28 response element-like site (CD28RE) (27) in the 5' flanking region, and position +459 to +470 of the c-Rel binding site (C3) (28) in the first intron. However, there was little direct evidence showing the significance of NF-{kappa}B in IFN-{gamma} expression. We examined the binding activities in nuclear proteins of KG-1 cells to the various putative NF-{kappa}B binding sites by EMSA. As shown in Fig. 2GoA, lanes 1 and 2, IL-18 induced DNA binding activity to KBBsite. However, no obvious inducible complex was formed with the CD28RE or C3 sites (Fig. 2GoB). Binding to the KBBsite was sequence-specific, because the complex did not form with the probe mutated at the NF-{kappa}B binding site (Fig. 2GoA, lanes 3 and 4). In addition, formation of the complex was blocked by excess unlabeled KBBsite or IL-2 NF-{kappa}B oligonucleotide but not by excess mutated NF-{kappa}B binding site (data not shown). To identify the components in the KBBsite complex, a supershift assay was performed. As shown in Fig. 2GoC, the upper band is composed of the p65/p50 heterodimer; the lower band is composed of the p50/p50 homodimer of the NF-{kappa}B subunit. The profiles of these complexes were the same as the IL-18-inducible complexes in the NF-{kappa}B binding site (positions -205 to -195) of the IL-2 promoter (13, 17). We also used several other Abs specific to the other members of the NF-{kappa}B family, including NF-{kappa}B2/p52, c-Rel, and RelB, to determine any possible involvement. However, preincubation of the binding mixtures with these Abs did not inhibit or retard formation of the complex (data not shown).


View this table:
[in this window]
[in a new window]
  		Table I. Sequences of potential NF-{kappa}B binding sites in the IFN-{gamma} gene regulatory region1

 


View larger version (56K):
[in this window]
[in a new window]
  		FIGURE 2. DNA binding activities induced by IL-18 on various NF-{kappa}B binding sites in the IFN-{gamma} promoter and first intron. An EMSA was performed using 32P-labeled oligonucleotides containing KBBsite wt (lanes 1 and 2) and mutant (lanes 3 and 4) (A), CD28RE site (lanes 1 and 2) (B), and C3 site (lanes 3 and 4) (B). Nuclear extracts from IL-18-stimulated cells (50 ng/ml, panels A and B, lanes 2 and 4) or unstimulated cells (panels A and B, lanes 1 and 3) were used. The positions corresponding to inducible binding proteins are indicated by arrowheads. C, RelA (p65) and NF-{kappa}B1 (p50) are components of the IL-18-induced KBBsite bound complex. The reaction mixtures were preincubated with diluent (lane 1), control rabbit IgG (normal IgG (nIgG), lane 2), anti-p50 Ab (lane 3), or anti-p65 Ab (lane 4).

 
KBBsite is required for maximal IFN-{gamma} promoter responsiveness to IL-18

Next, to investigate the functional significance of NF-{kappa}B binding to the KBBsite, we tested the IL-18 responsiveness of KG-1 cells in transient transfection assays using reporter plasmids containing three copies of KBBsite wt and mutant, which was inserted upstream of the minimal IL-8 promoter (-50/+44) (19) linked to the luciferase gene (depicted in Fig. 3GoA). Their luciferase activities were assessed following treatment with IL-18. As shown in Fig. 3GoA, the wt construct resulted in a 10-fold increase in luciferase activity. However, mutation of the NF-{kappa}B binding site merely reduced the basal levels and the response to IL-18. These results provide evidence for a functional significance of KBBsite as an enhancer element for transcription of the IFN-{gamma} gene. To confirm the functional role of KBBsite in the context of a naive IFN-{gamma} promoter, we generated a site-directed mutation within the KBBsite of the IFN-{gamma} promoter that selectively abolished the binding activity of KBBsite (Fig. 2GoA). As shown in Fig. 3B, transfection of the wt construct resulted in a 3.2-fold increase in luciferase activity. However, mutation of the KBBsite merely reduced the basal level and the fold luciferase induction in response to IL-18. Taken together, this evidence supports the functional role of KBBsite as an enhancer region participating in IL-18-induced transcriptional activity of the IFN-{gamma} gene.

Establishment of a KG-1 transformant stably expressing the dominant-negative form of I{kappa}B{alpha}

To extend further and to confirm the above findings, we have addressed directly the question of whether the activation of NF-{kappa}B plays a critical role in IL-18-inducible IFN-{gamma} expression. Thus, to suppress the activation of NF-{kappa}B, we constructed an expression plasmid encoding a FLAG-tagged dominant-negative form of I{kappa}B{alpha} (designated I{kappa}B{alpha}M) and stably transfected it into KG-1 cells. We established multiple G418-resistant KG-1 transformants expressing I{kappa}B{alpha}M (designated KG-1/I{kappa}B{alpha}M). The expression levels of the transfected I{kappa}B{alpha}M were determined by Western blotting with anti-FLAG mAb (M2) or anti-I{kappa}B{alpha} polyclonal Ab. Next, we selected several transformants that expressed I{kappa}B{alpha}M at comparable levels of endogenous I{kappa}B{alpha} protein and used at least three independent clones (clones 5, 11, and 12) in the following experiments. Results with a representative clone, clone 12, are shown in this study. In KG-1/I{kappa}B{alpha}M, no degradation of endogenous I{kappa}B{alpha} or exogenously expressed I{kappa}B{alpha}M itself was observed in response to IL-18 (Fig. 4Go).



View larger version (33K):
[in this window]
[in a new window]
  		FIGURE 4. Inhibition of IL-18-induced I{kappa}B{alpha} degradation in KG-1 cells transfected with a dominant-negative form of I{kappa}B{alpha}. The G418-resistant clone cells (control, lanes 3, 4, 7, and 8) and KG-1/I{kappa}B{alpha}M cells (I{kappa}B{alpha}M, lanes 1, 2, 5, and 6) were stimulated with 50 ng/ml of IL-18 for 30 min (lanes 2, 4, 6, and 8). Whole cell extracts were separated by SDS-PAGE (10–20%) and then immunoblotted (Western blotted (WB)) with anti-FLAG M2 Ab (left panel) or anti-I{kappa}B{alpha} Ab (right panel). Results with only one representative clone (clone 12) are shown.

 
Inhibition of IL-18-induced IFN-{gamma} production in KG-1/I{kappa}B{alpha}M cells

Next, we examined the effect of I{kappa}B{alpha}M on IL-18-induced IFN-{gamma} production. IFN-{gamma} production was dramatically decreased by >99% in KG-1/I{kappa}B{alpha}M cells compared with controls following stimulation with IL-18 (Table IIGo). RT-PCR experiments showed that the decrease in IFN-{gamma} production occurred at the transcriptional level (Fig. 5Go, upper panel). These results suggested that IL-18-induced NF-{kappa}B activation is critical for IL-18-modulated IFN-{gamma} gene regulation. IL-18-induced IL-6 expression was also inhibited in KG-1/I{kappa}B{alpha}M cells (Fig. 5Go, middle panel). In addition, IL-18-induced IL-6 expression did not require ongoing protein synthesis (data not shown). Taken together, it seems likely that an essential role for NF-{kappa}B is a common event in the cytokine gene expression induced by IL-18.


View this table:
[in this window]
[in a new window]
  		Table II. Inhibition of IL-18-induced IFN-{gamma} production in KG-1/{kappa}B{alpha}M cells1

 


View larger version (42K):
[in this window]
[in a new window]
  		FIGURE 5. IL-18-induced expression of IFN-{gamma} and IL-6 was inhibited by the dominant-negative form of I{kappa}B{alpha}. The total RNA from G418-resistant clone cells (control), KG-1/I{kappa}B{alpha}M cells without stimulation (lanes 1 and 4), and KG-1/I{kappa}B{alpha}M cells stimulated with 50 ng/ml of IL-18 for 30 min (lanes 2 and 5) or 2 h (lanes 3 and 6) was isolated. Following reverse transcription, PCR was conducted with specific primers for IFN-{gamma} (upper panel), IL-6 (middle panel), and ß-actin (lower panel). The data shown are representative of one experiment of two.

 
Inhibition of NF-{kappa}B binding activity in KG-1/I{kappa}B{alpha}M cells

To link the suppression of IFN-{gamma} expression in KG-1/I{kappa}B{alpha}M cells with the function of KBBsite, EMSAs with KBBsite as a probe were performed. In control KG-1 cells after treatment with IL-18, both the p65/p65 and p50/p50 dimers could be observed, whereas little or no KBBsite binding activity was observed in KG-1/I{kappa}B{alpha}M cells (Fig. 6GoA). Recently, IL-18 has been shown to activate activation protein-1 (AP-1) in primary CD4+ T cells (29). We also observed IL-18-inducible AP-1 binding activity in KG-1 cells (Fig. 6GoB, lanes 1 and 2). The extracts from IL-18-stimulated KG-1/I{kappa}B{alpha}M cells did show binding activity to a collagenase TRE probe that contains a typical AP-1 binding site (Fig. 6GoB, lane 4), indicating that I{kappa}B{alpha}M may not affect other signaling pathways. p65 and p50 proteins do not appear to be mutated, because hyperosmotic stress, which induces NF-{kappa}B without the phosphorylation of serines 32 and 36 of I{kappa}B{alpha} (30), can induce KBBsite binding activity in KG-1/I{kappa}B{alpha}M cells (Fig. 6GoA, lane 5). The supershift assay using anti-p65 and anti-p50 Abs revealed that the upper band is composed of the p65/p50 heterodimer and the lower band is composed of the p50/50 homodimer of the NF-{kappa}B subunit (data not shown). The above results indicate that the binding of NF-{kappa}B to KBBsite is one of the mechanisms involved in IL-18-induced IFN-{gamma} gene transcription.



View larger version (43K):
[in this window]
[in a new window]
  		FIGURE 6. Inhibition of NF-{kappa}B binding activity in KG-1 cells expressing a dominant-negative form of I{kappa}B{alpha}. A, EMSA of nuclear extracts prepared from the G418-resistant clone (control) or KG-1/I{kappa}B{alpha}M cells with a 32P-end-labeled KBBsite oligonucleotide probe. Nuclear extracts from unstimulated cells (lanes 1 and 3), IL-18-stimulated cells (lanes 2 and 4), or 0.4 M sorbitol-stimulated cells (lane 5) were used. B, EMSA with the AP-1 binding consensus probe (TRE of the collagenase gene promoter). Samples and lane numbers are as in A.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
IL-18 was originally identified as an IFN-{gamma}-inducing factor, and IFN-{gamma} acts as an important effector molecule involved in various immune responses (12). In this study, we have focused on the molecular mechanisms of IL-18-mediated regulation of IFN-{gamma} gene expression in the human acute myelogenous leukemic cell line, KG-1. KG-1 cells produce IFN-{gamma} in response to IL-18 even in the absence of any costimulatory signal (23, 24). We demonstrate in this study that IL-18 induced the NF-{kappa}B complex to bind to a region within the -786 to -776 site of the IFN-{gamma} promoter (designated KBBsite). In addition, we clarified that the enhancer effect via KBBsite was necessary for full IL-18-dependent activation of transcription. These data present the first functional evidence for the role of NF-{kappa}B in the IL-18-dependent regulation of IFN-{gamma} transcriptional activity. We also observed inducible KBBsite binding activity in nuclear extracts of KG-1 cells stimulated with either IL-1ß, TNF-{alpha}, or PMA (data not shown). These results also support the proposed functional role of KBBsite, and these phenomena are considered to be common events induced by various extracellular stimuli that trigger IFN-{gamma} expression. Parallel to the findings in these myelomonocytic cells, we also confirmed the involvement of KBBsite in IFN-{gamma} transcription in MOLT-16 T cells stimulated with IL-18 in the presence of PHA (data not shown). Recently, Sica et al. reported that the same NF-{kappa}B binding site is activated by PMA plus PHA in the human T cell line, Jurkat (31). These results show that the involvement of KBBsite in IFN-{gamma} gene regulation is not restricted to cells of the myeloid/monocytic lineages.

We have demonstrated previously that IL-18 shares the IL-1R-associated kinase/TRAF6 signal pathway with the IL-1 system (17), and this pathway may be linked to pathways active in the IL-1 system. In a recent study on the IL-1-activated NF-{kappa}B system, a kinase complex consisting of NF-{kappa}B-inducing kinase and two I{kappa}B kinases (IKK{alpha} and IKKß) was implicated in signal-induced phosphorylation of the I{kappa}B proteins (32, 33, 34, 35, 36, 37). After NF-{kappa}B-inducing kinase interacts with the TRAF proteins (33, 38), IKKs activate I{kappa}B{alpha} by the phosphorylation of both 32 and 36 serine residues in I{kappa}B{alpha}. To extend further and to confirm these findings, we have addressed directly the question of whether the activation of NF-{kappa}B plays a critical role in IL-18-inducible IFN-{gamma} expression. As reported elsewhere (39, 40, 41), the substitution of serines 32 and 36 of I{kappa}B{alpha} to alanine affects endogenous I{kappa}B{alpha} degradation in response to various extracellular stimuli such as IL-1, TNF-{alpha}, and LPS and is widely used as a selective tool for the study of the role of NF-{kappa}B in gene regulation. Thus, we made I{kappa}B{alpha} mutants that were expected to act in a dominant-negative manner. Mutants of I{kappa}B{alpha} with serine substituted for alanine at positions 32 and 36 (I{kappa}B{alpha}M) efficiently inhibited the IL-18-induced degradation of endogenous I{kappa}B{alpha}, NF-{kappa}B-binding activity, and IFN-{gamma} production but did not inhibit IL-18-inducible AP-1 in the stable transformants. The following explanation may be applied to the mechanisms by which I{kappa}B{alpha}M inhibits endogenous I{kappa}B{alpha} activity. I{kappa}B{alpha}M may inhibit the processing of I{kappa}B{alpha}, presumably by competing with endogenous I{kappa}B{alpha} protein for their recruitment to IKKs. These data indicated that NF-{kappa}B is one of the critical factors mediating transcription of the IFN-{gamma} gene in response to IL-18. Very recently, Adachi et al. reported that IL-18-induced IFN-{gamma} production is defective in the Th1 cells of mice lacking MyD88 generated by gene targeting, affecting signaling molecules upstream of the I{kappa}B{alpha}-NF-{kappa}B signaling pathway (42). Their indirect results support our conclusions, and these phenomena are therefore considered to be common events in cells responding to IL-18 by producing IFN-{gamma}.

In comparison with results with the loss of function mutant of the NF-{kappa}B-pathway, KBBsite-mediated transcriptional activity was not totally responsible in transient transfection assays. One possibility may be that other NF-{kappa}B-pathway acceptor sites exist in the transcriptional control region of the IFN-{gamma} gene. We could not detect any inducible complexes formed with the CD28RE or C3 sites. However, there are several other potential NF-{kappa}B family member binding sites that were not consensus regions but were homologous with the conventional NF-{kappa}B binding sequence in the promoter and in the first, second, and third introns of the IFN-{gamma} gene (26). The reason why the IFN-{gamma} gene expression level observed by RT-PCR was not comparable with that of the luciferase activity assay driven by the -791 to +64 sequence of the IFN-{gamma} 5' flanking region (fold induction of 10 and 3.3, respectively) could be similar. A search for other IL-18-inducible NF-{kappa}B binding sites in KG-1 cells is in progress. Alternatively, NF-{kappa}B may be essential but not sufficient for IL-18 inducible-IFN-{gamma} promoter activity. The involvement of other cis-activation elements may be necessary to achieve a maximal activation of IFN-{gamma} transcription. Synergism by cooperation between NF-{kappa}B and other transcription factors might be required for full IL-18-dependent activation of transcription. Earlier work on transcriptional regulation of the IFN-{gamma} promoter showed that various transcriptional factors were involved in regulation of the IFN-{gamma} gene, including c-Jun, c-Fos, activation transcription factor-2, GATA site-binding transcription factor, NF-AT, specificity protein-1, and yin and yang (yy)-1 (43, 44, 45, 46, 47, 48, 49). Very recently, Barbulescu et al. reported that the AP-1 binding site at -190 was characterized as a critical element for IL-18-inducible IFN-{gamma} promoter activity in primary CD4+ T cells (29). Actually, we also observed that IL-18 induced an AP-1 site binding complex in KG-1 cells (Fig. 6GoB). Therefore, the AP-1 site may also participate in the regulation of the IFN-{gamma} gene in KG-1 cells.

NF-AT is reported to be the transcriptional factor required for cytokine gene expression, especially in T cells (50). The involvement of NF-AT is of general interest in studies on the transcriptional regulation of cytokine gene expression. Cyclosporin A, a potent inhibitor of cytokine gene expression in lymphoid cells, did not significantly block the expression of IFN-{gamma} induced by IL-18 in KG-1 cells (our unpublished observations). As calcineurin, which is an activator of NF-AT, is a target of cyclosporin A, these data suggest that calcineurin may not play an important role in IL-18-mediated signaling in KG-1 cells. However, constitutive binding of the NF-AT protein in the -277 to -267 region of the IFN-{gamma} promoter, which is reported a PMA plus ionomycin-inducible NF-AT binding site in PBLs (45), was observed in KG-1 cells (our unpublished observations). Molecular machinery for a constitutive activation of NF-AT may exist in KG-1 cells. Therefore, the precise mechanisms of NF-AT protein involvement remain to be elucidated. Experiments to determine the involvement and cooperativity of these DNA-binding proteins in the regulation of IFN-{gamma} gene expression are currently ongoing in our laboratory. In addition, the possibility of IL-18-dependent regulation of IFN-{gamma} gene expression at the posttranscriptional level should also be addressed.

In conclusion, we identified a functional NF-{kappa}B binding site at -786 to -776 of the IFN-{gamma} promoter, and this site has turned out to be one of the major IL-18-responsive elements. In addition, NF-{kappa}B is crucial for IL-18-mediated IFN-{gamma} gene regulation, and the NF-{kappa}B activation pathway may be a potential therapeutic target in IL-18 signaling. Because IL-18 has recently been implicated in the onset of insulin-dependent diabetes mellitus in a mouse model (51), antagonists of NF-{kappa}B activating pathways, in combination with an appropriate drug delivery system, could prove applicable in the design of novel anti-IL-18 drugs.


   Acknowledgments
 
We thank Drs. M. J. Micallef and K. Nakajima for critical reading of the manuscript. We also thank Dr. S. Akira (Hyogo College of Medicine, Hyogo, Japan) for kindly providing the pEF-BOS plasmid. We gratefully acknowledge M. Fujii for human IL-18 and thank Y. Nishida, T. Okura, I. Okamoto, and K. Tsuji-Takayama for technical advice. Finally, we thank the entire staff of Fujisaki Institute for their support and helpful discussions.


   Footnotes
 
1 Address correspondence and reprint requests to Dr. Hirotada Kojima, Fujisaki Institute, Hayashibara Biochemical Laboratories Inc., 675-1 Fujisaki, Okayama 702-8006, Japan. E-mail address: Back

2 Abbreviations used in this paper: TRAF, TNF-{alpha} receptor associated factor; CHX, cycloheximide; AP-1, activation protein-1; wt, wild type; TRE, 12-O-tetradecanoylphorbol 13-acetate-responsive element; pIL, plasmid IL; CD28RE, CD28 response element. Back

Received for publication August 11, 1998. Accepted for publication January 25, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Okamura, H., H. Tsutsui, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  2. Micallef, M. J., T. Ohtsuki, K. Kohno, F. Tanabe, S. Ushio, M. Namba, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, S. Fukuda, M. Kurimoto. 1996. Interferon-{gamma}-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-{gamma} production. Eur. J. Immunol. 26:1647.[Medline]
  3. Ushio, S., M. Namba, T. Okura, K. Hattori, Y. Nukada, K. Akita, F. Tanabe, K. Konishi, M. Micallef, M. Fujii, et al 1996. Cloning of the cDNA for human IFN-{gamma}-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
  4. Hunter, C. A., J. Timans, P. Pisacane, S. Menon, G. Cai, W. Walker, M. Aste-Amezaga, R. Chizzonite, J. F. Bazan, R. A. Kastelein. 1997. Comparison of the effects of interleukin-1{alpha}, interleukin-1ß, and interferon-{gamma}-inducing factor on the production of interferon-{gamma} by natural killer. Eur. J. Immunol. 27:2787.[Medline]
  5. Kohno, K., J. Kataoka, T. Ohtsuki, Y. Suemoto, I. Okamoto, M. Usui, M. Ikeda, M. Kurimoto. 1997. IFN-{gamma}-inducing factor (IGIF) is a costimulatory factor on the activation of Th1 but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158:1541.[Abstract]
  6. Yoshimoto, T., H. Okamura, Y. I. Tagawa, Y. Iwakura, K. Nakanishi. 1997. Interleukin 18 together with interleukin 12 inhibits IgE production by induction of interferon-{gamma} production from activated B cells. Proc. Natl. Acad. Sci. USA 94:3948.[Abstract/Free Full Text]
  7. Dao, T., K. Ohashi, T. Kayano, M. Kurimoto, H. Okamura. 1996. Interferon-{gamma}-inducing factor, a novel cytokine, enhances Fas ligand-mediated cytotoxicity of murine T helper 1 cells. Cell. Immunol. 173:230.[Medline]
  8. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1997. IFN-{gamma}-Inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine NK cell clones. J. Immunol. 157:3967.[Abstract]
  9. Micallef, M. J., T. Tanimoto, K. Kohno, M. Ikeda, M. Kurimoto. 1997. Interleukin 18 induces the sequential activation of natural killer cells and cytotoxic T lymphocytes to protect syngeneic mice from transplantation with Meth A sarcoma. Cancer Res. 57:4557.[Abstract/Free Full Text]
  10. Micallef, M. J., K. Yoshida, S. Kawai, T. Hanaya, K. Kohno, S. Arai, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, M. Kurimoto. 1997. In vivo antitumor effects of murine interferon-{gamma}-inducing factor/interleukin-18 in mice bearing syngeneic Meth A sarcoma malignant ascites. Cancer Immunol. Immunother. 43:361.[Medline]
  11. Osaki, T., J. M. Peron, Q. Cai, H. Okamura, P. D. Robbins, M. Kurimoto, M. Lotze, H. Tahara. 1998. IFN-{gamma}-inducing factor/IL-18 administration mediates IFN-{gamma}- and IL-12-independent antitumor effects. J. Immunol. 160:1742.[Abstract/Free Full Text]
  12. Kohno, K., M. Kurimoto. 1998. Interleukin 18, a cytokine which resembles IL-1 structurally and IL-12 functionally but exerts its effect independently of both. Clin. Immunol. Immunopathol. 86:11.[Medline]
  13. Matsumoto, S., K. Tsuji-Takayama, Y. Aizawa, K. Koide, M. Takeuchi, T. Ohta, M. Kurimoto. 1997. Interleukin-18 activates NF-{kappa}B in murine T helper type 1 cells. Biochem. Biophys. Res. Commun. 234:454.[Medline]
  14. Parnet, P., K. E. Garka, T. P. Bonnert, S. K. Dower, J. E. Sims. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J. Biol. Chem. 271:3967.[Abstract/Free Full Text]
  15. Torigoe, K., S. Ushio, T. Okura, S. Kobayashi, M. Taniai, T. Kunikata, T. Murakami, O. Sanou, H. Kojima, M. Fujii, et al 1997. Purification and characterization of the human interleukin-18 receptor. J. Biol. Chem. 272:25737.[Abstract/Free Full Text]
  16. Robinson, D., K. Shibuya, A. Mui, F. Zonin, E. Murphy, T. Sana, S. B. Hartley, S. Menon, R. Kastelein, F. Bazan, A. O’Garra. 1997. IGIF does not drive Th1 development but synergizes with IL-12 for interferon-{gamma} production and activates IRAK and NF-{kappa}B. Immunity 7:571.[Medline]
  17. Kojima, H., M. Takeuchi, T. Ohta, Y. Nishida, N. Arai, M. Ikeda, H. Ikegami, M. Kurimoto. 1998. Interleukin-18 activates the IRAK-TRAF6 pathway in mouse EL-4 cells. Biochem. Biophys. Res. Commun. 244:183.[Medline]
  18. Dinarello, C. A.. 1996. Biologic basis for interleukin-1 in disease. Blood 87:2095.[Abstract/Free Full Text]
  19. Okamoto, S., N. Mukaide, K. Yasumoto, N. Rice, Y. Ishikawa, H. Horiguchi, S. Murakami, K. Matsusima. 1994. The interleukin-8 AP-1 and {kappa}B-like sites are genetic end targets of FK-506-sensitive pathway accompanied by calcium mobilization. J. Biol. Chem. 269:8582.[Abstract/Free Full Text]
  20. Mizushima, S., S. Nagata. 1990. pEF-BOS, a powerful mammalian expression vector. Nucleic Acids Res. 18:5322.[Free Full Text]
  21. Ho, S. N., H. D. Hunt, R. N. Horoton, J. K. Pullen, L. R. Pease. 1989. Site directed mutagenesis by overlap extension using the polymerase chain reaction. Gene 77:51.[Medline]
  22. Kozak, M.. 1987. An analysis of 5'-noncoding sequences from 699 vertebrate messenger RNAs. Nucleic Acids Res. 15:8125.[Abstract/Free Full Text]
  23. Konishi, K., F. Tanabe, M. Taniguchi, H. Yamauchi, M. Taniguchi, H. Yamauchi, T. Tanimoto, M. Ikeda, K. Orita, M. Kurimoto. 1997. A simple and sensitive bioassay for the detection of human interleukin-18/interferon-{gamma}-inducing factor using human myelomonocytic KG-1 cells. J. Immunol. Methods 209:187.[Medline]
  24. Ohtsuki, T., M. J. Micallef, K. Kohno, T. Tanimoto, M. Ikeda, M. Kurimoto. 1997. Interleukin 18 enhances Fas ligand expression and induces apoptosis in Fas-expressing human myelomonocytic KG-1 cells. Anticancer Res. 17:3253.[Medline]
  25. Jr Baldwin, A. S.. 1996. The NF-{kappa}B and I{kappa}B proteins: new discoveries and insights. Annu. Rev. Immunol. 14:649.[Medline]
  26. Young, H. A.. 1996. Regulation of interferon-{gamma} gene expression. J. Interferon Cytokine Res. 16:563.[Medline]
  27. Lai, J.-H., G. Horvath, J. Sbleski, J. Bruder, P. Ghosh, T.-H. Tan. 1995. RelA is a potent transcriptional activator of the CD28 response element within the interleukin 2 promoter. Mol. Cell. Biol. 15:4260.[Abstract]
  28. Sica, A., T. H. Tan, N. Rice, M. Kretzschmar, P. Ghosh, H. A. Young. 1992. The c-rel protooncogene product c-Rel but not NF-{kappa}B binds to the intronic region of the human interferon-{gamma} gene at a site related to an interferon-stimulable response element. Proc. Natl. Acad. Sci. USA 89:1740.[Abstract/Free Full Text]
  29. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K. M. Büschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-{gamma} promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
  30. Courtois, G., S. T. Whiteside, C. H. Sibley, A. Israel. 1997. Characterization of a mutant cell line that does not activate NF-{kappa}B in response to multiple stimuli. Mol. Cell. Biol. 17:1441.[Abstract]
  31. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NF-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text]
  32. DiDonato, J. A., M. Hayakawa, D. M. Rothwarf, E. Zandi, M. Karin. 1997. A cytokine-responsive I{kappa}B kinase that activates the transcription factor NF-{kappa}B. Nature 388:548.[Medline]
  33. Malinin, N. L., M. P. Boldin, A. V. Kovalenko, D. Wallach. 1997. MAP3K-related kinase involved in NF-{kappa}B induction by TNF, CD95, and IL-1. Nature 385:540.[Medline]
  34. Mercurio, F., H. Zhu, B. W. Murray, A. Shevchenko, B. L. Bennett, J. Li, D. B. Young, M. Barbosa, M. Mann, A. Manning, A. Rao. 1997. IKK-1 and IKK-2: cytokine-activated I{kappa}B kinases essential for NF-{kappa}B activation. Science 278:860.[Abstract/Free Full Text]
  35. Régnier, C. H., H. Y. Song, X. Gao, D. V. Goeddel, Z. Cao, M. Rothe. 1997. Identification and characterization of an I{kappa}B kinase. Cell 90:373.[Medline]
  36. Woronicz, J. D., X. Gao, Z. Cao, M. Rothe, D. V. Goeddel. 1997. I{kappa}B kinase-ß: NF-{kappa}B activation and complex formation with I{kappa}B kinase-{alpha} and NIK. Science 278:866.[Abstract/Free Full Text]
  37. Zandi, E., D. M. Rothwarf, M. Delhase, M. Hayakawa, M. Karin. 1997. The I{kappa}B kinase complex (IKK) contains two kinase subunits, IKK{alpha} and IKKß, necessary for I{kappa}B phosphorylation and NF-{kappa}B activation. Cell 91:243.[Medline]
  38. Song, H. Y., C. H. Régnier, C. J. Kirschning, D. V. Goeddel, M. Rothe. 1997. Tumor necrosis factor-mediated kinase cascades: bifurcation of nuclear factor-{kappa}B and c-jun N-terminal kinase (JNK/SAPK) pathways at TNF receptor-associated factor 2. Proc. Natl. Acad. Sci. USA 94:9792.[Abstract/Free Full Text]
  39. Traenckner, E. B., H. L. Pahl, T. Henkel, K. N. Schmidt, S. Wilk, P. A. Baeuerle. 1995. Phosphorylation of human I{kappa}B-{alpha} on serines 32 and 36 controls I{kappa}B-{alpha} proteolysis and NF-{kappa}B activation in response to diverse stimuli. EMBO J. 14:2876.[Medline]
  40. Antwerp, D. J., S. J. Van Martin, T. Kafri, D. R. Green, I. M. Verma. 1996. Suppression of TNF-{alpha}-induced apoptosis by NF-{kappa}B. Science 274:787.[Abstract/Free Full Text]
  41. Sun, S., J. Elwood, W. C. Greene. 1996. Both amino- and carboxyl-terminal sequences within I{kappa}B{alpha} regulate its inducible degradation. Mol. Cell. Biol. 16:1058.[Abstract]
  42. Adachi, O., T. Kawai, K. Takeda, M. Matsumoto, H. Tsutsui, M. Sakagami, K. Nakanishi, S. Akira. 1998. Targeted disruption of the MyD88 gene results in loss of IL-1- and IL-18-mediated function. Immunity 9:143.[Medline]
  43. Penix, L., W. M. Weaver, Y. Pang, H. A. Young, C. B. Wilson. 1993. Two essential regulatory elements in the human interferon {gamma} promoter confer activation-specific expression in T cells. J. Exp. Med. 178:1483.[Abstract/Free Full Text]
  44. Cippitelli, M., A. Sica, V. Viggiano, J. Ye, P. Ghosh, M. J. Birrer, H. A. Young. 1995. Negative transcriptional regulation of the interferon-{gamma} promoter by glucocorticoids and dominant negative mutants of c-Jun. J. Biol. Chem. 270:12548.[Abstract/Free Full Text]
  45. Campbell, P. M., J. Pimm, V. Ramassar, P. F. Halloran. 1996. Identification of a calcium-inducible, cyclosporin-sensitive element in the IFN-{gamma} promoter that is a potential NFAT binding site. Transplantation 61:933.[Medline]
  46. Cippitelli, M., J. Ye, V. Viggiano, A. Sica, P. Ghosh, A. Gulino, A. Santoni, H. A. Young. 1996. Retinoic acid-induced transcriptional modulation of the human interferon-{gamma} promoter. J. Biol. Chem. 271:26783.[Abstract/Free Full Text]
  47. Penix, L. A., M. T. Sweetser, W. M. Weaver, J. P. Hoeffler, T. K. Kerppola, C. B. Wilson. 1996. The proximal regulatory element of the interferon-{gamma} promoter mediates selective expression in T cells. J. Biol. Chem. 271:31964.[Abstract/Free Full Text]
  48. Ye, J., M. Cippitelli, L. Dorman, J. R. Ortaldo, H. A. Young. 1996. The nuclear factor YY1 suppresses the human {gamma} interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16:4744.[Abstract]
  49. Aune, T. M., L. A. Penix, M. R. Rincon, R. A. Flavell. 1997. Differential transcription directed by discrete {gamma} interferon promoter elements in naive and memory (effector) CD4 T cells and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
  50. Rao, A., C. Luo, P. G. Hogan. 1997. Transcription factors of the NF-AT family: regulation and function. Annu. Rev. Immunol. 15:707.[Medline]
  51. Rothe, H., N. A. Jenkins, N. G. Copeland, H. Kolb. 1997. Active stage of autoimmune diabetes is associated with the expression of a novel cytokine, IGIF, which is located near Idd2. J. Clin. Invest. 99:469.[Medline]



This article has been cited by other articles:


Home page
 Molecular Cancer TherapeuticsHome page
M. Bachmann, C. Dragoi, M. A. Poleganov, J. Pfeilschifter, and H. Muhl
Interleukin-18 directly activates T-bet expression and function via p38 mitogen-activated protein kinase and nuclear factor-{kappa}B in acute myeloid leukemia-derived predendritic KG-1 cells
Mol. Cancer Ther., February 1, 2007; 6(2): 723 - 731.
[Abstract] [Full Text] [PDF]

Home page
 Int ImmunolHome page
C. M. Tato, N. Mason, D. Artis, S. Shapira, J. C. Caamano, J. H. Bream, H.-C. Liou, and C. A. Hunter
Opposing roles of NF-{kappa}B family members in the regulation of NK cell proliferation and production of IFN-{gamma}
Int. Immunol., April 1, 2006; 18(4): 505 - 513.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
J. K. Yoo, H. Kwon, L.-Y. Khil, L. Zhang, H.-S. Jun, and J.-W. Yoon
IL-18 Induces Monocyte Chemotactic Protein-1 Production in Macrophages through the Phosphatidylinositol 3-Kinase/Akt and MEK/ERK1/2 Pathways
J. Immunol., December 15, 2005; 175(12): 8280 - 8286.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
D. W. Kim, G. Lenzen, A.-L. Page, P. Legrain, P. J. Sansonetti, and C. Parsot
The Shigella flexneri effector OspG interferes with innate immune responses by targeting ubiquitin-conjugating enzymes
PNAS, September 27, 2005; 102(39): 14046 - 14051.
[Abstract] [Full Text] [PDF]

Home page
 Proc. Natl. Acad. Sci. USAHome page
J.-K. Lee, S.-H. Kim, E. C. Lewis, T. Azam, L. L. Reznikov, and C. A. Dinarello
Differences in signaling pathways by IL-1{beta} and IL-18
PNAS, June 8, 2004; 101(23): 8815 - 8820.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan
TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells
J. Immunol., June 1, 2004; 172(11): 7002 - 7007.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. G. Rothfuchs, C. Trumstedt, H. Wigzell, and M. E. Rottenberg
Intracellular Bacterial Infection-Induced IFN-{gamma} Is Critically but Not Solely Dependent on Toll-Like Receptor 4-Myeloid Differentiation Factor 88-IFN-{alpha}{beta}-STAT1 Signaling
J. Immunol., May 15, 2004; 172(10): 6345 - 6353.
[Abstract] [Full Text] [PDF]

Home page
 J. Pharmacol. Exp. Ther.