The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, Y.
Right arrow Articles by Benveniste, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, Y.
Right arrow Articles by Benveniste, E. N.
The Journal of Immunology, 1999, 162: 4731-4739.
Copyright © 1999 by The American Association of Immunologists

IFN-{gamma} Regulation of the Type IV Class II Transactivator Promoter in Astrocytes1

Yuanshu Dong*, Wolfgang M. Rohn{dagger} and Etty N. Benveniste2,*,{dagger}

Departments of * Cell Biology and {dagger} Physiology and Biophysics, University of Alabama, Birmingham, AL 35294


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The transcriptional activation of class II MHC genes requires the class II transactivator (CIITA) protein, a regulator that is essential for both constitutive and IFN-{gamma}-inducible class II MHC expression. The CIITA gene is controlled by multiple independent promoters; two promoters direct constitutive expression, while another, the type IV CIITA promoter, mediates IFN-{gamma}-induced expression. We investigated the molecular regulation of IFN-{gamma}-induced type IV CIITA promoter activity in astrocytes. IFN-{gamma} inducibility of the type IV CIITA promoter is dependent on three cis-acting elements contained within a 154-bp fragment of the promoter; the proximal IFN-{gamma} activation sequence (GAS) element, the E box, and the proximal IFN regulatory factor (IRF) element. Two IFN-{gamma}-activated transcription factors, STAT-1{alpha} and IRF-1, bind the proximal GAS and IRF elements, respectively. The E box binds upstream stimulating factor-1 (USF-1), a constitutively expressed transcription factor. Furthermore, STAT-1{alpha} binding to the proximal GAS element is dependent on the binding of USF-1 to the adjacent E box. Functionally, the proximal IRF element is essential for IFN-{gamma} induction of type IV CIITA promoter activity, while the proximal GAS and E box elements contribute to the IFN-{gamma} inducibility of this promoter. In astrocytes, TNF-{alpha} enhances IFN-{gamma}-induced class II MHC transcription. Our results demonstrate that TNF-{alpha} does not enhance IFN-{gamma}-induced transcriptional activation of the type IV CIITA promoter, indicating that the enhancing effect of TNF-{alpha} is mediated downstream of CIITA transcription. These results define the molecular basis of IFN-{gamma} activation of the type IV CIITA promoter in astrocytes.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The class II Ags of the MHC have a critical role in the induction of immune responses by presenting fragments of processed foreign Ag to Th cells, resulting in their activation and differentiation. While the constitutive expression of class II MHC Ags is restricted primarily to B cells, dendritic cells, thymic epithelium, and macrophages, a wide variety of other cell types can be induced to express class II MHC Ags after exposure to cytokines such as IFN-{gamma} (for review, see 1). Aberrant expression of class II MHC Ags has been postulated to be involved in the progression of various diseases, such as rheumatoid arthritis, insulin-dependent diabetes mellitus, inflammatory bowel disease, and multiple sclerosis (MS),3 all of which are thought to be of autoimmune origin (for review, see 2).

The regulation of class II MHC genes occurs primarily at the transcriptional level, and a non DNA-binding protein, class II transactivator (CIITA), has been shown to be the master control factor for class II MHC transcription (for review, see 1 and 3). CIITA is essential for the transcriptional activation of class II MHC gene expression and is thought to function as a coactivator through interactions with specific DNA binding proteins bound to the conserved regulatory elements in the class II MHC promoter (4, 5). As well, CIITA interacts with TFIIB and TAF proteins, both components of the basal transcription machinery (6, 7). CIITA is required and is the major rate-limiting factor for both constitutive and inducible class II MHC expression (8). Constitutive CIITA expression is restricted to cell types that are constitutively class II MHC positive (9), while in class II MHC-negative cells, CIITA expression is lacking, but can be induced upon stimulation with IFN-{gamma} (10, 11, 12, 13). Transfection of a CIITA expression construct into class II MHC-negative cells results in the expression of class II MHC mRNA and protein in the absence of IFN-{gamma} stimulation, indicating that overexpression of CIITA is able to bypass the requirement of IFN-{gamma}-induced signaling (10, 13, 14). The critical role of CIITA in class II MHC expression has been demonstrated in CIITA-deficient mice; these mice lack both constitutive and IFN-{gamma}-inducible class II MHC expression, except for low expression on a subset of thymic epithelial cells (15).

Recently, it has been shown that expression of the CIITA gene is controlled by the alternative usage of multiple distinct promoters: constitutive expression in dendritic cells and in B lymphocytes by promoter I and promoter III, respectively, and IFN-{gamma}-inducible expression in a melanoma cell line by promoter IV (16). Sequence analysis of the type IV CIITA promoter demonstrated the presence of numerous cis-acting elements, including an IFN-{gamma} activation sequence (GAS), an E box, and an IFN regulatory factor (IRF) element (17). As well, the human type IV CIITA promoter contains an NF-{kappa}B binding element and a NF-GMa site. In melanoma cells, the GAS and IRF elements bind the IFN-{gamma}-regulated transcription factors STAT-1{alpha} and IRF-1, respectively (17). The E box is bound by constitutively expressed upstream stimulating factor-1 (USF-1), a transcription factor belonging to the basic-helix-loop-helix/leucine zipper family (17). All three of these cis-acting elements (GAS, E box, and IRF-1) are essential for IFN-{gamma}-induced activation of the type IV CIITA promoter in melanoma cells (17). Furthermore, a cooperative interaction of IFN-{gamma}-activated STAT-1{alpha} and constitutively expressed USF-1 is required for IFN-{gamma} activation of the type IV CIITA promoter (17).

Astrocytes are the major glial cell in the central nervous system (CNS). These cells are critical for the development and support of neurons, the repair of injured neurons, the formation and maintenance of the blood-brain barrier, and the uptake of neurotransmitters such as glutamate (for review, see 18). Recent work indicates that astrocytes are also involved in immunological events occurring within the brain due to their ability to produce and respond to a variety of cytokines and chemokines, express adhesion molecules such as ICAM-1 and VCAM-1, and express class I and II MHC Ags upon activation (for review, see 18 and 19). In vitro, astrocytes can be induced to express class II MHC upon exposure to IFN-{gamma}, and the inclusion of TNF-{alpha} enhances IFN-{gamma}-induced class II MHC expression (20, 21). The documentation of class II MHC-positive astrocytes in disease states such as MS and experimental allergic encephalomyelitis, an animal model for MS, has been controversial, with some investigators finding such cells and others unable to detect them (22, 23, 24, 25). There are conflicting reports on the ability of astrocytes to function as APCs. Some investigators have shown that class II MHC-positive astrocytes function as APCs in vitro (20, 26, 27, 28, 29), although other groups have reported that class II MHC-positive astrocytes are unable to induce the proliferation of T cells (30, 31). A recent study has demonstrated that IFN-{gamma}-treated astrocytes, which are induced to express B7-1, can activate naive T cells (27), while another has shown that class II MHC-positive astrocytes are effective APCs for Th2 cell activation (28). There are also reports that class II MHC-positive astrocytes transmit a suppressive and/or apoptotic signal to CD4+ T cells (30, 32), possibly due to the lack of B7 expression. Thus, the precise role of astrocytes as APCs is still unclear, i.e., whether they activate or inhibit T cell function.

In this study we wanted to determine the molecular basis underlying CIITA gene expression in astrocytes. The full-length type IV promoter of the human CIITA gene was cloned and analyzed for IFN-{gamma} inducibility in astrocytes. Functional analysis of CIITA promoter constructs revealed that the cis elements that are necessary and sufficient for IFN-{gamma} induction of type IV CIITA promoter activity are located within 154 bp of the transcription start site (TSS). Mutagenesis analysis revealed that the proximal IRF element is essential for IFN-{gamma} induction of type IV CIITA promoter activity, while the proximal GAS element and adjacent E box element contribute to IFN-{gamma} inducibility of the CIITA promoter. STAT-1{alpha} binds to the proximal GAS element and is dependent on the binding of USF-1 to the E box. Furthermore, the IRF-1 transcription factor binds to the proximal IRF element of the CIITA promoter. Collectively, these results demonstrate that in astrocytes, the IRF element and IRF-1 transcription factor are critically important for IFN-{gamma} induction of type IV CIITA promoter activity.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Primary rat astrocyte cultures

Primary glial cell cultures were established from neonatal rat cerebra as described previously (33). Cells were cultured in DMEM, high glucose formula supplemented with glucose to a final concentration of 6 g/l, 2 mM glutamine, 0.1 mM nonessential amino acid mixture, 0.1% gentamicin, and 10% FBS (HyClone, Logan, UT). After 2 wk in primary culture, oligodendrocytes and microglia were removed by mechanical dislodgement. Astrocytes were harvested by trypsinization (0.25% trypsin and 0.02% EDTA) and monitored for purity by immunofluorescence. Astrocyte cultures were routinely >97% positive for glial fibrillary acidic protein, an intracellular Ag unique to astrocytes (34).

Reagents

Rat rIFN-{gamma} was purchased from Life Technologies (Grand Island, NY), and rat rTNF-{alpha} was obtained from BioSource International (Camarillo, CA). Polyclonal antiserum to STAT-1{alpha} was a gift from Berlex Biosciences (Richmond, CA). Polyclonal antisera against STAT-3, STAT-6, USF-1, IRF-1, and IRF-2 were purchased from Santa Cruz Biotechnology (Santa Cruz, CA), while antiserum against STAT-5 was obtained from Zymed (San Francisco, CA).

CIITA promoter constructs

The sequence for the primers used to PCR amplify a 1703-bp DNA fragment of the type IV promoter of the human CIITA gene was derived from that reported previously (16). The sense primer is located at the 3' end of the type III promoter and has the sequence GCCTGGCTCCACGCCCTGCTG, and the antisense primer is located at the 3' end of the type IV promoter and has the sequence CGCTGTTCCCCGGGCTCCCG. PCR was performed with the Taq PCR Core Kit (Qiagen, Santa Clarita, CA) according to the manufacturer’s instructions as previously described (35). The resulting 1703-bp fragment was gel purified and ligated into linearized pCRII vector (Invitrogen, Carlsbad, CA). The complete sequence of the insert was obtained by automatic sequencing, which was performed by the University of Alabama at Birmingham Center for AIDS Research Molecular Biology Core Facility. The 1703-bp insert was released from pCRII by digestion with the restriction enzyme EcoRI and gel purified, and the restriction ends were blunted with the Klenow fragment of DNA polymerase I according to the manufacturer (Promega, Madison, WI). The blunt-ended fragment was ligated into the SmaI site of the pGL2-Basic vector, which contains the gene for luciferase as reporter. The designated name for this construct is hCIITAp1.7. Plasmid constructs containing deletions in the promoter (D1, D2, D4, and D5) were prepared as follows. Aliquots of the hCIITAp1.7 construct were subjected to digestion with the restriction enzyme XhoI, giving rise to a 1020-bp XhoI fragment that was gel purified and subcloned into pGL2-Basic, generating the deletion construct hCIITAp-D1. The hCIITAp1.7 construct was also digested with SmaI, generating a 301-bp SmaI fragment; with BstXI/KpnI, generating a 229-bp fragment; or with SacI/KpnI, generating a 155-bp fragment that was subcloned into pGL2-Basic, creating the deletion constructs hCIITAp-D2, hCIITAp-D4, and hCIITAp-D5, respectively. The deletion construct hCIITAp-D3 was generated by religating the hCIITAp1.7 construct after deleting a 535-bp KpnI fragment, then inserting a 99-bp fragment (-24 to +75) into the Mlu1 site. A 129-bp (-54 to +75) PCR fragment was inserted into the XhoI site of pGL2-Basic to generate the deletion construct hCIITAp-D6 (see Fig. 1Go). The site-directed mutation constructs, hCIITA-GAS, hCIITA-E box, hCIITA-IRF, hCIITA-GAS + IRF, and hCIITA-GAS + E box (Fig. 2Go), were generated on the hCIITAp1.7 plasmid backbone using the QuikChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) following the manufacturer’s instructions and were confirmed by sequencing.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Effect of deletion mutations of the human type IV CIITA promoter on inducibility by IFN-{gamma}. Putative cis-acting elements identified within the type IV CIITA promoter are indicated. Rat astrocytes were cotransfected with 10 µg of the wt or truncated CIITA promoter constructs and 1 µg of the pCMV-ß-galactosidase construct as indicated in Materials and Methods. Cells were allowed to recover for 18 h, then were treated with serum-free medium alone or IFN-{gamma} (250 U/ml) for 12 h. Luciferase and ß-galactosidase activities were determined in triplicate, and the luciferase activity of each sample was normalized to ß-galactosidase activity to calculate relative luciferase activity (RLA). Fold induction was calculated by dividing the RLA of the IFN-{gamma}-treated samples by the RLA of the medium-treated sample. Data are the mean ± SD from at least four experiments.

 


View larger version (24K):
[in this window]
[in a new window]
 
FIGURE 2. Effect of site-specific mutations in the human type IV CIITA promoter on inducibility by IFN-{gamma}. The mutated elements are indicated in black. Astrocytes were cotransfected with 10 µg of the wt or mutated CIITA promoter constructs and 1 µg of the pCMV-ß-galactosidase construct as indicated in Materials and Methods. Cells were allowed to recover for 18 h, then were treated with serum-free medium alone or with IFN-{gamma} (250 U/ml) for 12 h. Luciferase and ß-galactosidase activity was determined in triplicate, and the luciferase activity of each sample was normalized to ß-galactosidase activity to calculate RLA. Fold induction was calculated by dividing the RLA of the IFN-{gamma}-treated samples by the RLA of the medium-treated sample. Data are the mean ± SD from at least four experiments.

 
Transient transfection and luciferase assay

Ten micrograms of the hCIITA promoter constructs (both CIITA deletion and mutant constructs) were cotransfected with 1 µg of the pCMV-ß-galactosidase construct into 3 x 106 astrocytes by electroporation with a Bio-Rad Gene Pulser set at 250 V and 960 µF as previously described (36). After transfection, cells were allowed to recover for 18 h before treatment with IFN-{gamma} and/or TNF-{alpha} for 12 h, which we have previously determined to be optimal for IFN-{gamma}-induced activation (data not shown). Cells were washed with PBS and lysed with 180 µl of lysis buffer containing 25 mM trisphosphate (pH 7.8), 2 mM DTT, 2 mM diaminocyclohexane tetra-acetic acid, 10% glycerol, and 1% Triton X-100. Extracts were assayed in triplicate for luciferase activity in a volume of 130 µl containing 30 µl of cell extract, 20 mM tricine, 0.1 mM EDTA, 1 mM magnesium carbonate, 2.67 mM MgSO4, 33.3 mM DTT, 0.27 mM coenzyme A, 0.47 mM luciferin, and 0.53 mM ATP, and light intensity was measured using a luminometer (Promega). Luciferase activity was integrated over a 10-s period. Extracts were also assayed in triplicate for ß-galactosidase enzyme activity as previously described (37). The luciferase activity of each sample was normalized to ß-galactosidase activity to calculate relative luciferase activity.

Nuclear extracts and electrophoretic mobility shift assay (EMSA)

Nuclear extracts from astrocytes were prepared as previously described (36). Cells were grown in 100-mm dishes, allowed to adhere overnight, and then stimulated in serum-free medium with or without IFN-{gamma} for 1–2 h. After treatment cells were washed with cold PBS, harvested by scraping, and pelleted. Cells were resuspended in 1 ml of buffer A (10 mM KCl, 20 mM HEPES, 1 mM MgCl2, 1 mM DTT, 0.4 mM PMSF, 1 mM NaF, and 1 mM Na3VO4), incubated on ice for 10 min, and pelleted at 1,000 x g for 10 min. Pellets were resuspended in 0.5 ml of buffer A plus 0.1% Nonidet P-40, incubated on ice for 10 min, and centrifuged at 3,000 x g for 10 min. The nuclear pellet was resuspended in 1 ml of buffer B (10 mM HEPES, 400 mM NaCl, 0.1 mM EDTA, 1 mM MgCl2, 1 mM DTT, 0.4 mM PMSF, 15% glycerol, 1 mM NaF, and 1 mM Na3VO4) and incubated for 30 min at 4°C with constant gentle mixing. Nuclei were then pelleted at 14,000 x g for 30 min, and extracts were dialyzed for 2 h at 4°C against 1 l of buffer C (20 mM HEPES, 200 mM KCl, 1 mM MgCl2, 0.1 mM EDTA, 1 mM DTT, 0.4 mM PMSF, 15% glycerol, 1 mM NaF, and 1 mM Na3VO4). Extracts were cleared by centrifugation at 14,000 x g for 15 min at 4°C. Protein concentrations were determined using a Bio-Rad protein assay (Richmond, CA).

EMSA was performed using the following oligonucleotides as probes and/or competitors: the oligonucleotide CIITA-GAS + E box has the sequence 5'-TGCCACTTCTGATAAAGCACGTGGTGGCCA-3' and corresponds to the type IV CIITA promoter sequence -119 to -148, the CIITA-IRF-1 oligonucleotide has the sequence 5'-TGCAGAAAGAAAGTGAAAGGGAAAAAGAAC-3' and corresponds to the type IV CIITA promoter sequence -45 to -74 (16), and the IRF-1 consensus sequence is 5'-GAAAATGAAATT-3' and was obtained from Santa Cruz Biotechnology. The mutant proximal GAS oligonucleotide (mGAS + wild-type (wt) E box) has the sequence 5'-GCAGTTGGGATGCCACcgaTcgTAAAGCACGTGGTGGCC-3', and the mutant E box oligonucleotide (wt GAS + mE box) is 5'-GGGATGCCACTTCTGATAAAGgcgGTaGTGGCCACAGTAGG-3'. Mutations are indicated by lowercase letters. 32P-labeled oligonucleotide (0.2 ng; 20,000 cpm) was incubated for 30 min at room temperature with 10 µg of nuclear extract in a volume of 20 µl containing 50 mM KCl, 2.5 mM MgCl2, 1 mM EDTA, 1 mM DTT, 10 mM Tris-Cl (pH 7.5), 12% glycerol, 1 µg of salmon sperm DNA, and 1 µg of poly(dI-dC). For supershift analysis 1 µl of Ab was incubated with the nuclear extracts at 4°C for 30 min in binding buffer, followed by an additional incubation for 30 min at room temperature with labeled oligonucleotide. For competitions, unlabeled DNA was incubated with the nuclear extracts at 4°C for 20 min before addition of labeled probe. Bound and free DNA were resolved by electrophoresis through a 6% polyacrylamide gel at 250 V in 1x TGE (50 mM Tris-Cl, 380 mM glycine, and 2 mM EDTA). Dried gels were exposed to Kodak XAR-5 film (Eastman Kodak, Rochester, NY) at -70°C with intensifying screens. Four different preparations of nuclear extracts were tested by EMSA.

Statistical analysis

Levels of significance for comparisons between samples were determined using Student’s t test distribution.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Identification of IFN-{gamma} response elements in the type IV CIITA promoter

To define the promoter elements responsible for IFN-{gamma} induction of the CIITA gene in astrocytes, we used a CIITA wt reporter construct in which 1703 bp of the type IV CIITA 5' region was inserted into the pGL2-basic reporter construct. Fig. 1Go depicts cytokine response elements that have been identified through the Mat Inspector program (38). Three clusters of GAS and IRF elements are found in the type IV CIITA promoter. The proximal cluster is located -55 to -142 bp upstream of the TSS (pIRF, pGAS), the medial cluster is located -591 to -683 bp (mIRF, mGAS), and the distal cluster is -769 to -854 bp upstream of the TSS (dIRF, dGAS). An NF-{kappa}B site is located at -230 bp, a NF-GMa site is at -152 bp, and an E box element is located at -131 bp. In addition,deletion constructs were generated from the 5' and 3' ends of the CIITA promoter, and their inducibility by IFN-{gamma} was examined (see Fig. 1Go). Each of these constructs was transiently transfected into astrocytes with a pCMV-ß-galactosidase construct to monitor transfection efficiency. The cells were stimulated for 12 h with IFN-{gamma}, and then relative luciferase activity was determined. A very low basal transcriptional activity of the full-length construct, hCIITAp1.7, was detected, and a 8.3-fold induction of CIITA promoter activity was observed upon stimulation with IFN-{gamma} (Fig. 1Go). The hCIITAp-D1 construct was tested to examine whether deletion of 683 bp upstream of the distal GAS element had any influence on IFN-{gamma} inducibility. Similar levels of IFN-{gamma}-induced luciferase activity were observed with hCIITAp-D1 (7.7-fold induction) compared with hCIITAp1.7. The hCIITAp-D2 construct lacks the distal and medial GAS/IRF elements; this construct was tested to determine the contributions of these four elements to IFN-{gamma} inducibility of the CIITA promoter. As shown in Fig. 1Go, IFN-{gamma} stimulation resulted in a 6.0-fold induction of hCIITAp-D2 promoter activity, indicating that the distal and medial GAS/IRF elements do not contribute to IFN-{gamma} inducibility of the type IV CIITA promoter. As a further confirmation of this finding, we analyzed the hCIITAp-D3 construct, which contains the distal and medial GAS/IRF elements and lacks the downstream region of the type IV CIITA promoter. The hCIITAp-D3 promoter activity was not inducible by IFN-{gamma} treatment, further demonstrating that the distal and medial GAS/IRF elements cannot mediate CIITA transcription in response to IFN-{gamma}. To further define the minimal promoter elements responsible for IFN-{gamma} activation of the CIITA promoter, three other deletion constructs were tested; hCIITAp-D4, hCIITAp-D5, and hCIITAp-D6. The hCIITAp-D4 lacks the NF-{kappa}B element at position -230 and contains the NF-GMa, proximal GAS, E box, and proximal IRF elements. Upon IFN-{gamma} stimulation, a 5.3-fold induction of hCIITAp-D4 promoter activity was observed. This level of activation was not significantly different from that of construct hCIITAp-D2, indicating that the NF-{kappa}B element is not involved in IFN-{gamma} activation of the CIITA promoter. Further deletion of the NF-GMa, proximal GAS, and E box elements (construct hCIITAp-D5) lead to a small reduction in IFN-{gamma} inducibility (3.9-fold induction), while deletion of the proximal IRF-1 element in construct hCIITAp-D6 lead to a total loss of IFN-{gamma}-inducible CIITA promoter activity (Fig. 1Go). These results collectively demonstrate that IFN-{gamma} activation of the CIITA gene in astrocytes is dependent on elements contained within a 154-bp fragment of the type IV CIITA promoter. Furthermore, IFN-{gamma} induction of CIITA promoter activity is evident, although at lower levels, in the absence of the proximal GAS and E box elements, indicating that the proximal IRF element is capable of mediating IFN-{gamma} activation of the type IV CIITA promoter.

Contribution of the proximal GAS element, E box element, and proximal IRF-1 element to IFN-{gamma} induction of the type IV CIITA promoter

The results obtained above in astrocytes differ from what has previously been observed in melanoma cells; in that cell type, IFN-{gamma} activation of the type IV CIITA promoter was completely abolished when the proximal GAS element was mutated, indicating a critical role for STAT-1{alpha} in these cells (17). To further define the contribution of the proximal GAS, E box, and proximal IRF elements in CIITA promoter activity in astrocytes, we generated a series of type IV CIITA promoter constructs with selective mutations in those elements individually (GAS, E box, and IRF) or in combination (GAS + E box, and GAS + IRF; see Fig. 2Go). Mutation of the proximal GAS element results in an approximately 55% inhibition of IFN-{gamma}-induced CIITA promoter activity compared with that of the hCIITAp1.7 construct; however, there is still an IFN-{gamma} stimulation index of ~45% of the hCIITA-GAS construct compared with the wt construct (Fig. 2Go). Binding of STAT-1{alpha} to the proximal GAS element has been shown to require interaction with the constitutively expressed transcription factor USF-1, which binds to the adjacent E box (17). Thus, we next tested the influence of a mutated E box on IFN-{gamma} inducibility of the CIITA promoter. An IFN-{gamma} stimulation index of ~44% of the hCIITA-E box construct was observed, comparable to that of the hCIITA-GAS construct (Fig. 2Go). IFN-{gamma} stimulation of the construct containing mutations in both the proximal GAS and E box elements, hCIITA-GAS + E box, resulted in a stimulation index value of ~36% compared with wt hCIITAp1.7. Thus, mutations in either of these elements (GAS or E box) results in a partial inhibition of IFN-{gamma}-inducible promoter activity compared with that of the wt construct. However, IFN-{gamma} activation is not completely abolished, suggesting that an intact IRF element may mediate partial IFN-{gamma} activation of the type IV CIITA promoter in astrocytes. To test the importance of the IRF element in this response, the mutation construct hCIITA-IRF was created. As shown in Fig. 2Go, mutation of the proximal IRF element results in an almost complete abrogation of IFN-{gamma}-inducible CIITA promoter activity. As well, mutations in both the proximal GAS and IRF elements (hCIITA-GAS + IRF) led to a complete loss of IFN-{gamma} inducibility (Fig. 2Go). These results demonstrate that the proximal GAS, E box, and proximal IRF elements each play a functionally important role in IFN-{gamma} induction of CIITA promoter activity. The proximal IRF element is capable of mediating IFN-{gamma} inducibility of this promoter, even in the absence of functional proximal GAS and E box elements, while the proximal GAS and E box elements cannot mediate IFN-{gamma} inducibility in the absence of a functional IRF element. Optimal responsiveness to IFN-{gamma} stimulation requires all three cis-acting elements.

DNA-protein complex formation over the CIITA proximal GAS and E box elements

To analyze the DNA-protein complexes forming over the proximal GAS and E box elements of the type IV CIITA promoter, nuclear extracts were prepared from unstimulated or IFN-{gamma}-stimulated astrocytes, and EMSA was performed with labeled oligonucleotide spanning the proximal GAS and E box elements. Using extracts from unstimulated cells, three DNA-protein complexes were detected; complex 2, complex 3, and complex 4 (Fig. 3GoA, lane 2). An additional complex (complex 1; a doublet with slower electrophoretic mobility) was observed using nuclear extracts from IFN-{gamma}-stimulated astrocytes (Fig. 3GoA, lane 3). Using an excess of unlabeled proximal GAS + E box oligonucleotide, all four complexes from IFN-{gamma}-stimulated extracts were competed away (Fig. 3GoA, lane 4). To further investigate the identities of complexes 1–4, we analyzed the DNA-protein complexes by supershift experiments using Abs against STAT family members (STAT-1{alpha}, STAT-3, STAT-5, and STAT-6) and USF-1. As shown in Fig. 3GoA, the IFN-{gamma}-inducible complex 1 is supershifted in the presence of STAT-1{alpha} antisera (lane 5). STAT-3, STAT-5, or STAT-6 antiserum did not affect complex 1 formation (lanes 6–8). These results indicate that the IFN-{gamma}-induced complex 1 is composed of STAT-1{alpha}. The constitutively present complexes 2, 3, and 4 were not influenced by the inclusion of STAT-1{alpha}, STAT-3, STAT-5, or STAT-6 antiserum (Fig. 3GoA, lanes 5–8). To determine whether complexes 2, 3, and 4 contain members of the USF family, polyclonal antiserum to USF-1 was used in supershift experiments (Fig. 3GoB). Nuclear extracts from unstimulated extracts formed three complexes over the proximal GAS + E box oligonucleotide, complexes 2, 3, and 4 (Fig. 3GoB, lane 1). Inclusion of antiserum against USF-1 lead to a supershift of all three complexes (lane 3). Upon IFN-{gamma} stimulation, complex 1 was observed (lane 4), and inclusion of USF-1 antiserum supershifted all four complexes (lane 6). These results indicate that complexes 1, 2, 3, and 4 all contain USF-1. It should be noted that Muhlethaler-Mottet et al. (17) also observed multiple complexes forming over this region of the CIITA promoter; two DNA-protein complexes from unstimulated extracts and an additional IFN-{gamma} inducible complex composed of a doublet. It is possible that additional proteins that bind to STAT-1{alpha}, USF-1, or both may be contained in either of the two IFN-{gamma} bands.



View larger version (53K):
[in this window]
[in a new window]
 
FIGURE 3. EMSA of complex formation over the proximal GAS and E box elements of the type IV CIITA promoter. Rat astrocytes were untreated or were stimulated in the presence of IFN-{gamma} for 1 h, then nuclear extracts were prepared. In A, EMSA was performed with 10 µg of nuclear extracts from untreated cells (lane 2) or IFN-{gamma}-stimulated cells (lanes 3–8) with 20,000 cpm of labeled CIITA proximal GAS + E box probe. Competition analysis was performed in the presence of a 100-fold molar excess of unlabeled CIITA GAS + E box oligonucleotide (lane 4). Supershift analysis was performed in the presence of anti-STAT-1{alpha} (lane 5), anti-STAT-3 (lane 6), anti-STAT-5 (lane 7), or anti-STAT-6 (lane 8) antisera. F, free probe (lane 1). In B, 10 µg of nuclear extracts from untreated (lanes 1–3) or IFN-{gamma}-stimulated cells (lanes 4–6) were incubated with 20,000 cpm of labeled CIITA proximal GAS + E box probe in the presence of normal rabbit serum (NRS; lanes 2 and 5) or anti-USF-1 antiserum (lanes 3 and 6). In C, 10 µg of nuclear extracts from untreated (lanes 1–4) or IFN-{gamma}-stimulated cells (lanes 5–8) were incubated with 20,000 cpm of labeled CIITA proximal GAS + E box probe. Competition analysis was performed in the presence of a 100-fold molar excess of unlabeled CIITA GAS + E box oligonucleotide (lanes 2 and 6), mGAS + wt E box oligonucleotide (lanes 3 and 7), or wt GAS + mE box oligonucleotide (lanes 4 and 8). Data shown are representative of four experiments.

 
Muhlethaler-Mottet et al. (17) have shown that STAT-1{alpha} binds to the proximal GAS element only in the presence of constitutively expressed USF-1, which binds to the adjacent E box element. To investigate whether this is true for STAT-1{alpha} binding to the GAS element in astrocytes, oligonucleotides with mutations in either the proximal GAS element or the E box element were used as competitors in EMSA performed with labeled proximal GAS + E box probe. As shown previously, an excess of unlabeled proximal GAS + E box oligonucleotide competed away complexes 2, 3, and 4 formed by nuclear extracts from unstimulated cells (Fig. 3GoC, compare lanes 1 and 2). Using the oligonucleotide containing the mutant proximal GAS + wt E box as competitor (mGAS + wt E box), complexes 2, 3, and 4 were competed away as expected due to the intact E box (lane 3). The wt GAS + mutant E box oligonucleotide (wt GAS + mE box) could not compete out any of the three complexes (lane 4). The effects of these mutant oligonucleotides were next tested on extracts from IFN-{gamma}-stimulated astrocytes. Unlabeled excess proximal GAS + E box oligonucleotide effectively competed away complexes 1, 2, 3, and 4 (compare lanes 5 and 6). The mGAS + wt E box oligonucleotide competed out not only complexes 2, 3, and 4, which contain USF-1, but also complex 1 containing STAT-1{alpha} (lane 7), indicating that prevention of USF-1 binding to the E box of the labeled probe abolished the binding of STAT-1{alpha} to the proximal GAS element. Using the wt GAS + mE box oligonucleotide as competitor, only complex 1 was competed away (lane 8). Collectively, these results indicate that the binding of STAT-1{alpha} to the proximal GAS element of the type IV CIITA promoter is dependent on that of USF-1 binding to the E box, in agreement with the findings from Muhlethaler-Mottet et al. (17).

DNA-protein complex formation over the CIITA proximal IRF element

We next investigated the nature of the protein(s) binding the proximal IRF element of the CIITA promoter. Extracts from unstimulated astrocytes or astrocytes treated with IFN-{gamma} for 2 h were incubated with a labeled oligonucleotide containing the proximal IRF sequence. Using extracts from unstimulated cells, no DNA-protein complexes were detected (Fig. 4GoA, lane 1). A DNA-protein complex (complex A) was observed from IFN-{gamma}-stimulated nuclear extracts (lane 2), which was competed away using an excess of unlabeled proximal IRF oligonucleotide (lane 3). As well, competition with unlabeled IRF-1 consensus oligonucleotide led to near complete competition of complex A (lane 4). The identity of complex A was analyzed by supershift experiments using Abs against IRF-1 and IRF-2. Inclusion of normal rabbit serum did not affect binding of complex A (Fig. 4GoB, lane 4), while IRF-1 antisera caused a supershift in complex A (lane 5). Complex A binding was not influenced by antiserum against IRF-2 or STAT-1{alpha} (Fig. 4GoB, lanes 6 and 7). These results indicate that complex A contains the IRF-1 transcription factor.



View larger version (0K):
[in this window]
[in a new window]
 
FIGURE 4. EMSA of complex formation over the proximal IRF element of the type IV CIITA promoter. Rat astrocytes were untreated or were stimulated in the presence of IFN-{gamma} for 2 h, then nuclear extracts were prepared. In A, EMSA was performed with 10 µg of nuclear extracts from untreated cells (lane 1) or IFN-{gamma}-stimulated cells (lanes 2–4) with 20,000 cpm of labeled CIITA proximal IRF probe. Competition analysis was performed in the presence of a 100-fold molar excess of unlabeled CIITA-IRF oligonucleotide (lane 3) or IRF-1 consensus oligonucleotide (lane 4). In B, 10 µg of nuclear extracts from untreated (lanes 1 and 2) or IFN-{gamma}-stimulated cells (lanes 3–7) were incubated with 20,000 cpm of labeled CIITA proximal IRF probe in the absence (lanes 1 and 3) or the presence of normal rabbit serum (lanes 2 and 4), anti-IRF-1 (lane 5), anti-IRF-2 (lane 6), or anti-STAT-1{alpha} (lane 7) antiserum. Data shown are representative of three experiments.

 
TNF-{alpha} does not enhance IFN-{gamma}-induced CIITA promoter activity

We have previously demonstrated that TNF-{alpha} alone does not induce class II MHC expression in astrocytes, but enhances IFN-{gamma}-induced class II MHC gene transcription (21, 36). To determine whether the TNF-{alpha}-enhancing effect was mediated at the level of the CIITA gene, the effect of IFN-{gamma}, TNF-{alpha}, or both cytokines on the transcriptional activity of the full-length type IV CIITA construct, hCIITApl.7, was tested. As shown in Table IGo, the hCIITApl.7 promoter construct was activated in the presence of IFN-{gamma}, while TNF-{alpha} alone had no effect. Stimulation of cells with IFN-{gamma} plus TNF-{alpha} did not activate CIITA transcription above that observed with IFN-{gamma} alone (Table IGo). As well, there was no statistical difference between IFN-{gamma} vs IFN-{gamma} plus TNF-{alpha} activation of CIITA transcription. These results indicate that TNF-{alpha}, either alone or in combination with IFN-{gamma}, does not activate type IV CIITA promoter activity.


View this table:
[in this window]
[in a new window]
 
Table I. TNF-{alpha} does not affect type IV CIITA promoter activity

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
CIITA has been identified as a critical factor required for both the constitutive and IFN-{gamma}-inducible expression of class II MHC genes (for review, see 3). In this study we investigated the activation of the type IV CIITA promoter in astrocytes in response to IFN-{gamma} stimulation and identified the cis-acting elements and transcription factors involved in this response. We demonstrate that the proximal GAS, E box, and proximal IRF elements are all required for IFN-{gamma} induction of CIITA promoter activity in astrocytes. The proximal IRF element was shown to be essential for IFN-{gamma} induction of CIITA activation, while the proximal GAS and E box elements play an important role in contributing to the maximal response of the type IV CIITA promoter in response to IFN-{gamma}. As well, we demonstrate that STAT-1{alpha}, USF-1, and IRF-1 bind the proximal GAS, E box, and proximal IRF elements, respectively. The binding of STAT-1{alpha} to the proximal GAS element is dependent on the binding of USF-1 to the adjacent E box element, in agreement with previous findings (17).

Functional analysis of the type IV CIITA promoter was performed by using deletion constructs and constructs containing selective mutations in the proximal GAS, E box, and proximal IRF elements. Our results in primary rat astrocytes indicate that a 154-bp fragment of the type IV CIITA promoter contains all the elements necessary for responsiveness to IFN-{gamma} (proximal GAS, E box, and proximal IRF elements; Fig. 1Go). Interestingly, deletion of the proximal GAS and E box elements results in an approximately 53% reduction in CIITA transcription in response to IFN-{gamma} (Fig. 1Go). Mutation of the proximal GAS element also results in an approximately 55% reduction in IFN-{gamma}-induced CIITA transcription compared with the wt construct (Fig. 2Go). Thus, these data indicate that in the absence of a functional proximal GAS element, the type IV CIITA promoter still maintains ~45% of the inducibility by IFN-{gamma}, which we propose is mediated by the proximal IRF element (see below). This finding in astrocytes differs from that observed in melanoma cells; in that cell type IFN-{gamma}-induced type IV CIITA promoter activity was almost completely abrogated when the proximal GAS element was mutated (17).

Our results also indicate an involvement of the E box in IFN-{gamma}-induced CIITA expression. Using the construct hCIITA-E box, which contains a mutation in the E box, IFN-{gamma} induction of CIITA promoter activity was inhibited by ~56% compared with that of the wt promoter (Fig. 2Go). This extent of inhibition is similar to that seen using construct hCIITA-GAS, which contains a mutated GAS element (Fig. 2Go). STAT-1{alpha} has been shown to bind to the proximal GAS element of the type IV CIITA promoter only in the presence of USF-1, which binds to the adjacent E box (17). We have observed the same in astrocytes, as determined by EMSA. Thus, in the construct hCIITA-E box, the mutation in the E box prevents USF-1 binding, which, in turn, inhibits STAT-1{alpha} binding to the proximal GAS element. This results in a reduction of IFN-{gamma}-inducible CIITA promoter activity. Indeed, double mutation of both the proximal GAS and E box elements does not result in a significantly greater extent of inhibition (~64%) compared with individual mutations in each of the elements (Fig. 2Go). This indicates that the GAS/E box sites function as a single, integrated cis-regulatory element and are responsible in part for IFN-{gamma} induction of type IV CIITA promoter activity.

The critical role of the proximal IRF element in IFN-{gamma} induction of type IV CIITA promoter activity was determined using the deletion/mutant CIITA promoter constructs. First, the deletion construct containing only the proximal IRF element (hCIITAp-D5) maintained ~47% inducibility by IFN-{gamma} compared with the wt construct (Fig. 1Go). Construct hCIITA-D6, which lacks the proximal IRF element, had no response to IFN-{gamma} (Fig. 1Go). Moreover, mutation of the IRF element alone in the context of the full-length CIITA promoter resulted in an almost complete loss of IFN-{gamma} inducibility (Fig. 2Go). Collectively, these results indicate that the proximal IRF element is obligatory in mediating IFN-{gamma} induction of CIITA expression in astrocytes. This finding is in agreement with previous observations that IRF-1 is essential for IFN-{gamma}-induced CIITA and class II MHC expression (17, 39, 40). In those studies, cells from IRF-1-deficient mice showed a lack of IFN-{gamma}-inducible CIITA and class II MHC expression. In addition, STAT-1{alpha} has been shown to be essential for IFN-{gamma}-induced CIITA and class II MHC gene expression. CIITA and class II MHC mRNA expression is not inducible by IFN-{gamma} in bone marrow macrophages from STAT-1{alpha}-deficient mice (41). We have previously shown that treatment of cells with STAT-1{alpha} antisense oligonucleotides reduces STAT-1{alpha} protein expression, leading to a reduction in CIITA and class II MHC expression in response to IFN-{gamma} (12). We have also conducted experiments on astrocytes from STAT-1{alpha}-deficient mice, and these cells cannot be induced to express class II MHC in response to IFN-{gamma} (E. N. Benveniste, unpublished observation). Our results in the astrocytes indicate that the binding of STAT-1{alpha} to the proximal GAS element is not obligatory for IFN-{gamma}-induced type IV CIITA promoter activity. However, since STAT-1{alpha} is required for IFN-{gamma} induction of IRF-1 gene expression (42, 43), this explains the absolute need for STAT-1{alpha} in the overall IFN-{gamma} induction of CIITA and class II MHC expression.

Although a limited number of cell types have been examined for IFN-{gamma}-induced CIITA transcription (melanoma cells and astrocytes), the differences in the absolute requirement for STAT-1{alpha} and IRF-1 may explain the conflicting results regarding the need for protein synthesis for optimal CIITA expression. In HeLa cells, IFN-{gamma} induction of CIITA gene expression does not require new protein synthesis (11), while in THP-1 monocytic cells, human astroglioma cells, and astrocytes, a partial sensitivity of IFN-{gamma}-induced CIITA expression to cycloheximide treatment is observed (10, 12) (data not shown). In some cell types (i.e., HeLa cells), STAT-1{alpha} and USF-1, which are constitutively present in the cell, may be sufficient for CIITA expression; thus, there is no requirement for the synthesis of IRF-1. In cell types such as the astrocyte, the requirement for IRF-1 in addition to STAT-1{alpha} and USF-1 may reflect the need for protein synthesis for optimal CIITA expression. Examination of other cell types will further our understanding of the molecular basis of CIITA expression in different tissues.

We have made the observation that in astrocytes TNF-{alpha} alone has no effect on class II MHC expression, but enhances IFN-{gamma}-induced class II mRNA and protein expression (21, 44). TNF-{alpha} functions by enhancing the rate of IFN-{gamma}-induced class II transcription (45). TNF-{alpha} treatment of astrocytes, in the presence of IFN-{gamma}, leads to the induction of a protein, TNF-{alpha}-induced complex X, that binds to the X2 box of the class II promoter (36); however, we do not know whether expression of TNF-{alpha}-induced complex X is responsible for the TNF-{alpha} enhancement of class II MHC expression. We wished to determine whether the TNF-{alpha}-enhancing effect on IFN-{gamma}-induced class II MHC transcription could be due in part to enhancement of CIITA transcription. Our results indicated that TNF-{alpha} alone had no effect on type IV CIITA promoter activity, nor did TNF-{alpha} enhance IFN-{gamma}-induced CIITA activation (Table IGo). TNF-{alpha} mediates many of its functional effects through activation of NF-{kappa}B, and we have previously shown that TNF-{alpha} activates p65 homodimers and p65/p50 heterodimers in primary rat astrocytes (46). However, although the human type IV CIITA promoter contains an NF-{kappa}B element that could mediate the TNF-{alpha} effect, TNF-{alpha} has no influence on CIITA promoter activity, either alone or in the presence of IFN-{gamma}. Thus, the ability of TNF-{alpha} to enhance IFN-{gamma}-induced class II MHC transcription occur at a step distal to CIITA transcription.

This study has examined the mechanism by which IFN-{gamma} induces CIITA gene expression in primary rat astrocytes, which is critical for subsequent class II MHC expression. As mentioned previously, the role of the class II MHC-positive astrocyte as an APC within the CNS is still unresolved, with some groups reporting activation of Th1 and Th2 function, while others have demonstrated a suppressive and/or apoptotic signal to T cells (27, 28, 29, 32). If class II MHC-positive astrocytes do promote activation of Th2 cells and secretion of IL-4 and IL-10 (28), this could be viewed as beneficial due to the immunoprotective effects of IL-4 and IL-10 within the CNS (47, 48, 49). Transmission of an apoptotic signal to autoreactive T cells by class II MHC-positive astrocytes could also be beneficial in inhibiting aberrant immune responses within the CNS. Understanding the molecular basis of IFN-{gamma}- induced CIITA expression and subsequent class II expression in astrocytes may aid in the regulation of inflammatory responses in the CNS.


    Acknowledgments
 
We thank Sue B. Wade, Cheryl C. Lyles, and Evelyn Rogers for excellent secretarial assistance and Li Ping Tang for technical expertise.


    Footnotes
 
1 This work was supported by National Multiple Sclerosis Society Grant RG-2205-B-9 (to E.N.B.) and National Institutes of Health Grant NS36765 (to E.N.B.). We acknowledge the support of the University of Alabama at Birmingham Center for AIDS Research (CFAR) Molecular Biology Core Facility (Grant AI27767). Back

2 Address correspondence and reprint requests to Dr. Etty N. Benveniste, Department of Cell Biology, Room 350 MCLM, University of Alabama, Birmingham, AL 35294-0005. E-mail address: Back

3 Abbreviations used in this paper: MS, multiple sclerosis; CIITA, class II transactivator; GAS, IFN-{gamma} activation sequence; IRF-1, IFN regulatory factor-1; CNS, central nervous system; TSS, transcription start site; EMSA, electrophoretic mobility shift assay; wt, wild type; mE box, mutant E box; RLA, relative luciferase activity; USF-1, upstream stimulating factor-1. Back

Received for publication October 6, 1998. Accepted for publication January 25, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Rohn, W. M., Y.-J. Lee, E. N. Benveniste. 1996. Regulation of class II MHC expression. Crit. Rev. Immunol. 16:311.[Medline]
  2. Grusby, M. J., L. H. Glimcher. 1995. Immune responses in MHC class II-deficient mice. Annu. Rev. Immunol. 13:417.[Medline]
  3. van den Elsen, P. J., S. J. P. Gobin, M. C. J. A. van Eggermond, A. Peijnenburg. 1998. Regulation of MHC class I and II gene transcription: differences and similarities. Immunogenetics 48:208.[Medline]
  4. Scholl, T., S. K. Mahanta, J. L. Strominger. 1997. Specific complex formation between the type II bare lymphocyte syndrome-associated transactivators CIITA and RFX5. Proc. Natl. Acad. Sci. USA 94:6330.[Abstract/Free Full Text]
  5. Wright, K. L., K.-C. Chin, M. Linhoff, C. Skinner, J. A. Brown, J. M. Boss, G. R. Stark, J. P.-Y. Ting. 1998. CIITA stimulation of transcription factor binding to major histocompatibility complex class II and associated promoters in vivo. Proc. Natl. Acad. Sci. USA 95:6267.[Abstract/Free Full Text]
  6. Fontes, J. D., B. Jiang, B. M. Peterlin. 1997. The class II trans-activator CIITA interacts with the TBP-associated factor TAFll32. Nucleic Acids Res. 25:2522.[Abstract/Free Full Text]
  7. Mahanta, S. K., T. Scholl, F.-C. Yang, J. L. Strominger. 1997. Transactivation by CIITA, the type II bare lymphocyte syndrome-associated factor, requires participation of multiple regions of the TATA box binding protein. Proc. Natl. Acad. Sci. USA 94:6324.[Abstract/Free Full Text]
  8. Otten, L. A., V. Steimle, S. Bontron, B. Mach. 1998. Quantitative control of MHC class II expression by the transactivator CIITA. Eur. J. Immunol. 28:473.[Medline]
  9. Steimle, V., L. A. Otten, M. Zufferey, B. Mach. 1993. Complementation cloning of an MHC class II transactivator mutated in hereditary MHC class II deficiency (or bare lymphocyte syndrome). Cell 75:135.[Medline]
  10. Steimle, V., C.-A. Siegrist, A. Mottet, B. Lisowska-Grospierre, B. Mach. 1994. Regulation of MHC class II expression by interferon-{gamma} mediated by the transactivator gene CIITA. Science 265:106.[Abstract/Free Full Text]
  11. Chang, C.-H., J. D. Fontes, M. Peterlin, R. A. Flavell. 1994. Class II transactivator (CIITA) is sufficient for the inducible expression of major histocompatibility complex class II genes. J. Exp. Med. 180:1367.[Abstract/Free Full Text]
  12. Lee, Y.-J., E. N. Benveniste. 1996. STAT-1{alpha} expression is involved in IFN-{gamma} induction of the class II transactivator and class II MHC genes. J. Immunol. 157:1559.[Abstract]
  13. Lee, Y.-J., Y. Han, H.-T. Lu, V. Nguyen, H. Qin, P. H. Howe, B. A. Hocevar, J. M. Boss, R. M. Ransohoff, E. N. Benveniste. 1997. TGF-ß suppresses IFN-{gamma} induction of class II MHC gene expression by inhibiting class II transactivator messenger RNA expression. J. Immunol. 158:2065.[Abstract]
  14. Chin, K.-C., C. Mao, C. Skinner, J. L. Riley, K. L. Wright, C. S. Moreno, G. R. Stark, J. M. Boss, J. P.-Y. Ting. 1994. Molecular analysis of G1B and G3A IFN-{gamma} mutants reveals that defects in CIITA or RFX result in defective class II MHC and Ii gene induction. Immunity 1:687.[Medline]
  15. Chang, C.-H., S. Guerder, S.-C. Hong, W. van Ewijk, R. A. Flavell. 1996. Mice lacking the MHC class II transactivator (CIITA) show tissue-specific impairment of MHC class II expression. Immunity 4:167.[Medline]
  16. Muhlethaler-Mottet, A., L. A. Otten, V. Steimle, B. Mach. 1997. Expression of MHC class II molecules in different cellular and functional compartments is controlled by differential usage of multiple promoters of the transactivator CIITA. EMBO J. 16:2851.[Medline]
  17. Muhlethaler-Mottet, A., W. Di Berardino, L. A. Otten, B. Mach. 1998. Activation of the MHC class II transactivator CIITA by interferon-{gamma} requires cooperative interaction between Stat1 and USF-1. Immunity 8:157.[Medline]
  18. Benveniste, E. N.. 1997. Cytokines: Influence on glial cell gene expression and function. J. E. Blalock, ed. Neuroimmunoendocrinology 31. Karger, Basel.
  19. Shrikant, P., E. N. Benveniste. 1996. The central nervous system as an immunocompetent organ: role of glial cells in antigen presentation. J. Immunol. 157:1819.[Abstract]
  20. Fontana, A., W. Fierz, H. Wekerle. 1984. Astrocytes present myelin basic protein to encephalitogenic T-cell lines. Nature 307:273.[Medline]
  21. Vidovic, M., S. M. Sparacio, M. Elovitz, E. N. Benveniste. 1990. Induction and regulation of class II MHC mRNA expression in astrocytes by IFN-{gamma} and TNF-{alpha}. J. Neuroimmunol. 30:189.[Medline]
  22. Lee, S. C., G. R. W. Moore, G. Golenwsky, C. S. Raine. 1990. Multiple sclerosis: a role for astroglia in active demyelination suggested by class II MHC expression and ultrastructural study. J. Neuropathol. Exp. Neurol. 49:122.[Medline]
  23. Hofman, F. M., R. VonHanwher, C. Dinarello, S. Mizel, D. Hinton, J. E. Merrill. 1986. Immunoregulatory molecules and IL-2 receptors identified in multiple sclerosis brain. J. Immunol. 136:3239.[Abstract]
  24. Hickey, W. F., J. P. Osborn, W. M. Kirby. 1985. Expression of Ia molecules by astrocytes during acute experimental allergic encephalomyelitis in the Lewis rat. Cell. Immunol. 91:528.[Medline]
  25. Matsumoto, Y., K. Kawai, M. Fujiwara. 1989. In situ Ia expression on brain cells in the rat: autoimmune encephalomyelitis-resistant strain (BN) and susceptible strain (Lewis) compared. Immunology 66:621.[Medline]
  26. Fierz, W., B. Endler, K. Reske, H. Wekerle, A. Fontana. 1985. Astrocytes as antigen presenting cells. I. Induction of Ia antigen expression on astrocytes by T cells via immune interferon and its effect on antigen presentation. J. Immunol. 134:3785.[Abstract]
  27. Nikcevich, K. M., K. B. Gordon, L. Tan, S. D. Hurst, J. F. Kroepfl, M. Gardinier, T. A. Barrett, S. D. Miller. 1997. IFN-{gamma}-activated primary murine astrocytes express B7 costimulatory molecules and prime naive antigen-specific T cells. J. Immunol. 158:614.[Abstract]
  28. Aloisi, F., F. Ria, G. Penna, L. Adorini. 1998. Microglia are more efficient than astrocytes in antigen processing and in Th1 but not Th2 cell activation. J. Immunol. 160:4671.[Abstract/Free Full Text]
  29. Tan, L., K. B. Gordon, J. P. Mueller, L. A. Matis, S. D. Miller. 1998. Presentation of proteolipid protein epitopes and B7-1-dependent activation of encephalitogenic T cells by IFN-{gamma}-activated SJL/J astrocytes. J. Immunol. 160:4271.[Abstract/Free Full Text]
  30. Matsumoto, Y., K. Ohmori, M. Fujiwara. 1992. Immune regulation by brain cells in the central nervous system: microglia but not astrocytes present myelin basic protein to encephalitogenic T cells under in vivo-mimicking conditions. Immunology 76:209.[Medline]
  31. Weber, F., E. Meinl, F. Aloisi, C. Nevinny-Stickel, E. Albert, H. Wekerle, R. Hohlfeld. 1994. Human astrocytes are only partially competent antigen presenting cells. Brain 117:59.[Abstract/Free Full Text]
  32. Gold, R., M. Schmied, U. Tontsch, H. P. Hartung, H. Wekerle, K. V. Toyka, H. Lassmann. 1996. Antigen presentation by astrocytes primes rat T lymphocytes for apoptotic cell death. Brain 119:651.[Abstract/Free Full Text]
  33. Shrikant, P., D. J. Benos, L.-P. Tang, E. N. Benveniste. 1996. HIV glycoprotein 120 enhances intercellular adhesion molecule-1 gene expression in glial cells: involvement of Janus kinase/signal transducer and activator of transcription and protein kinase C signaling pathways. J. Immunol. 156:1307.[Abstract]
  34. Bignami, A., L. F. Eng, D. Dahl, C. T. Uyeda. 1972. Localization of the glial fibrillary acidic protein in astrocytes by immunofluorescence. Brain Res. 43:429.[Medline]
  35. Rohn, W., L. P. Tang, Y. Dong, E. N. Benveniste. 1999. IL-1ß inhibits IFN-{gamma} induced class II MHC expression by suppressing transcription of the class II transactivator gene. J. Immunol. 162:886.[Abstract/Free Full Text]
  36. Panek, R. B., Y.-J. Lee, Y. Lindstrom-Itoh, J. P.-Y. Ting, E. N. Benveniste. 1994. Characterization of astrocyte nuclear proteins involved in IFN-{gamma} and TNF-{alpha} mediated class II MHC gene expression. J. Immunol. 153:4555.[Abstract]
  37. Shrikant, P., S. J. Lee, I. Kalvakalanu, R. M. Ransohoff, E. N. Benveniste. 1996. Stimulus-specific inhibition of ICAM-1 gene expression by TGF-ß. J. Immunol. 157:892.[Abstract]
  38. Quandt, K., K. Frech, H. Karas, E. Wingender, T. Werner. 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic Acids Res. 23:4878.[Abstract/Free Full Text]
  39. Hobart, M., V. Ramassar, N. Goes, J. Urmson, P. F. Halloran. 1997. IFN regulatory factor-1 plays a central role in the regulation of the expression of class I and II MHC genes in vivo. J. Immunol. 158:4260.[Abstract]
  40. Hobart, M., V. Ramassar, N. Goes, J. Urmson, P. F. Halloran. 1996. The induction of class I and II major histocompatibility complex by allogeneic stimulation is dependent on the transcription factor interferon regulatory factor 1 (IRF-1). Transplantation 62:1895.[Medline]
  41. Meraz, M., J. M. White, K. C. F. Sheehan, E. A. Bach, S. J. Rodig, A. S. Dighe, D. H. Kaplan, J. K. Riley, A. C. Greenlund, D. Campbell, et al 1996. Targeted disruption of the Stat1 gene in mice reveals unexpected physiologic specificity in the JAK-STAT signaling pathway. Cell 84:431.[Medline]
  42. Pine, R., A. Canova, C. Schindler. 1994. Tyrosine phosphorylated p91 binds to a single element in the ISGF2/IRF-1 promoter to mediate induction by IFN{alpha} and IFN{gamma}, and is likely to autoregulate the p91 gene. EMBO J. 13:158.[Medline]
  43. Pine, R.. 1997. Convergence of TNF{alpha} and IFN{gamma} signalling pathways through synergistic induction of IRF-1/ISGF-2 is mediated by a composite GAS/{kappa}B promoter element. Nucleic Acids Res. 25:4346.[Abstract/Free Full Text]
  44. Benveniste, E. N., S. M. Sparacio, J. R. Bethea. 1989. Tumor necrosis factor-{alpha} enhances interferon-{gamma} mediated class II antigen expression on astrocytes. J. Neuroimmunol. 25:209.[Medline]
  45. Panek, R. B., H. Moses, J. P.-Y. Ting, E. N. Benveniste. 1992. Tumor necrosis factor {alpha} response elements in the HLA-DRA promoter: identification of a tumor necrosis factor {alpha}-induced DNA-protein complex in astrocytes. Proc. Natl. Acad. Sci. USA 89:11518.[Abstract/Free Full Text]
  46. Lee, S. J., J. Hou, E. N. Benveniste. 1998. Transcriptional regulation of intercellular adhesion molecule-1 in astrocytes involves NF-{kappa}B and C/EBP isoforms. J. Neuroimmunol. 92:196.[Medline]
  47. Röcken, M., M. Racke, E. M. Shevach. 1996. IL-4-induced immune deviation as antigen-specific therapy for inflammatory autoimmune disease. Immunol. Today 17:225.[Medline]
  48. Segal, B. M., B. K. Dwyer, E. M. Shevach. 1998. An interleukin (IL)-10/IL-12 immunoregulatory circuit controls susceptibility to autoimmune disease. J. Exp. Med. 187:537.[Abstract/Free Full Text]
  49. Bettelli, E., M. P. Das, E. D. Howard, H. L. Weiner, R. A. Sobel, V. K. Kuchroo. 1998. IL-10 is critical in the regulation of autoimmune encephalomyelitis as demonstrated by studies of IL-10- and IL-4-deficient and transgenic mice. J. Immunol. 161:3299.[Abstract/Free Full Text]



This article has been cited by other articles:


Home page
J. Neurol. Neurosurg. PsychiatryHome page
J P Mostert, F Admiraal-Behloul, J M Hoogduin, J Luyendijk, D J Heersema, M A van Buchem, and J De Keyser
Effects of fluoxetine on disease activity in relapsing multiple sclerosis: a double-blind, placebo-controlled, exploratory study
J. Neurol. Neurosurg. Psychiatry, September 1, 2008; 79(9): 1027 - 1031.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Qin, S. A. Niyongere, S. J. Lee, B. J. Baker, and E. N. Benveniste
Expression and Functional Significance of SOCS-1 and SOCS-3 in Astrocytes
J. Immunol., September 1, 2008; 181(5): 3167 - 3176.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. H. Wang, S. Gregoire, E. Zika, L. Xiao, C. S. Li, H. Li, K. L. Wright, J. P. Ting, and X.-J. Yang
Identification of the Ankyrin Repeat Proteins ANKRA and RFXANK as Novel Partners of Class IIa Histone Deacetylases
J. Biol. Chem., August 12, 2005; 280(32): 29117 - 29127.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
E. S. Hwang, D. W. Kim, J. H. Hwang, H. S. Jung, J. M. Suh, Y. J. Park, H. K. Chung, J. H. Song, K. C. Park, S. H. Park, et al.
Regulation of Signal Transducer and Activator of Transcription 1 (STAT1) and STAT1-Dependent Genes by RET/PTC (Rearranged in Transformation/Papillary Thyroid Carcinoma) Oncogenic Tyrosine Kinases
Mol. Endocrinol., November 1, 2004; 18(11): 2672 - 2684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Nozell, Z. Ma, C. Wilson, R. Shah, and E. N. Benveniste
Class II Major Histocompatibility Complex Transactivator (CIITA) Inhibits Matrix Metalloproteinase-9 Gene Expression
J. Biol. Chem., September 10, 2004; 279(37): 38577 - 38589.
[Abstract] [Full Text] [PDF]


Home page
Mol Cancer ResHome page
M. E. Stearns, G. Kim, F. Garcia, and M. Wang
Interleukin-10 Induced Activating Transcription Factor 3 Transcriptional Suppression of Matrix Metalloproteinase-2 Gene Expression in Human Prostate CPTX-1532 Cells
Mol. Cancer Res., July 1, 2004; 2(7): 403 - 416.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
H. Kim, J. M. Suh, E. S. Hwang, D. W. Kim, H. K. Chung, J. H. Song, J. H. Hwang, K. C. Park, H. K. Ro, E.-K. Jo, et al.
Thyrotropin-Mediated Repression of Class II Trans-Activator Expression in Thyroid Cells: Involvement of STAT3 and Suppressor of Cytokine Signaling
J. Immunol., July 15, 2003; 171(2): 616 - 627.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
P. J. van den Elsen, N. van der Stoep, and T. Yazawa
Class II Transactivator (CIITA) Deficiency in Tumor Cells: Complicated Mechanisms or Not?
Am. J. Pathol., July 1, 2003; 163(1): 373 - 376.
[Full Text] [PDF]


Home page
BloodHome page
J.-M. Waldburger, S. Rossi, G. A. Hollander, H.-R. Rodewald, W. Reith, and H. Acha-Orbea
Promoter IV of the class II transactivator gene is essential for positive selection of CD4+ T cells
Blood, May 1, 2003; 101(9): 3550 - 3559.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-l. Huang, R. Pawliczak, X.-l. Yao, M. J. Cowan, M. T. Gladwin, M. J. Walter, M. J. Holtzman, P. Madara, C. Logun, and J. H. Shelhamer
Interferon-gamma Induces p11 Gene and Protein Expression in Human Epithelial Cells through Interferon-gamma -activated Sequences in the p11 Promoter
J. Biol. Chem., March 7, 2003; 278(11): 9298 - 9308.
[Abstract] [Full Text] [PDF]


Home page
Arch NeurolHome page
J. De Keyser, E. Zeinstra, and E. Frohman
Are Astrocytes Central Players in the Pathophysiology of Multiple Sclerosis?
Arch Neurol, January 1, 2003; 60(1): 132 - 136.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
O. Stuve, S. Youssef, A. J. Slavin, C. L. King, J. C. Patarroyo, D. L. Hirschberg, W. J. Brickey, J. M. Soos, J. F. Piskurich, H. A. Chapman, et al.
The Role of the MHC Class II Transactivator in Class II Expression and Antigen Presentation by Astrocytes and in Susceptibility to Central Nervous System Autoimmune Disease
J. Immunol., December 15, 2002; 169(12): 6720 - 6732.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. W. Wong, N. Ghosh, K. P. McKinnon, W. Reed, J. F. Piskurich, K. L. Wright, and J. P.-Y. Ting
Regulation and Specificity of MHC2TA Promoter Usage in Human Primary T Lymphocytes and Cell Line
J. Immunol., September 15, 2002; 169(6): 3112 - 3119.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. K. Pai, D. Askew, W. H. Boom, and C. V. Harding
Regulation of Class II MHC Expression in APCs: Roles of Types I, III, and IV Class II Transactivator
J. Immunol., August 1, 2002; 169(3): 1326 - 1333.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Kumatori, D. Yang, S. Suzuki, and M. Nakamura
Cooperation of STAT-1 and IRF-1 in Interferon-gamma -induced Transcription of the gp91phox Gene
J. Biol. Chem., March 8, 2002; 277(11): 9103 - 9111.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. M. Holling, N. van der Stoep, E. Quinten, and P. J. van den Elsen
Activated Human T Cells Accomplish MHC Class II Expression Through T Cell-Specific Occupation of Class II Transactivator Promoter III
J. Immunol., January 15, 2002; 168(2): 763 - 770.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Pathol.Home page
J. Maier, C. Kincaid, A. Pagenstecher, and I. L. Campbell
Regulation of Signal Transducer and Activator of Transcription and Suppressor of Cytokine-Signaling Gene Expression in the Brain of Mice with Astrocyte-Targeted Production of Interleukin-12 or Experimental Autoimmune Encephalomyelitis
Am. J. Pathol., January 1, 2002; 160(1): 271 - 288.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. A. Rahat, I. Chernichovski, and N. Lahat
Increased binding of IFN regulating factor 1 mediates the synergistic induction of CIITA by IFN-{gamma} and tumor necrosis factor-{alpha} in human thyroid carcinoma cells
Int. Immunol., November 1, 2001; 13(11): 1423 - 1432.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
H. Kim, T.-H. Lee, Y. S. Hwang, M. A. Bang, K. H. Kim, J. M. Suh, H. K. Chung, D.-Y. Yu, K.-K. Lee, O-Y. Kwon, et al.
Methimazole As an Antioxidant and Immunomodulator in Thyroid Cells: Mechanisms Involving Interferon-gamma Signaling and H2O2 Scavenging
Mol. Pharmacol., November 1, 2001; 60(5): 972 - 980.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Z. Ma, H. Qin, and E. N. Benveniste
Transcriptional Suppression of Matrix Metalloproteinase-9 Gene Expression by IFN-{gamma} and IFN-{beta}: Critical Role of STAT-1{alpha}
J. Immunol., November 1, 2001; 167(9): 5150 - 5159.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Landmann, A. Muhlethaler-Mottet, L. Bernasconi, T. Suter, J.-M. Waldburger, K. Masternak, J.-F. Arrighi, C. Hauser, A. Fontana, and W. Reith
Maturation of Dendritic Cells Is Accompanied by Rapid Transcriptional Silencing of Class II Transactivator (Ciita) Expression
J. Exp. Med., August 20, 2001; 194(4): 379 - 392.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
J.-M. Waldburger, T. Suter, A. Fontana, H. Acha-Orbea, and W. Reith
Selective Abrogation of Major Histocompatibility Complex Class II Expression on Extrahematopoietic Cells in Mice Lacking Promoter IV of the Class II Transactivator Gene
J. Exp. Med., August 20, 2001; 194(4): 393 - 406.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
K. Honey and A. Rudensky
The Piv-Otal Class II Transactivator Promoter Regulates Major Histocompatibility Complex Class II Expression in the Thymus
J. Exp. Med., August 20, 2001; 194(4): f15 - f18.
[Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Dong, L. Tang, J. J. Letterio, and E. N. Benveniste
The Smad3 Protein Is Involved in TGF-{{beta}} Inhibition of Class II Transactivator and Class II MHC Expression
J. Immunol., July 1, 2001; 167(1): 311 - 319.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. M. O'Keefe, V. T. Nguyen, L. Ping Tang, and E. N. Benveniste
IFN-{{gamma}} Regulation of Class II Transactivator Promoter IV in Macrophages and Microglia: Involvement of the Suppressors of Cytokine Signaling-1 Protein
J. Immunol., February 15, 2001; 166(4): 2260 - 2269.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
D. D. Eason and G. Blanck
High Level Class II trans-Activator Induction Does Not Occur with Transient Activation of the IFN-{{gamma}} Signaling Pathway
J. Immunol., January 15, 2001; 166(2): 1041 - 1048.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. A. Harton and J. P.-Y. Ting
Class II Transactivator: Mastering the Art of Major Histocompatibility Complex Expression
Mol. Cell. Biol., September 1, 2000; 20(17): 6185 - 6194.
[Full Text]


Home page
J. Biol. Chem.Home page
G. B. Ehret, P. Reichenbach, U. Schindler, C. M. Horvath, S. Fritz, M. Nabholz, and P. Bucher
DNA Binding Specificity of Different STAT Proteins. COMPARISON OF IN VITRO SPECIFICITY WITH NATURAL TARGET SITES
J. Biol. Chem., February 23, 2001; 276(9): 6675 - 6688.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. T. Nguyen and E. N. Benveniste
Involvement of STAT-1 and Ets Family Members in Interferon-gamma Induction of CD40 Transcription in Microglia/Macrophages
J. Biol. Chem., July 28, 2000; 275(31): 23674 - 23684.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Suk, I. Chang, Y.-H. Kim, S. Kim, J. Y. Kim, H. Kim, and M.-S. Lee
Interferon gamma (IFNgamma ) and Tumor Necrosis Factor alpha Synergism in ME-180 Cervical Cancer Cell Apoptosis and Necrosis. IFNgamma INHIBITS CYTOPROTECTIVE NF-kappa B THROUGH STAT1/IRF-1 PATHWAYS
J. Biol. Chem., April 13, 2001; 276(16): 13153 - 13159.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Dong, Y.
Right arrow Articles by Benveniste, E. N.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Dong, Y.
Right arrow Articles by Benveniste, E. N.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS