The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fehniger, T. A.
Right arrow Articles by Caligiuri, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fehniger, T. A.
Right arrow Articles by Caligiuri, M. A.
The Journal of Immunology, 1999, 162: 4511-4520.
Copyright © 1999 by The American Association of Immunologists

Differential Cytokine and Chemokine Gene Expression by Human NK Cells Following Activation with IL-18 or IL-15 in Combination with IL-12: Implications for the Innate Immune Response1

Todd A. Fehniger*,{dagger},{ddagger}, Manisha H. Shah*,{dagger}, Matthew J. Turner{dagger}, Jeffrey B. VanDeusen*,{dagger}, Susan P. Whitman{dagger}, Megan A. Cooper{dagger}, Kazuhiro Suzuki{dagger}, Mark Wechser§, Frederico Goodsaid§ and Michael A. Caligiuri2,*,{dagger},{ddagger}

Department of Internal Medicine, Divisions of * Hematology/Oncology and {dagger} Human Cancer Genetics, {ddagger} Department of Medical Microbiology and Immunology, and the Comprehensive Cancer Center, Ohio State University, Columbus, OH 43210; and § PE Applied Biosystems, Foster City, CA 94404


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
NK cells constitutively express monocyte-derived cytokine (monokine) receptors and secrete cytokines and chemokines following monokine stimulation, and are therefore a critical component of the innate immune response to infection. Here we compared the effects of three monokines (IL-18, IL-15, and IL-12) on human NK cell cytokine and chemokine production. IL-18, IL-15, or IL-12 alone did not stimulate significant cytokine or chemokine production in resting NK cells. The combination of IL-18 and IL-12 induced extremely high amounts of IFN-{gamma} protein (225 ± 52 ng/ml) and a 1393 ± 643-fold increase in IFN-{gamma} gene expression over those in resting NK cells. IL-15 and IL-12 induced less IFN-{gamma} protein (24 ± 10 ng/ml; p < 0.007) and only a 45 ± 19-fold increase in IFN-{gamma} gene expression over those in resting NK cells. The CD56bright NK cell subset produced significantly more IFN-{gamma} following IL-18 and IL-12 compared with CD56dim NK cells (p < 0.008). However, the combination of IL-15 and IL-12 was significantly more potent than that of IL-18 and IL-12 for NK cell production of IL-10, macrophage inflammatory protein-1{alpha}, macrophage inflammatory protein-1ß, and TNF-{alpha} at the protein and transcript levels. Granulocyte-macrophage CSF was optimally induced by IL-15 and IL-18. Resting CD56+ NK cells expressed IL-18R transcript that was up-regulated by IL-12 or IL-15. Our results show that distinct cytokine and chemokine patterns are induced in NK cells in response to different costimulatory signals from these three monokines. This suggests that NK cell cytokine production may be governed in part by the monokine milieu induced during the early proinflammatory response to infection and by the subset of NK cells present at the site of inflammation.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
The NK cell is a critical component of the innate immune response to a variety of pathogens, including viruses, fungi, parasites, and bacteria (1, 2, 3, 4, 5). Resting human NK cells constitutively express a number of monocyte-derived cytokine (monokine)3 receptors and secrete immunoregulatory cytokines and chemokines following stimulation with monokines (6, 7). This NK cell effector function does not appear to require any prior sensitization, supporting a role for NK cell-derived cytokines in the early response to infection. In this context, several murine models have shown NK cell-derived cytokines to be critical in the early response against obligate intracellular pathogens such as Toxoplasma gondii (8), Listeria monocytogenes (9), and Leishmania major (10). In these infectious models, pathogens are thought to indirectly activate NK cell cytokine production via their induction of monokines; however, direct recognition of organisms by NK cells has not been rigorously excluded (11). In addition, an in vitro coculture system demonstrated that simulated infection of human macrophages with LPS resulted in monokine production, which, in turn, stimulated human NK cell IFN-{gamma} production (12). NK cells may also influence the type of Th cell responses generated through their early production of immunoregulatory cytokines such as IFN-{gamma}, during T cell clonal expansion (11, 13, 14).

IL-12 is a proinflammatory and immunomodulatory cytokine produced by activated macrophages in response to infection and has a central role in directing the type 1 cytokine response as well as inducing NK cell cytotoxicity (reviewed in 3, 5). IL-12 has been shown to stimulate human NK cell cytokine and chemokine production, usually in synergy with other costimulatory cytokines (15, 16, 17, 18, 19). IL-15, a cytokine that shares biological functions and uses shared receptor components with IL-2, is also produced by macrophages activated with bacterial products (12, 20, 21). We have previously shown that these monokines, IL-15 and IL-12, are potent inducers of IFN-{gamma}, TNF-{alpha}, granulocyte-macrophage CSF (GM-CSF), macrophage inflammatory protein-1{alpha} (MIP-1{alpha}), and MIP-1ß production by human NK cells (12, 16, 17, 19).

IL-18 is a novel proinflammatory cytokine produced by activated macrophages in response to bacterial components and appears to use IL-1R-related protein (IL-1Rrp) to mediate intracellular signals similar to those induced by IL-1 (reviewed in 22, 23). Alone, IL-18 has the ability to augment murine (24) and human (25) NK cell cytotoxicity and up-regulate murine NK cell expression of Fas ligand (26); in combination with IL-12 it induces IFN-{gamma} production by murine NK1.1+CD3- cells (27). To date, reports of the effects of IL-18 on human cells have focused on the bulk stimulation of PBMC or purified primary T cells (25, 28, 29, 30). These studies have shown that IL-18 in combination with Con A or TCR/CD3 cross-linking induced IFN-{gamma} by human PBMC (25), and that IL-18 plus TCR/CD3 signals induced IFN-{gamma} and GM-CSF production by primary human T cells (28). Recently, IL-18 alone has been shown to induce IL-8 production by human PBMC and purified NK cells (29). However, the direct effects of IL-18 on cytokine and chemokine production by purified populations of human NK cells have not, to the best of our knowledge, been reported.

In the present study we characterized the effects of rhIL-18, alone and in combination with rhIL-12, on the induction of cytokine (IFN-{gamma}, IL-10, TNF-{alpha}, and GM-CSF) and C-C chemokine (MIP-1{alpha} and MIP-1ß) transcript and protein production by resting human NK cells. In addition, we directly compared the effects of various combinations of three monokines, i.e., IL-18, IL-15, and IL-12, on the induction of cytokine and chemokines, thereby providing some insight into the cytokine profiles induced by these different monokine combinations. Our results show that different combinations of IL-18, IL-15, and IL-12 optimally induced distinct cytokine and chemokine patterns, and these patterns vary between NK cell subsets.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Reagents

Purified rhIL-15 was provided by Immunex (Seattle, WA). Purified rhIL-12 (sp. act., 4.5 x 106 U/mg) was obtained from Genetics Institute (Cambridge, MA). Purified rhIL-18 was a gift from Vertex Pharmaceuticals (Cambridge, MA). All cytokines were reconstituted in sterile PBS with 0.1% human albumin (Armour, Kankakee, IL) and were endotoxin free. PE-conjugated anti-human CD56 mAb was purchased from Coulter Immunology (Hialeah, FL), and PE-isotype control mAb was purchased from Becton Dickinson (San Jose, CA). FITC-conjugated anti-human IFN-{gamma} mAb and isotype control mAb were purchased from PharMingen (San Diego, CA).

Isolation of human NK cells

Normal donor PBMC were obtained from leukopacs (American Red Cross, Columbus, OH) using Ficoll-Hypaque (Sigma, St. Louis, MO) density gradient centrifugation. RBC were lysed, after which PBMC were washed twice in RPMI 1640 supplemented with 10% human AB serum (HAB; C-six Diagnostics, Mequon, WI), antibiotics, and anti-pleuropneumonia-like organism (Life Technologies, Grand Island, NY; 10% HAB) and cultured for 2 h in plastic tissue culture dishes to remove adherent monocytes. T cells, B cells, and remaining monocytes were depleted using goat anti-mouse immunomagnetic beads (PerSeptive Biosystems, Framingham, MA) and a combination of murine mAb reactive against CD3, CD20, and HLA-DR, as described previously (31). Nondepleted cells were then stained with CD56-PE mAb, washed in 10% HAB, and isolated by FACS for total CD56+ NK cells or CD56bright and CD56dim NK cell subsets on a Coulter ELITE flow cytometer (Coulter Immunology). Sorted CD56+ NK cells were routinely >=98% pure as determined by flow cytometric analysis. NK cells enriched by negative selection (>=85% pure) were used for Northern analysis of IL-18R expression.

Stimulation of human NK cells with recombinant human monokines

For analysis of cytokine protein production, FACS-purified CD56+ NK cells were cultured at 0.5 x 106/ml (unless otherwise indicated) in 10% HAB and plated in 96-well U-bottom plates. After 72 h, cell-free culture supernatants were harvested, centrifuged to remove any cells or debris, and frozen at -80°C until assayed by commercial ELISA. Supernatants underwent only one freeze-thaw cycle before quantitation by ELISA. For analysis of cytokine protein by intracellular flow cytometry, purified NK cells or FACS sorted NK cell subsets were cultured (1 x 106/ml) for 24 h in 10% HAB in 96-well U-bottom plates, harvested, and immediately stained for IFN-{gamma} protein. Brefeldin A (Sigma) was added at a final concentration of 10 µg/ml during the final 4 h of culture. For quantitation of cytokine transcript by real-time PCR, cell sorted CD56+ NK cells were either placed immediately in 300 µl of RNA lysis buffer (Ambion, Austin, TX) or cultured (3 x 106/ml) in 24-well flat-bottom plates with IL-12 (10 U/ml), IL-15 (100 ng/ml), and/or IL-18 (100 ng/ml) at 37°C for the indicated times, followed by lysis in RNA lysis buffer. For analysis of steady state IL-18R (IL-1Rrp) transcript by Northern blot, enriched (>=85%) CD56+ NK cells were cultured (3 x 106/ml) in 24-well flat-bottom plates in medium, IL-12 (10 U/m), or IL-15 (100 ng/ml) for 24 h, followed by lysis in RNA lysis buffer. Samples in RNA lysis buffer were stored at -80°C until RNA isolation was performed.

Measurement of NK cell cytokine protein in cell culture supernatants

Human NK cell production of IFN-{gamma}, TNF-{alpha}, GM-CSF (sensitivity, 20 pg/ml; Endogen, Woburn, MA), IL-10 (sensitivity, 0.625 pg/ml; BioSource International, Camarillo, CA), MIP-1{alpha}, and MIP-1ß (sensitivity, 20 pg/ml; R&D Systems, Minneapolis, MN) protein was measured in duplicate from cell-free culture supernatants with commercial ELISA kits, following the manufacturers’ instructions.

Detection of IFN-{gamma} production by intracellular flow cytometry

Following 24-h culture in the indicated monokine(s), CD56+ NK cells were harvested and transferred into 5-ml flow tubes. Cells were then surface stained with anti-CD56-PE mAb, washed in FACS buffer (PBS with 1% FCS), and fixed in 2% paraformaldehyde for 30 min at room temperature. After fixation, cells were washed, resuspended in 25 µl of permeabilization buffer (PBS with 0.5% saponin), and incubated for 30 min at room temperature. Next, anti-IFN-{gamma}-FITC or isotype control-FITC mAb were added at a final dilution of 1/100, and cells were incubated for an additional 30 min at room temperature. Cells were then washed twice with FACS buffer and resuspended in a total volume of 1 ml of FACS buffer for analysis. Forward scatter, side scatter, and fluorescence data were collected on a Coulter XL flow cytometer (Coulter Immunology) and analyzed with the WinMDI software program (Joseph Trotter, Scripps Research Institute, La Jolla, CA). The percentage of CD56+ cells expressing detectable IFN-{gamma} and the mean fluorescence intensity (MFI) are indicated in the appropriate quadrant of each dot plot. Nonreactive FITC-isotype control staining of identical cells was used to set the quadrant gates, with >=99.5% of cells located in the negative quadrants.

Quantitation of NK cell cytokine transcripts by real-time PCR

Real-time RT-PCR is a novel method that allows a rapid, accurate, and precise quantitation of gene transcripts (32, 33). Real-time PCR assays were performed with modifications to specifically quantitate human cytokine and chemokine (IFN-{gamma}, IL-10, TNF-{alpha}, MIP-1{alpha}, and MIP-1ß) transcripts. Total cellular RNA was extracted using RNAqueous total RNA isolation kits (Ambion), and cDNAs were generated by RT of 1–2 µg of cellular RNA in the presence of random hexamer primers (Clontech, Palo Alto, CA) following the manufacturer’s recommendations. Each cDNA sample (2.5 µl) was then used as a template for a PCR amplification mixture containing forward and reverse primers (900 nM each), 6-carboxy-fluorescein-labeled probe (125 nM) for the target cytokine (i.e., IFN-{gamma}, IL-10, TNF-{alpha}, MIP-1{alpha}, or MIP-1ß), forward and reverse primers for the 18S ribosomal RNA (rRNA; 50 nM each), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein-labeled probe (50 nM) for 18S rRNA (internal control), and 2x TaqMan Universal PCR Master Mix (PE Applied Biosystems, Foster City, CA). The PCR amplifications for target cytokine and internal control 18S rRNA were performed in the same well of capped 96-well optical plates. Reaction mixtures were subjected to the following amplification scheme: one cycle at 50°C for 2 min (AmpErase UNG deactivation) and one cycle at 95°C for 10 min (AmpliTaq Gold activation), followed by 40 cycles at 95°C (denaturation) for 15 s and 60°C (anneal/extension) for 1 min. Real-time PCR data were analyzed using Sequence Detector version 1.6 software included with the 7700 Sequence Detector (PE Applied Biosystems). Final quantitation was derived using the comparative CT method (see below) and is reported as the n-fold difference relative to a calibrator cDNA (resting NK cell sample from each donor) prepared in parallel with the experimental cDNAs. In some instances the absolute fold increase was normalized to the optimal stimulation conditions (i.e., the stimulation that resulted in the greatest absolute fold increase) and expressed as a percentage of the maximal fold increase. All data calculations were performed with the Microsoft Excel software program (Microsoft, Redmond, WA).

The comparative CT method

The fractional cycle number at which the reporter fluorescence generated by the cleavage of the probe passes a fixed threshold above baseline is defined as the parameter threshold cycle (CT). 18S rRNA was used as an internal control to distinguish true target negatives from PCR inhibition and also to normalize for differences in the amount of total nucleic acid added to a reaction. The detection of multiple target cDNAs in the same tube was achieved by labeling probes with different and distinguishable reporter dyes. For relative quantitation, values are expressed relative to a reference sample, called the calibrator (resting NK cell cDNA in this study), and relative quantitation was calculated by the comparative CT method. First, the CT for the target amplicon and the CT for the internal control were determined for each sample. Differences in the CT for the target and the CT for the internal control, called {Delta}CT, were calculated to normalize for the differences in the amount of total nucleic acid added to each reaction. Then the {Delta}CT for each experimental sample was subtracted from the {Delta}CT of calibrator. This difference is termed the {Delta}{Delta}CT. Finally, the amount of target, normalized to an internal control and relative to the calibrator, was calculated by 2-{Delta}{Delta}CT. Thus, all experimental samples are expressed as an n-fold difference relative to the calibrator.

Quality control of the real-time PCR

All human cytokine and chemokine primers and probes used for this study were obtained from PE Applied Biosystems and are commercially available. Before analyzing experimental samples, primer and probe concentrations were optimized for each target cytokine. In addition, positive control cDNA (PHA-activated human PBL), negative control cDNA (P815 murine cell line), and human genomic DNA samples were tested to ensure the specificity of primers and probes for amplification of the target cDNA. The comparative CT method was validated for each target cytokine by demonstrating that {Delta}CT varied with serial template dilution.

Northern analysis for IL-1Rrp expression

The IL-18R (IL-1Rrp) cDNA probe was generated by PCR amplification using primers synthesized based upon the published cDNA sequence (5' primer, CTTTGCTGAATGAAGAGGATGTAAT; 3' primer, CTTTCAAGTTCATACCTGACCTCAT) (34). Total cellular RNA was extracted from resting and monokine-activated NK cell lysates using RNAqueous total RNA isolation kits (Ambion). After isolation, RNA (15 µg) was diluted to a total volume of 15 µl with RNA sample loading buffer containing ethidium bromide. RNA was size fractionated through a 1% agarose-formaldehyde gel, and equal loading of RNA was verified by ethidium bromide staining of 28S and 18S rRNA. The size-fractionated RNA was transferred overnight to a nitrocellulose membrane in 20x SSC buffer and then cross-linked by UV irradiation. The membrane was prehybridized at 42°C for 2 h with 15 ml of prehybridization solution (50% formamide, 3x Denhardt’s solution, 0.5% SDS, heat-denatured salmon sperm DNA (0.5 mg), and yeast transfer RNA (0.2 mg)). Radiolabel (32P) was incorporated into the probe by random primer labeling using the PrimeIt II kit (Stratagene, La Jolla, CA). Following prehybridization, the membrane was hybridized overnight with the denatured, radiolabeled probe at 42°C in 15 ml of hybridization solution (50% formamide, 1.33x Denhardt’s solution, 0.5% SDS, heat-denatured salmon sperm DNA (0.5 mg), and yeast transfer RNA (0.2 mg)). The membrane was washed twice at room temperature for 10 min in 2x SSC/0.1% SDS followed by two 20-min washes at 50°C in 0.1x SSC/0.1% SDS. The membrane was then exposed to x-ray film (Eastman Kodak, Rochester, NY) for 72 h at -80°C. The size of the observed IL-18R band (~3.5 kb) was calculated by measuring the distance of migration relative to that of a fluorescent ethidium bromide-stained marker on the agarose-formaldehyde gel. The band migrated below the 28S rRNA as previously described (34). For a positive control, RNA isolated from PHA-activated human PBL was analyzed in parallel with the NK cell samples.

RT-PCR analysis for AcPL expression

Total cellular RNA was extracted using RNAqueous total RNA isolation kits (Ambion), and cDNAs were generated by RT of 1–2 µg of cellular RNA in the presence of random hexamer primers (Clontech), following the manufacturer’s recommendations. Each cDNA sample (5 µl) was then used as a template for a PCR reaction containing primers for the gene of interest (AcPL or hypoxanthine phosphoribosyltransferase (HPRT); 20 µM), 1x PCR buffer (1.5 mM MgCl2, 10 mM Tris (pH 9.0), 50 mM KCl, and 0.1% Triton X-100), dNTPs (20 mM), and 1 U of AmpliTaq Gold polymerase (PE Applied Biosystems). The PCR amplification was performed in a GeneAmp 9700 thermocycler (PE Applied Biosystems). Reaction mixtures were subjected to the following amplification scheme: one cycle at 95°C for 2 min, and 35 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 45 s. PCR products were then electrophoresed on a 2% agarose gel, stained with ethidium bromide, and visualized by UV fluorescence. Primers for AcPL were: 5' primer, 5'-GATCAGACGCTTGGGGATAA-3'; and 3' primer, 5'-TGTTTGATCATCCAAGGCAA-3'. Primers for HPRT were described previously (35).

Statistical analysis

Statistics were determined using Student’s paired t test, with p < 0.05 considered significant.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
IL-18 plus IL-12 stimulated greater IFN-{gamma} protein production by resting CD56+ NK cells than IL-15 plus IL-12

The monokine combination of IL-18 and IL-12 has recently been shown to costimulate abundant IFN-{gamma} production by human PBMC, activated human T cells, and murine NK1.1+CD3- cells (25, 27, 28). We have previously shown that the monokine combination of IL-15 and IL-12 synergistically induced abundant IFN-{gamma} protein production by resting human NK cells (16). We therefore directly compared the monokine combination of IL-18 and IL-12 to that of IL-15 and IL-12 for the ability to stimulate CD56+ NK cell IFN-{gamma} production. Using a constant dose of rhIL-12 (10 U/ml) and increasing costimulatory doses of rhIL-18 and rhIL-15, IL-18 induced far greater IFN-{gamma} protein production by resting human NK cells (Fig. 1GoA, note log y-axis scale). IL-18, IL-12, and IL-15 alone induced little (<1 ng/ml) or no IFN-{gamma} production in these assays. Comparing one concentration of IL-18 or IL-15 (100 ng/ml), IFN-{gamma} levels were 10- to 20-fold higher in the IL-18- plus IL-12-stimulated cultures than in the IL-15- plus IL-12-stimulated cultures (p < 0.007; Fig. 1GoB). Stimulation of NK cells with all three monokines (IL-12, IL-18, and IL-15) yielded similar amounts of IFN-{gamma} compared with stimulation with IL-18 and IL-12 (data not shown). To further clarify the cellular mechanism underlying the increased IFN-{gamma} production in response to IL-18 and IL-12, enriched CD56+ cells (>=85% pure) were cultured for 24 h in various combinations of IL-15, IL-18, and IL-12 and assayed for IFN-{gamma} production by intracellular flow cytometry (Fig. 2GoA). Consistent with the results of IFN-{gamma} in cell culture supernatants, stimulation with IL-15 or IL-18 alone yielded very few (<2%) CD56+ cells that were low IFN-{gamma} producers (<102 log-FITC fluorescence). Stimulation with IL-12 alone gave a low (5.6%) number of CD56+ cells, the majority of which were low IFN-{gamma} producers. IL-18 and IL-12 induced a greater percentage of high IFN-{gamma} producers (>102 log-FITC fluorescence) compared with IL-15 and IL-12, while the percentages of total (low and high) IFN-{gamma} producers were very similar (32 vs 37%, respectively). These data are consistent with the results above showing that IL-18 and IL-12 induce much greater IFN-{gamma} in cell culture supernatants compared with IL-15 and IL-12 and suggest that this results from a greater production of IFN-{gamma} by IL-18 and IL-12 on a per cell basis.



View larger version (16K):
[in this window]
[in a new window]
 
FIGURE 1. Comparison of IFN-{gamma} protein production by resting human NK cells in response to stimulation with IL-18 or IL-15 in combination with IL-12. A, Dose-response curve of IL-15 and IL-18 alone and in combination with IL-12. Results presented are representative of four independent experiments and show the mean IFN-{gamma} protein level ± SEM of duplicate wells. Note the log scale on the y-axis. B, Percent maximal IFN-{gamma} protein production by resting human NK cells stimulated with various monokines, alone or in combination. Stimulation of resting human NK cells was performed as described in A with 100 ng/ml IL-15 and IL-18. Absolute levels of IFN-{gamma} protein were normalized to the highest levels measured (with IL-18 and IL-12). Results shown are the mean percent maximal IFN-{gamma} protein ± SEM of eight donors. *, p < 0.007, IL-18 and IL-12 vs IL-15 and IL-12. C, Comparison of IL-18 or IL-15 plus IL-12 for the ability to stimulate IFN-{gamma} production by resting human NK cell subsets. Equal numbers of sorted CD56bright and CD56dim cells (1 x 105/ml) were stimulated with 100 ng/ml of IL-18 or IL-15 plus IL-12 and assayed for IFN-{gamma} production by ELISA. Results shown are from four separate experiments, normalized to the highest cytokine condition and subset (CD56bright NK cells stimulated with IL-18 and IL-12). **, p < 0.008, CD56bright vs CD56dim for IL-18 and IL-12; ***, p < 0.02, IL-15 and IL-12.

 


View larger version (38K):
[in this window]
[in a new window]
 
FIGURE 2. Intracellular staining of monokine-activated NK cells for IFN-{gamma} expression. A, Enriched CD56+ NK cells (>=85% pure) were cultured for 24 h with the indicated cytokines and stained for intracellular IFN-{gamma}. The results shown are representative of four separate experiments. B, Sorted CD56bright (upper panels) and CD56dim (lower panels) NK cells (>=99% pure) were cultured for 24 h in IL-18 or IL-15 plus IL-12 and stained for intracellular IFN-{gamma}. The results shown are representative of three separate experiments. The percentage of CD56+ cells expressing detectable IFN-{gamma} and the MFI are indicated in the appropriate quadrant of each dot plot.

 
The CD56bright NK subset produced significantly greater amounts of IFN-{gamma} compared with CD56dim NK cells

Human NK cells may be divided into phenotypic and functional subsets based upon surface expression of CD56 (7). We have previously observed that CD56bright NK cells produce significantly greater amounts of IFN-{gamma} protein following costimulation with IL-15 and IL-12 compared with CD56dim NK cells (36). We therefore purified CD56bright and CD56dim NK cells by cell sorting and compared the IFN-{gamma} induction by IL-18 and IL-12 to that by IL-15 and IL-12. NK cell-derived IFN-{gamma} was significantly greater in CD56bright vs CD56dim when subsets were stimulated with IL-18 and IL-12 (p < 0.008) or IL-15 and IL-12 (p < 0.02). The majority of IFN-{gamma} appeared to originate from the CD56bright NK cell subset, which comprises only 10% of the total CD56+ NK cells and 1% of lymphocytes (Fig. 1GoC). Consistent with results obtained with total CD56+ cells (Fig. 1Go, A and B), both NK cell subsets produced little or no IFN-{gamma} protein in response to IL-15, IL-18, or IL-12 alone, and IL-18 and IL-12 was the most potent costimulus for IFN-{gamma} production in both NK cell subsets. To compare the effects of IL-18 and IL-12 to those of IL-15 and IL-12 on individual CD56bright vs CD56dim NK cells, these NK cell subsets were analyzed for intracellular IFN-{gamma} production by flow cytometry (Fig. 2GoB). Costimulation of CD56bright NK cells (Fig. 2GoB, right upper panel) with IL-18 and IL-12 resulted in a striking IFN-{gamma} protein signal (MFI = 662) and production of IFN-{gamma} by the vast majority of cells (>95%). However, costimulation with IL-15 and IL-12 (Fig. 2GoB, left upper panel) resulted in about 50% of CD56bright NK cells producing lower amounts of IFN-{gamma} (MFI = 38.2). Approximately 50% of CD56dim NK cells stimulated with IL-18 and IL-12 (Fig. 2GoB, right lower panel) produced IFN-{gamma}, with those cells expressing a broad continuum of IFN-{gamma} (MFI = 223). In contrast, very few CD56dim NK cells (~8%) produced low amounts of IFN-{gamma} (MFI = 17.4) in response to IL-15 and IL-12 (Fig. 2GoB, lower left panel). These results are consistent with the IFN-{gamma} protein measured in cell culture supernatants and suggest that one mechanism for differential IFN-{gamma} production in response to IL-18 and IL-12 vs IL-15 and IL-12 involves the recruitment of different subsets of human NK cells.

IL-18 and IL-12 induced a greater increase in IFN-{gamma} transcript levels in resting human NK cells compared with IL-15 and IL-12

We next measured IFN-{gamma} mRNA in these NK cell cultures to determine whether the striking production of IFN-{gamma} protein in response to IL-18 and IL-12, and the difference observed between costimulation with IL-18 vs IL-15, were mediated at the level of gene expression. In these experiments, FACS-purified CD56+ NK cells were stimulated for various amounts of time with IL-15 or IL-18 plus IL-12, and total cellular RNA was isolated and reverse transcribed into cDNA. To quantitate differences in IFN-{gamma} mRNA levels, we used real-time RT-PCR. Both rhIL-18 (100 ng/ml) and rhIL-15 (100 ng/ml) plus rhIL-12 (10 U/ml) stimulated a rapid and sustained increase in IFN-{gamma} mRNA that was detectable at 1 h and peaked at 12 h (Fig. 3Go, A and B, note log axes). After 12 h the amount of IFN-{gamma} transcript plateaued and was sustained for at least 24 h (data not shown). Consistent with IFN-{gamma} protein production, the combination of IL-18 and IL-12 invariably induced significantly higher (1393 ± 643-fold greater than resting) IFN-{gamma} transcript at 12 h compared with IL-15 and IL-12 (45 ± 19-fold greater than resting; p < 0.025; Fig. 3Go, B and C). Identical concentrations of IL-15 or IL-12 alone induced a modest (<3-fold) increase, while IL-18 induced no increase in IFN-{gamma} mRNA levels compared with identical cultures of resting NK cells. Normalizing the absolute fold increase for each experimental condition to the optimal (IL-18 and IL-12) condition showed that the combination of IL-18 and IL-12 was clearly the most potent costimulus tested for up-regulation of IFN-{gamma} mRNA in human NK cells (Fig. 3GoC). Therefore, while the monokine combinations of IL-18 plus IL-12 and IL-15 plus IL-12 induced significant increases in IFN-{gamma} gene expression and protein production by human NK cells, the former was the more potent stimulus.



View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 3. Changes in IFN-{gamma} transcript levels in response to combinations of IL-18, IL-15, and/or IL-12 in resting human NK cells. A, CD56+ NK cells were cultured in either IL-18 or IL-15 plus IL-12 and harvested for RNA isolation at the indicated time points. Results represent the mean ± SEM fold increase over resting of three separate experiments. Note the log scale on the y-axis. B, NK cells were cultured as described in A; stimulated with IL-15, IL-18, IL-12, IL-15 and IL-12, and IL-18, and IL-12; and then harvested for real-time PCR analysis at 12 h. Results shown are representative of three separate experiments, again with a log scale. C, Percent maximal fold increase in IFN-{gamma} gene expression in response to the indicated monokines alone and in combination. The absolute fold increases in IFN-{gamma} gene expression in response to IL-18, IL-15, IL-12 (n = 3), IL-15 plus IL-12, and IL-18 plus IL-12 (n = 7) were normalized to the optimal stimulation condition (IL-18 and IL-12) and expressed as the mean ± SEM percent maximal fold increase in IFN-{gamma} gene expression. *, p < 0.025, IL-18 and IL-12 vs IL-15 and IL-12.

 
IL-15 and IL-12 induced greater IL-10 expression by resting human NK cells compared with IL-18 and IL-12

The induction of IL-10 mRNA and protein by human NK cells was recently demonstrated in response to the cytokine combination of IL-2 and IL-12 (18). We therefore compared the effects of IL-18 or IL-15 plus IL-12 on IL-10 gene expression and protein production by resting CD56+ NK cells. We examined IL-10 protein in monokine-stimulated NK cell culture supernatants 3–6 days after the addition of the indicated cytokines (Fig. 4GoA). Stimulation of CD56+ NK cells (1 x 106/ml) with IL-15, IL-12, or IL-18 alone induced <10 pg/ml IL-10 protein in culture supernatants. IL-15 (100 ng/ml) and IL-12 (10 U/ml) induced significantly greater IL-10 protein production than IL-18 (100 ng/ml) and IL-12 (p < 0.02). Consistent with these results, real-time PCR demonstrated that IL-15 and IL-12 induced significantly higher increases in IL-10 transcript than IL-18 and IL-12 (p < 0.05; Fig. 4GoB). The relative difference between IL-15 or IL-18 plus IL-12 was similar to that observed for IFN-{gamma} (Figs. 1Go and 3Go); however, in this case the combination of IL-15 and IL-12 was the optimal stimulus.



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 4. IL-15 and IL-12 induces greater IL-10 production by resting NK cells compared with IL-18 and IL-12. A, Resting CD56+ NK cells were cultured with the indicated monokines as described in Fig. 1Go, and after 3–6 days cell-free culture supernatants were assayed for IL-10 protein production. Results represent the mean ± SEM of five separate experiments. B, Resting CD56+ NK cells were stimulated with the indicated monokines for 12 h as described in Fig. 3Go. IL-10 transcript levels were quantitated using real-time PCR. Results represent the mean ± SEM percent maximal fold increase in IL-10 transcript levels for three to eight donors. *, p < 0.05, IL-15 and IL-12 vs IL-18 and IL-12.

 
IL-15 and IL-12 stimulated greater MIP-1{alpha} and MIP-1ß production by human NK compared with IL-18 and IL-12

Human NK cells produce abundant amounts of the C-C chemokines MIP-1{alpha} and MIP-1ß protein following costimulation with IL-15 and IL-12 (17, 19). We also examined the ability of IL-18 and IL-12 to stimulate MIP-1{alpha} and MIP-1ß production by human NK cells. IL-18 (100 ng/ml) and IL-12 (100 ng/ml) alone stimulated little or no MIP-1{alpha} protein or increase in transcript levels (Fig. 5Go, A and B). In contrast, there was a synergistic induction of MIP-1{alpha} by the combination of IL-18 and IL-12. However, identical NK cell cultures stimulated with IL-15 and IL-12 produced significantly greater amounts of MIP-1{alpha} protein (p < 0.05) and greater increases in MIP-1{alpha} transcript levels (p < 0.01). Of note, IL-15 is the only single monokine that stimulated MIP-1{alpha} protein and transcript, albeit at lower levels than when combined with IL-12. A similar pattern of induction was observed for another C-C chemokine, MIP-1ß (Fig. 5Go, C and D), with IL-15 and IL-12 inducing significantly greater amounts of MIP-1ß protein (p < 0.05) and increased MIP-1ß transcript levels (p < 0.025) compared with IL-18 and IL-12. Stimulation with all three monokines (IL-12, IL-15, and IL-18) yielded similar levels of MIP-1{alpha} and MIP-1ß as those produced by IL-15 and IL-12 stimulation (data not shown).



View larger version (22K):
[in this window]
[in a new window]
 
FIGURE 5. The combination of IL-15 and IL-12 stimulates greater C-C chemokine production by resting CD56+ NK cells than that of IL-18 and IL-12. A and C, Resting CD56+ NK cells were stimulated with the indicated monokines as described in Fig. 1Go. After 72 h cell-free culture supernatants were assayed for MIP-1{alpha} (A) and MIP-1ß (C) protein levels. Results represent the mean ± SEM of three separate experiments. *, p < 0.05, IL-15 and IL-12 vs IL-18 and IL-12. B and D, Resting CD56+ NK cells (3 x 106/ml) were stimulated with the indicated monokines as described in Fig. 3Go. Results represent the mean ± SEM percent maximal fold increase in MIP-1{alpha} (B) and MIP-1ß (D) transcript levels of three (IL-18, IL-15, and IL-12 alone) or eight (IL-18 plus IL-12 and IL-15 plus IL-12) separate experiments. **, p < 0.001, IL-15 and IL-12 vs IL-18 and IL-12.

 
IL-15 and IL-12 induced greater TNF-{alpha} production by human NK cells compared with IL-18 and IL-12

We have previously shown that human NK cells also produce the proinflammatory cytokine TNF-{alpha} following costimulation with IL-15 and IL-12 (16). We therefore compared the ability of IL-18 or IL-15 plus IL-12 to directly induce TNF-{alpha} transcript and protein by resting NK cells. As shown in Fig. 6GoA, IL-18 and IL-12 alone stimulated no TNF-{alpha}, whereas IL-15 alone induced measurable TNF-{alpha} protein in the NK cell culture supernatants. While both IL-18 and IL-15 synergized with IL-12 to induce TNF-{alpha} protein production by NK cells, the combination of IL-15 and IL-12 was a more potent stimulus (p < 0.05). Stimulation with all three monokines (IL-12, IL-15, and IL-18) induced modestly higher amounts (about twofold) of TNF-{alpha} than stimulation with IL-15 and IL-12 (data not shown). A similar pattern, with IL-15 and IL-12 inducing a greater increase in TNF-{alpha} levels than IL-18 and IL-12 (p < 0.05), was observed at the transcript level using real-time PCR (Fig. 6GoB).



View larger version (13K):
[in this window]
[in a new window]
 
FIGURE 6. The combination of IL-15 and IL-12 stimulates greater TNF-{alpha} production by resting human NK cells than that of IL-18 and IL-12. A, Resting CD56+ NK cells were cultured in the indicated monokines for 72 h, and cell-free culture supernatants were assayed for TNF-{alpha} protein production. Results are the mean ± SEM TNF-{alpha} protein (picograms per milliliter) and are representative of six separate experiments. B, CD56+ NK cells were stimulated as described in Fig. 3Go and were analyzed for TNF-{alpha} mRNA levels by real-time PCR. Absolute fold increases were normalized for the optimal stimulatory condition (IL-15 and IL-12), and results are expressed as the mean ± SEM percent maximal fold increase in TNF-{alpha} mRNA from three separate experiments. *, p < 0.05, IL-15 and IL-12 vs IL-18 and IL-12.

 
Costimulation by IL-15 and IL-18 resulted in the greatest GM-CSF protein production by human NK cells

The production of GM-CSF by human PBMC and T cells in response to IL-18 plus T cell mitogens has been reported (25, 28). We examined the ability of IL-18, alone and in combination with IL-12 or IL-15, to induce GM-CSF production by CD56+ NK cells. Consistent with our previous results (16), IL-15 alone (100 ng/ml) induced GM-CSF protein production (Fig. 7Go), and the addition of IL-12 did not significantly alter the amount of GM-CSF produced. While individually IL-18 and IL-12 induced no GM-CSF production, in combination these monokines synergized to induce significant amounts of GM-CSF protein. Interestingly, the combination of IL-15 and IL-18 was the most potent stimulus for NK cell GM-CSF production, inducing greater amounts than IL-15 alone or IL-18 and IL-12 (p < 0.05). The combination of IL-18 and IL-15 induced similar amounts of IFN-{gamma}, TNF-{alpha}, MIP-1{alpha}, and MIP-1ß as IL-15 alone (data not shown).



View larger version (12K):
[in this window]
[in a new window]
 
FIGURE 7. GM-CSF is optimally costimulated by the monokine combination of IL-15 and IL-18. Resting CD56+ NK cells were stimulated with the indicated monokines for 72 h and then assayed for GM-CSF protein production. Results are presented as the mean ± SEM GM-CSF protein levels (picograms per milliliter) and are representative of three separate experiments. *, p < 0.05, IL-15 and IL-18 vs IL-18 or IL-15 and IL-12.

 
Human NK cells express components of the IL-18R

IL-18 has been shown to use a member of the IL-1R family, IL-1Rrp, for binding and signaling (37). To confirm our functional results suggesting that monokine-activated NK cells express the IL-18R, we examined resting and activated human NK cells for expression of IL-1Rrp transcript. CD56+ NK cells were enriched to >=85% purity by negative selection and were cultured (1 x 106/ml) for 24 h in medium, IL-12 (10 U/ml), or IL-15 (100 ng/ml). The NK cells were then harvested, and total cellular RNA was analyzed by Northern blot for expression of IL-1Rrp message, as described in Materials and Methods. Resting human NK cells expressed low, but detectable, IL-1Rrp, and stimulation with IL-12 or IL-15 resulted in an increase in the amount of signal, consistent with an increase in IL-18R expression (Fig. 8Go). IL-18 has also recently been shown to use another receptor component, AcPL, for signaling (38). We also examined expression of AcPL mRNA by RT-PCR in resting and monokine-activated NK cells. Resting human NK cells expressed AcPL; however, there was no clear up-regulation by semiquantitative RT-PCR, suggesting that this IL-18R subunit may be constitutively expressed by resting NK cells and not regulated by IL-12 or IL-15 (data not shown).



View larger version (54K):
[in this window]
[in a new window]
 
FIGURE 8. Expression of the IL-18R (IL-1Rrp) by resting and cytokine-activated human NK cells. Total cellular RNA from enriched (>=85% pure) CD56+ NK cells cultured overnight in medium, IL-12 (10 U/ml), or IL-15 (100 ng/ml) for 24 h was analyzed by Northern blot using an IL-1Rrp cDNA probe. Lanes 1 and 4, medium; lanes 2 and 5, IL-12; lanes 3 and 6, IL-15. Human NK cell RNA was isolated from one normal donor (lanes 1–3) or pooled from three different donors (lanes 4–6). UV fluorescence of ethidium bromide-stained 18S rRNA is shown below each lane as a measure of RNA loading.

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the current report we demonstrate that the recently cloned proinflammatory monokine, IL-18 (24, 25), is an extremely potent costimulus for resting human NK cell IFN-{gamma} production. IL-18, in the presence of IL-12, induced a striking, dose-dependent increase in the amount of IFN-{gamma} protein measured in CD56+ NK cell culture supernatants. The combination of IL-18 and IL-12 was also shown to induce a very distinct subset of NK cells (i.e., CD56bright) to produce relatively high amounts of IFN-{gamma} compared with the more numerous CD56dim subset. Individually, IL-18 and IL-12 failed to induce IFN-{gamma} protein by human NK cells, consistent with previous findings that optimal NK cell production of IFN-{gamma} requires costimulation by more than one monokine (16). Moreover, as other monokines (e.g., IL-15 and TNF-{alpha}) also potentiate IFN-{gamma} production in combination with IL-12 (12, 16), these data provide additional evidence that an IL-12-derived signal may be critical for monokine stimulation of abundant IFN-{gamma} production by this lymphocyte population. To determine whether the dramatic increase in IFN-{gamma} protein production induced by IL-18 and IL-12 was mediated at the level of transcription, we next measured IFN-{gamma} mRNA expression in monokine-stimulated CD56+ NK cells. IFN-{gamma} transcript levels in IL-18- and IL-12-stimulated NK cells were >1000-fold higher than those in resting NK cells, as quantitated by real-time RT-PCR. This striking activation of IFN-{gamma} gene expression paralleled the synergistic induction of IFN-{gamma} protein, as identical concentrations of IL-18 or IL-12 alone induced a <=3-fold increase in IFN-{gamma} mRNA levels.

We have previously shown that IL-15 synergistically potentiates IL-12-induced NK cell production of IFN-{gamma} (12, 16), and we next directly compared the abilities of IL-15 and IL-18 to costimulate IFN-{gamma} production. While both IL-15 plus IL-12 and IL-18 plus IL-12 induced synergistic production of IFN-{gamma}, the latter combination consistently induced 20- to 30-fold greater amounts of IFN-{gamma} protein and gene expression (p < 0.025). IL-18 and IL-12 also induced a greater percentage of high IFN-{gamma}-producing NK cells compared with IL-15 and IL-12. These data suggest that IL-18 produced by macrophages in response to certain infectious pathogens may be an important monokine for optimal stimulation of NK cell IFN-{gamma}. Indeed, in a murine model of Cryptococcus neoformans infection, culture of peritoneal exudate cells with a combination of IL-12 and IL-18 induced antifungal activity through induction of NK cell IFN-{gamma} and macrophage nitric oxide (39). In addition, administration of anti-IL-18 Abs in vivo rendered mice more susceptible to Yersinia enterocolitica infection (40) and reduced carrageenin-induced local inflammation in vivo (41). Further studies are needed to definitively prove a role for IL-18 in the induction of protective IFN-{gamma} in human infectious disease. Our findings that IL-18 potently costimulated human NK cell IFN-{gamma} production are consistent with those of other studies demonstrating that IL-18 potentiates IFN-{gamma} production in TCR/CD3 cross-linked or mitogen-stimulated purified human T cells, Th1 cell clones, and bulk PBMC (25, 28, 30). Tomura et al. recently documented a similar role for IL-18 in the costimulation of IFN-{gamma} protein production by freshly isolated murine NK1.1+CD3- splenocytes in combination with IL-12 (27). Collectively, the data presented in this report and these previous studies define a potential role for IL-18 produced by pathogen-activated macrophages in the induction of early NK cell-derived IFN-{gamma} as well as late T cell-derived IFN-{gamma}.

Human NK cells may be divided into functional subsets based upon their surface expression of CD56, an isoform of the neural cell adhesion molecule, and CD16 (Fc{gamma}RIII) (7, 42, 43). A minority of NK cells (~10%) express CD56 at high density (CD56brightCD16dim/neg) and have unique characteristics among NK cells, including constitutive expression of a functional high affinity IL-2R{alpha}ß{gamma} (44, 45), the c-kit tyrosine kinase receptor (31), and high levels of L-selectin (CD62 ligand) (46). The majority of human NK cells are CD56dimCD16bright, express the intermediate affinity IL-2Rß{gamma}, and mediate cytotoxicity that is increased upon stimulation with nanomolar concentrations of IL-2, IL-15, or IL-12. The CD56bright NK cell subset is selectively expanded in patients with cancer and/or AIDS when they are administered low doses of exogenous rhIL-2 (35, 47, 48, 49, 50). We have previously shown that the CD56bright NK cell subset produced significantly greater amounts of macrophage-activating factors (IFN-{gamma}, TNF-{alpha}, and GM-CSF) when costimulated with nanomolar amounts of IL-2 or IL-15 in combination with IL-12 compared with CD56dim NK cells (36). We therefore examined IFN-{gamma} production by these two NK cell subsets in response to IL-18 and IL-12. CD56bright NK cells produced 20- to 30-fold greater amounts of IFN-{gamma} protein in cell culture supernatants following stimulation with IL-18 and IL-12 compared with an equal number of CD56dim NK cells. Intracellular flow cytometry revealed that nearly all CD56bright NK cells became high IFN-{gamma} producers following IL-18 and IL-12 costimulation, while only a fraction of CD56dim NK cells became IFN-{gamma} producers (Fig. 2GoB). Voss et al. have recently shown that resting CD56bright, but not CD56dim, NK cells produce IFN-{gamma} in response to ligation of the C-type lectin NK receptor CD94 in combination with IL-2 or IL-15 (51). These data suggest that even though CD56bright NK cells are the numerically minor NK cell subset, they may be the major source of IFN-{gamma} in response to monokines such as IL-15 or IL-18 plus IL-12 as well as from cell surface-derived signals through NK cell receptors. A recent report characterizing IL-18R (IL-1Rrp) expression by flow cytometry on human peripheral blood cells demonstrated that nearly all resting CD56bright NK cells express IL-18R, which was up-regulated by IL-12 (52). This appears to be one mechanism for the differential production of IFN-{gamma} by these NK cell subsets, but others may include differences in the levels of intracellular signaling molecules, cell surface costimulatory molecules, or activation state or an intrinsic functional difference in the potential to produce cytokines. Studies are underway to fully characterize the differences in cytokine and chemokine production between CD56bright and CD56dim NK cell subsets (T. A. Fehniger and M. A. Caligiuri, manuscript in preparation). It is notable that expression of the IL-18R (IL-1Rrp) has recently been suggested as a stable cell surface marker for Th1 cells (41). CD56bright NK cells share many functional (e.g., potent IFN-{gamma} production) and phenotypic (e.g., constitutive IL-18R, IL-12R, and IL-2/15Rß{gamma} expression) properties with Th1 cells. As such, the human CD56bright NK cell subset may be considered closely related to Th1 cells and may have a similar immunoregulatory role in the early innate immune response to infection.

While the combination of IL-18 and IL-12 was clearly the optimal stimulus for IFN-{gamma} production by human NK cells, this was not the case for several other cytokines and chemokines examined. IL-10 production was induced by IL-15 and IL-12, while little IL-10 was induced by IL-18 and IL-12. Such differential induction by monokines may be important for the interaction between NK cells and macrophages via innate paracrine cytokine loops. The present study also described a role for IL-18 in combination with IL-12 in the induction of TNF-{alpha} as well as the C-C chemokines MIP-1{alpha} and MIP-1ß by resting human NK cells. Similar to the observations with IFN-{gamma} and IL-10, IL-18 alone failed to induce TNF-{alpha}, MIP-1{alpha}, or MIP-1ß protein and transcript by CD56+ NK cells. Synergistic production of these factors was induced at both the protein and transcript levels when IL-18 was combined with IL-12. In contrast to the results for IFN-{gamma}, when the combination of IL-18 and IL-12 was directly compared with that of IL-15 and IL-12 for the ability to induce these factors, IL-15 and IL-12 was the optimal monokine combination. Of note, IL-15 alone stimulated significantly greater amounts of MIP-1{alpha} and MIP-1ß protein than medium controls, IL-18 alone, or IL-12 alone. Our preliminary studies (36) indicate that IL-15 and IL-12 selectively induce TNF-{alpha} and GM-CSF in the CD56bright NK cell subset, and experiments are ongoing to fully compare the cytokine and chemokine profiles produced by these NK cell subsets in response to various stimuli (T. A. Fehniger and M. A. Caligiuri, manuscript in preparation). A recent report showed that IL-18 (10 nM, ~18 ng/ml) alone directly induced IL-8 production by purified human NK cells (29). In this study Puren et al. also suggest that this IL-8 production was partially dependent on endogenous TNF-{alpha}, as the addition of a soluble recombinant TNF binding protein decreased the IL-8 measured. However, endogenous TNF-{alpha} production was not measured at the protein or transcript level. In our experiments, we observed no increase in TNF-{alpha} gene expression and no TNF-{alpha} protein production induced by IL-18 alone at concentrations up to 100 ng/ml. While IL-18 and IL-12 again synergized in the induction of GM-CSF production by NK cells, the levels were approximately equivalent to those induced by IL-15 with or without IL-12. Unexpectedly, the optimal costimulatory monokine combination for GM-CSF production by human NK cells was IL-15 and IL-18.

The results of this study and others discussed above suggest that the particular monokines (e.g., IL-18, IL-15, and IL-12) that are induced by an infectious pathogen may determine in part the pattern of cytokines and chemokines produced by human NK cells during the early response to infection. Responsiveness to these monokines depends upon the NK cell subsets present and the surface expression of their respective receptors. This report provided data demonstrating that mRNA for one component of the IL-18R, IL-1Rrp, is expressed on resting human NK cells and is up-regulated by IL-12 or IL-15. This is consistent with recent work showing that resting human NK cells express IL-1Rrp by flow cytometry, and this expression is increased by IL-12 (52). Such receptor modulation may also be an important regulatory mechanism determining when and which NK cell subsets are responsive to certain monokines. Another component of the IL-18R complex required for signaling in response to IL-18, AcPL, was recently identified (38) and appears to be constitutively expressed at the transcript level by resting human NK cells (data not shown). It is likely that additional components of the functional IL-18R important for high affinity binding have yet to be identified (23) and may also contribute to selective IL-18 responsiveness via cell type-specific or cytokine-regulated expression.

Interaction of different monokine-induced transcription factors at the promoters of monokine-responsive NK cell genes represent one final point of integration determining their expression. Barbulescu et al. have recently reported that anti-CD3/CD28 Abs, IL-12, and IL-18 have distinct effects on the IFN-{gamma} promoter in primary human CD4+ T cells (30). IL-18 induced binding of a transcription factor to an AP-1 site located in the -265 to -186 region of the IFN-{gamma} promoter, which conferred high promoter activity. In contrast, IL-12 induced binding of a transcription factor to a STAT binding site, but this conferred low promoter activity. When these T cells were stimulated with anti-CD3/CD28 Abs and IL-12, there was concurrent binding to both the AP-1 site and the STAT binding site resulting in high promoter activity. However, the authors did not test the effects of IL-12, anti-CD3/CD28, and IL-18, precluding analysis of the synergistic increase in IFN-{gamma} production at the promoter level in CD4+ T cells. As the cis-acting elements that control IFN-{gamma} gene expression are complex (53, 54, 55, 56, 57), IL-15 may potentiate IL-12-induced IFN-{gamma} through induction of AP-1 or by inducing other IFN-{gamma} promoter binding proteins, such as STAT5, in human NK cells (58, 59). Studies examining the molecular mechanisms of intracellular signaling involved in activating different NK cell cytokine and chemokine patterns, with comparison to T cells, may yield additional NK cell-specific targets to up- or down-regulate certain NK cell effector functions. Further studies examining how NK cells integrate various signals from monokines, cell surface costimulatory molecules, and NK-activating receptors will help clarify how this innate immune cytokine response is orchestrated to efficiently contain the pathogen and direct the development of a protective Ag-specific immune response. Understanding the complex cytokine networks integrated by human NK cells to induce immunoregulatory cytokine and chemokine production may provide novel therapeutic strategies for augmenting, diminishing, or redirecting the early innate immune response to infectious insult.


    Acknowledgments
 
We thank Andy Oberyszyn for cell sorting, Dr. Clay Marsh for insightful discussions, and Dr. William Carson for helpful review of the manuscript.


    Footnotes
 
1 This work was supported by Grants P30CA16058, CA09581, CA68456, and CA65670 from the National Institutes of Health, the Bennett Fellowship from Ohio State University College of Medicine (to T.A.F.), and the Veterans of Foreign Wars Cancer Research Fellowship (to S.P.W.). Back

2 Address correspondence and reprint requests to Dr. Michael A. Caligiuri, Ohio State University, 458A Starling-Loving Hall, 320 West 10th Ave., Columbus, OH 43210. E-mail address: Back

3 Abbreviations used in this paper: monokine, monocyte-derived cytokine; GM-CSF, granulocyte-macrophage CSF; MIP, macrophage inflammatory protein; IL-1Rrp, IL-1 receptor-related protein; rh, recombinant human; PE, phycoerythrin; HAB, human AB serum; MFI, mean fluorescence intensity; rRNA, ribosomal ribonucleic acid; CT, parameter threshold cycle; AP-1, activator protein-1; AcPL, accessory protein-like. Back

Received for publication November 18, 1998. Accepted for publication January 28, 1999.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Bancroft, G. J.. 1993. The role of natural killer cells in innate resistance to infection. Curr. Opin. Immunol. 5:503.[Medline]
  2. Biron, C. A., R. T. Gazzinelli. 1995. Effects of IL-12 on immune responses to microbial infections: a key mediator in regulating disease outcome. Curr. Opin. Immunol. 7:485.[Medline]
  3. Trinchieri, G.. 1995. Interleukin-12: a proinflammatory cytokine with immunoregulatory functions that bridge innate resistance and antigen-specific adaptive immunity. Annu. Rev. Immunol. 13:251.[Medline]
  4. Biron, C. A.. 1997. Activation and function of natural killer cell responses during viral infections. Curr. Opin. Immunol. 9:24.[Medline]
  5. Trinchieri, G.. 1997. Cytokines acting on or secreted by macrophages during intracellular infection (IL-15, IL-12, IFN-{gamma}). Curr. Opin. Immunol. 9:17.[Medline]
  6. Trinchieri, G.. 1989. Biology of natural killer cells. Adv. Immunol. 47:187.[Medline]
  7. Robertson, M. J., J. Ritz. 1990. Biology and clinical relevance of human natural killer cells. Blood 76:2421.[Free Full Text]
  8. Gazzinelli, R. T., S. Hieny, T. A. Wynn, S. Wolf, A. Sher. 1993. Interleukin 12 is required for the T-lymphocyte-independent induction of interferon {gamma} by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115.[Abstract/Free Full Text]
  9. Unanue, E. R.. 1997. Inter-relationship among macrophages, natural killer cells and neutrophils in early stages of Listeria resistance. Curr. Opin. Immunol. 9:35.[Medline]
  10. Louis, J., H. Himmelrich, C. Parra-Lopez, F. Tacchini-Cottier, P. Launois. 1998. Regulation of protective immunity against Leishmania major in mice. Curr. Opin. Immunol. 10:459.[Medline]
  11. Scharton-Kersten, T. M., A. Sher. 1997. Role of natural killer cells in innate resistance to protozoan infections. Curr. Opin. Immunol. 9:44.[Medline]
  12. Carson, W. E., M. E. Ross, R. A. Baiocchi, M. J. Marien, N. Boiani, K. Grabstein, M. A. Caligiuri. 1995. Endogenous production of interleukin 15 by activated human monocytes is critical for optimal production of interferon-{gamma} by natural killer cells in vitro. J. Clin. Invest. 96:2578.
  13. Scott, P., G. Trinchieri. 1995. The role of natural killer cells in host-parasite interactions. Curr. Opin. Immunol. 7:34.[Medline]
  14. Medzhitov, R., C. A. Janeway. 1997. Innate immunity: impact on the adaptive immune response. Curr. Opin. Immunol. 9:4.[Medline]
  15. Chan, S. H., B. Perussia, J. W. Gupta, M. Kobayashi, M. Pospisil, H. A. Young, S. F. Wolf, D. Young, S. C. Clark, G. Trinchieri. 1991. Induction of interferon {gamma} production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869.[Abstract/Free Full Text]
  16. Carson, W. E., J. G. Giri, M. J. Lindemann, M. L. Linett, M. Ahdieh, R. Paxton, D. Anderson, J. Eisenmann, K. Grabstein, M. A. Caligiuri. 1994. Interleukin (IL) 15 is a novel cytokine that activates human natural killer cells via components of the IL-2 receptor. J. Exp. Med. 180:1395.[Abstract/Free Full Text]
  17. Bluman, E. M., K. J. Bartynski, B. R. Avalos, M. A. Caligiuri. 1996. Human natural killer cells produce abundant macrophage inflammatory protein-1{alpha} in response to monocyte-derived cytokines. J. Clin. Invest. 97:2722.[Medline]
  18. Mehrotra, P. T., R. P. Donnelly, S. Wong, H. Kanegane, A. Geremew, H. S. Mostowski, K. Furuke, J. P. Siegel, E. T. Bloom. 1998. Production of IL-10 by human natural killer cells stimulated with IL-2 and/or IL-12. J. Immunol. 160:2637.[Abstract/Free Full Text]
  19. Fehniger, T. A., G. Herbein, H. Yu, M. I. Para, Z. P. Bernstein, W. A. O’Brien, M. A. Caligiuri. 1998. Natural killer cells from HIV-1+ patients produce C-C chemokines and inhibit HIV-1 infection. J. Immunol. 161:6433.[Abstract/Free Full Text]
  20. Doherty, T. M., R. A. Seder, A. Sher. 1996. Induction and regulation of IL-15 expression in murine macrophages. J. Immunol. 156:735.[Abstract]
  21. Carson, W. E., M. A. Caligiuri. 1996. Interleukin 15: a potential player during the innate immune response to infection. Exp. Parasitol. 84:291.[Medline]
  22. Okamura, H., S. Kashiwamura, H. Tsutsui, T. Yoshimoto, K. Nakanishi. 1998. Regulation of interferon-{gamma} production by IL-12 and IL-18. Curr. Opin. Immunol. 10:159.
  23. Dinarello, C. A., D. Novick, A. J. Puren, G. Fantuzzi, L. Shapiro, H. Muhl, D. Y. Yoon, L. L. Reznikov, S. H. Kim, M. Rubinstein. 1998. Overview of interleukin-18: more than an interferon-{gamma} inducing factor. J. Leukoc. Biol. 63:658.[Abstract]
  24. Okamura, H., H. Tsutsi, T. Komatsu, M. Yutsudo, A. Hakura, T. Tanimoto, K. Torigoe, T. Okura, Y. Nukada, K. Hattori, et al 1995. Cloning of a new cytokine that induces IFN-{gamma} production by T cells. Nature 378:88.[Medline]
  25. Ushio, S., M. Namba, T. Okura, K. Hattori, Y. Nukada, K. Akita, F. Tanabe, K. Konishi, M. Micallef, M. Fujii, et al 1996. Cloning of the cDNA for human IFN-{gamma}-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
  26. Tsutsui, H., K. Nakanishi, K. Matsui, K. Higashino, H. Okamura, Y. Miyazawa, K. Kaneda. 1996. IFN-{gamma}-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
  27. Tomura, M., X. Y. Zhou, S. Maruo, H. J. Ahn, T. Hamaoka, H. Okamura, K. Nakanishi, T. Tanimoto, M. Kurimoto, H. Fujiwara. 1998. A critical role for IL-18 in the proliferation and activation of NK1.1+ CD3- cells. J. Immunol. 160:4738.[Abstract/Free Full Text]
  28. Micallef, M. J., T. Ohtsuki, K. Kohno, F. Tanabe, S. Ushio, M. Namba, T. Tanimoto, K. Torigoe, M. Fujii, M. Ikeda, et al 1996. Interferon-{gamma}-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon-{gamma} production. Eur. J. Immunol. 26:1647.[Medline]
  29. Puren, A. J., G. Fantuzzi, Y. Gu, M. S. Su, C. A. Dinarello. 1998. Interleukin-18 (IFN{gamma}-inducing factor) induces IL-8 and IL-1ß via TNF{alpha} production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
  30. Barbulescu, K., C. Becker, J. F. Schlaak, E. Schmitt, K. H. Meyer zum Buschenfelde, M. F. Neurath. 1998. IL-12 and IL-18 differentially regulate the transcriptional activity of the human IFN-{gamma} promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642.[Abstract/Free Full Text]
  31. Matos, M. E., G. S. Schnier, M. S. Beecher, L. K. Ashman, D. E. William, M. A. Caligiuri. 1993. Expression of a functional c-kit receptor on a subset of natural killer cells. J. Exp. Med. 178:1079.[Abstract/Free Full Text]
  32. Gibson, U. E., C. A. Heid, P. M. Williams. 1996. A novel method for real time quantitative RT-PCR. Genome Res. 6:995.[Abstract/Free Full Text]
  33. Heid, C. A., J. Stevens, K. J. Livak, P. M. Williams. 1996. Real time quantitative PCR. Genome Res. 6:986.[Abstract/Free Full Text]
  34. Parnet, P., K. E. Garka, T. P. Bonnert, S. K. Dowers, J. E. Sims. 1996. IL-1Rrp is a novel receptor-like molecule similar to the type I interleukin-1 receptor and its homologues T1/ST2 and IL-1R AcP. J. Biol. Chem. 271:3967.[Abstract/Free Full Text]
  35. Khatri, V. P., T. A. Fehniger, R. A. Baiocchi, Y. Feng, M. H. Shah, D. S. Schiller, M. Gould, R. T. Gazzinelli, Z. P. Bernstein, M. A. Caligiuri. 1998. Ultra low dose interleukin-2 therapy promotes a type 1 cytokine profile in vivo in patients with AIDS and AIDS-associated malignancies. J. Clin. Invest. 101:1373.[Medline]
  36. Fehniger, T. A., W. E. Carson, M. A. Caligiuri. 1997. The CD56bright human NK cell subset is the most potent NK producer of macrophage activating factors. Proc. Am. Assoc. Cancer Res. 38:34a. (Abstr.).
  37. O’Neill, L. A., C. Greene. 1998. Signal transduction pathways activated by the IL-1 receptor family: ancient signaling machinery in mammals, insects, and plants. J. Leukocyte Biol. 63:650.[Abstract]
  38. Born, T. L., E. Thomassen, T. A. Bird, J. E. Sims. 1998. Cloning of a novel receptor subunit, AcPL, required for interleukin-18 signaling. J. Biol. Chem. 273:29445.[Abstract/Free Full Text]
  39. Zhang, T., K. Kawakami, M. H. Qureshi, H. Okamura, M. Kurimoto, A. Saito. 1997. Interleukin-12 (IL-12) and IL-18 synergistically induce the fungicidal activity of murine peritoneal exudate cells against Cryptococcus neoformans through production of {gamma} interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
  40. Bohn, E., A. Sing, R. Zumbihl, C. Bielfeldt, H. Okamura, M. Kurimoto, J. Heesemann, I. B. Autenrieth. 1998. IL-18 (IFN-{gamma}-inducing factor) regulates early cytokine production in, and promotes resolution of, bacterial infection in mice. J. Immunol. 160:299.[Abstract/Free Full Text]
  41. Xu, D., W. L. Chan, B. P. Leung, D. Hunter, K. Schulz, R. W. Carter, I. B. McInnes, J. H. Robinson, F. Y. Liew. 1998. Selective expression and functions of the interleukin 18 receptor on T helper (Th) type 1 but not Th2 cells. J. Exp. Med. 188:1485.[Abstract/Free Full Text]
  42. Ellis, T. M., R. I. Fisher. 1989. Functional heterogeneity of Leu 19"bright"+ and Leu 19"dim"+ lymphokine-activated killer cells. J. Immunol. 142:2949.[Abstract]
  43. Nagler, A., L. L. Lanier, S. Cwirla, J. H. Phillips. 1989. Comparative studies of human Fc{gamma}RIII-positive and negative natural killer cells. J. Immunol. 143:3183.[Abstract]
  44. Caligiuri, M. A., A. Zmuidzinas, T. J. Manley, H. Levine, K. A. Smith, J. Ritz. 1990. Functional consequences of interleukin 2 receptor expression on resting human lymphocytes: identification of a novel natural killer cell subset with high affinity receptors. J. Exp. Med. 171:1509.[Abstract/Free Full Text]
  45. Nagler, A., L. L. Lanier, J. H. Phillips. 1990. Constitutive expression of high affinity interleukin 2 receptors on human CD16- natural killer cells in vivo. J. Exp. Med. 171:1527.[Abstract/Free Full Text]
  46. Frey, M., N. B. Packianathan, T. A. Fehniger, M. E. Ross, W. Wang, C. C. Stewart, M. A. Caligiuri, S. E. Evans. 1998. Differential expression and function of L-selectin on CD56bright and CD56dim natural killer cell subsets. J. Immunol. 161:400.[Abstract/Free Full Text]
  47. Caligiuri, M. A., C. Murray, M. J. Robertson, E. Wang, K. Cochran, C. Cameron, P. Schow, M. E. Ross, T. R. Klumpp, R. J. Soiffer, et al 1993. Selective modulation of human natural killer cells in vivo after prolonged infusion of low dose recombinant interleukin 2. J. Clin. Invest. 91:123.
  48. Bernstein, Z. P., M. M. Porter, M. Gould, B. Lipman, E. M. Bluman, C. C. Stewart, R. G. Hewitt, G. Fyfe, B. Poiesz, M. A. Caligiuri. 1995. Prolonged administration of low-dose interleukin-2 in human immunodeficiency virus-associated malignancy results in selective expansion of innate immune effectors without significant clinical toxicity. Blood 86:3287.[Abstract/Free Full Text]
  49. Meropol, N. J., M. Porter, L. E. Blumenson, M. J. Lindemann, R. P. Perez, L. Vaickus, G. M. Loewen, P. J. Creaven, K. A. Wilkes, M. A. Giedlin, M. A. Caligiuri. 1996. Daily subcutaneous injection of low-dose interleukin 2 expands natural killer cells in vivo without significant toxicity. Clin. Cancer Res. 2:669.[Abstract]
  50. Bernstein, Z. P., G. Barresi, M. Gould, B. Poiesz, M. A. Caligiuri. 1997. A phase II study of daily subcutaneous (sq) low dose interleukin-2 (IL-2) in HIV-associated malignancies. J. Acquired Immune Defic. Syndr. Hum. Retrovirol. 14:40A.
  51. Voss, S. D., J. Daley, J. Ritz, M. J. Robertson. 1998. Participation of the CD94 receptor complex in costimulation of human natural killer cells. J. Immunol. 160:1618.[Abstract/Free Full Text]
  52. Kunikata, T., K. Torigoe, S. Ushio, T. Okura, C. Ushio, H. Yamauchi, M. Ikeda, H. Ikegami, M. Kurimoto. 1998. Constitutive and induced IL-18 receptor expression by various peripheral blood cell subsets as determined by anti-hIL-18R monoclonal antibody. Cell. Immunol. 189:135.[Medline]
  53. Young, H. A.. 1996. Regulation of interferon-{gamma} gene expression. J. Interferon Res. 16:563.
  54. Xu, X., Y. L. Sun, T. Hoey. 1996. Cooperative DNA binding and sequence-selective recognition conferred by the STAT amino-terminal domain. Science 273:794.[Abstract]
  55. Ye, J., M. Cippitelli, L. Dorman, J. R. Ortaldo, H. A. Young. 1996. The nuclear factor YY1 suppresses the human {gamma} interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16:4744.[Abstract]
  56. Aune, T. M., L. A. Penix, M. R. Rincon, R. A. Flavell. 1997. Differential transcription directed by discrete {gamma} interferon promoter elements in naive and memory (effector) CD4 T cells and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
  57. Sica, A., L. Dorman, V. Viggiano, M. Cippitelli, P. Ghosh, N. Rice, H. A. Young. 1997. Interaction of NK-{kappa}B and NFAT with the interferon-{gamma} promoter. J. Biol. Chem. 272:30412.[Abstract/Free Full Text]
  58. Miyazaki, T., Z. J. Liu, A. Kawahara, Y. Minami, K. Yamada, Y. Tsujimoto, E. L. Barsoumian, R. M. Permutter, T. Taniguchi. 1995. Three distinct IL-2 signaling pathways mediated by bcl-2, c-myc, and lck cooperate in hematopoietic cell proliferation. Cell 81:223.[Medline]
  59. Tagaya, Y., R. N. Bamford, A. P. DeFilippis, T. A. Waldmann. 1996. IL-15: a pleiotropic cytokine with diverse receptor/signaling pathways whose expression is controlled at multiple levels. Immunity 4:329.[Medline]



This article has been cited by other articles:


Home page
Molecular Cancer TherapeuticsHome page
A phase I trial of paclitaxel and trastuzumab in combination with interleukin-12 in patients with HER2/neu-expressing malignancies
Mol. Cancer Ther., November 1, 2009; 8(11): 2983 - 2991.



Home page
J. Immunol.Home page
E. A. Haddad, L. K. Senger, and F. Takei
An Accessory Role for B Cells in the IL-12-Induced Activation of Resting Mouse NK Cells
J. Immunol., September 15, 2009; 183(6): 3608 - 3615.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. A. Olson, R. Zeiser, A. Beilhack, J. J. Goldman, and R. S. Negrin
Tissue-Specific Homing and Expansion of Donor NK Cells in Allogeneic Bone Marrow Transplantation
J. Immunol., September 1, 2009; 183(5): 3219 - 3228.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. P. Longhi, C. Trumpfheller, J. Idoyaga, M. Caskey, I. Matos, C. Kluger, A. M. Salazar, M. Colonna, and R. M. Steinman
Dendritic cells require a systemic type I interferon response to mature and induce CD4+ Th1 immunity with poly IC as adjuvant
J. Exp. Med., July 6, 2009; 206(7): 1589 - 1602.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. C. Rodriguez-Galan, D. Reynolds, S. G. Correa, P. Iribarren, M. Watanabe, and H. A. Young
Coexpression of IL-18 Strongly Attenuates IL-12-Induced Systemic Toxicity through a Rapid Induction of IL-10 without Affecting its Antitumor Capacity
J. Immunol., July 1, 2009; 183(1): 740 - 748.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
N. C. Robson, H. Wei, T. McAlpine, N. Kirkpatrick, J. Cebon, and E. Maraskovsky
Activin-A attenuates several human natural killer cell functions
Blood, April 2, 2009; 113(14): 3218 - 3225.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
Y.-C. Huang, S.-W. Hung, T.-R. Jan, K.-W. Liao, C.-H. Cheng, Y.-S. Wang, and R.-M. Chu
CD5-low expression lymphocytes in canine peripheral blood show characteristics of natural killer cells
J. Leukoc. Biol., December 1, 2008; 84(6): 1501 - 1510.
[Abstract] [Full Text] [PDF]


Home page
J. Am. Soc. Nephrol.Home page
H. Wu, M. L. Craft, P. Wang, K. R. Wyburn, G. Chen, J. Ma, B. Hambly, and S. J. Chadban
IL-18 Contributes to Renal Damage after Ischemia-Reperfusion
J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2331 - 2341.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
H. Guo, A. Samarakoon, B. Vanhaesebroeck, and S. Malarkannan
The p110{delta} of PI3K plays a critical role in NK cell terminal maturation and cytokine/chemokine generation
J. Exp. Med., September 29, 2008; 205(10): 2419 - 2435.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Trotta, J. D. Col, J. Yu, D. Ciarlariello, B. Thomas, X. Zhang, J. Allard II, M. Wei, H. Mao, J. C. Byrd, et al.
TGF-{beta} Utilizes SMAD3 to Inhibit CD16-Mediated IFN-{gamma} Production and Antibody-Dependent Cellular Cytotoxicity in Human NK Cells
J. Immunol., September 15, 2008; 181(6): 3784 - 3792.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Dulphy, P. Haas, M. Busson, S. Belhadj, R. Peffault de Latour, M. Robin, M. Carmagnat, P. Loiseau, R. Tamouza, C. Scieux, et al.
An Unusual CD56brightCD16low NK Cell Subset Dominates the Early Posttransplant Period following HLA-Matched Hematopoietic Stem Cell Transplantation
J. Immunol., August 1, 2008; 181(3): 2227 - 2237.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
M. D. Smithgall, M. R. Comeau, B.-R. Park Yoon, D. Kaufman, R. Armitage, and D. E. Smith
IL-33 amplifies both Th1- and Th2-type responses through its activity on human basophils, allergen-reactive Th2 cells, iNKT and NK Cells
Int. Immunol., August 1, 2008; 20(8): 1019 - 1030.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. Caligiuri
Human natural killer cells
Blood, August 1, 2008; 112(3): 461 - 469.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. Guia, C. Cognet, L. de Beaucoudrey, M. S. Tessmer, E. Jouanguy, C. Berger, O. Filipe-Santos, J. Feinberg, Y. Camcioglu, J. Levy, et al.
A role for interleukin-12/23 in the maturation of human natural killer and CD56+ T cells in vivo
Blood, May 15, 2008; 111(10): 5008 - 5016.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
V. Athie-Morales, G. M. O'Connor, and C. M. Gardiner
Activation of Human NK Cells by the Bacterial Pathogen-Associated Molecular Pattern Muramyl Dipeptide
J. Immunol., March 15, 2008; 180(6): 4082 - 4089.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. M. Johnson and R. I. Tapping
Microbial Products Stimulate Human Toll-like Receptor 2 Expression through Histone Modification Surrounding a Proximal NF-{kappa}B-binding Site
J. Biol. Chem., October 26, 2007; 282(43): 31197 - 31205.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
R. Trotta, D. Ciarlariello, J. D. Col, J. Allard II, P. Neviani, R. Santhanam, H. Mao, B. Becknell, J. Yu, A. K. Ferketich, et al.
The PP2A inhibitor SET regulates natural killer cell IFN-{gamma} production
J. Exp. Med., October 1, 2007; 204(10): 2397 - 2405.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
H. Wang, B. Grzywacz, D. Sukovich, V. McCullar, Q. Cao, A. B. Lee, B. R. Blazar, D. N. Cornfield, J. S. Miller, and M. R. Verneris
The unexpected effect of cyclosporin A on CD56+CD16 and CD56+CD16+ natural killer cell subpopulations
Blood, September 1, 2007; 110(5): 1530 - 1539.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. Cerboni, A. Zingoni, M. Cippitelli, M. Piccoli, L. Frati, and A. Santoni
Antigen-activated human T lymphocytes express cell-surface NKG2D ligands via an ATM/ATR-dependent mechanism and become susceptible to autologous NK- cell lysis
Blood, July 15, 2007; 110(2): 606 - 615.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Becknell, T. L. Hughes, A. G. Freud, B. W. Blaser, J. Yu, R. Trotta, H. C. Mao, M. L. Caligiuri de Jesus, M. Alghothani, D. M. Benson Jr, et al.
Hlx homeobox transcription factor negatively regulates interferon-{gamma} production in monokine-activated natural killer cells
Blood, March 15, 2007; 109(6): 2481 - 2487.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Rafei, J. H. Wu, B. Annabi, L. Lejeune, M. Francois, and J. Galipeau
A GMCSF and IL-15 fusokine leads to paradoxical immunosuppression in vivo via asymmetrical JAK/STAT signaling through the IL-15 receptor complex
Blood, March 1, 2007; 109(5): 2234 - 2242.
[Abstract] [Full Text] [PDF]


Home page
J. Gen. Virol.Home page
A. R. Rodriguez, B. P. Arulanandam, V. L. Hodara, H. M. McClure, E. K. Cobb, M. T. Salas, R. White, and K. K. Murthy
Influence of interleukin-15 on CD8+ natural killer cells in human immunodeficiency virus type 1-infected chimpanzees
J. Gen. Virol., February 1, 2007; 88(2): 641 - 651.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
B. Grzywacz, N. Kataria, M. Sikora, R. A. Oostendorp, E. A. Dzierzak, B. R. Blazar, J. S. Miller, and M. R. Verneris
Coordinated acquisition of inhibitory and activating receptors and functional properties by developing human natural killer cells
Blood, December 1, 2006; 108(12): 3824 - 3833.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Yang, D. Rangasamy, K. I. Matthaei, A. J. Frew, N. Zimmmermann, S. Mahalingam, D. C. Webb, D. J. Tremethick, P. J. Thompson, S. P. Hogan, et al.
Inhibition of Arginase I Activity by RNA Interference Attenuates IL-13-Induced Airways Hyperresponsiveness
J. Immunol., October 15, 2006; 177(8): 5595 - 5603.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
T. Aranami, S. Miyake, and T. Yamamura
Differential Expression of CD11c by Peripheral Blood NK Cells Reflects Temporal Activity of Multiple Sclerosis
J. Immunol., October 15, 2006; 177(8): 5659 - 5667.
[Abstract] [Full Text] [PDF]


Home page
Hum ReprodHome page
S. Vujisic, S. Z. Lepej, I. Emedi, R. Bauman, A. Remenar, and M. K. Tiljak
Ovarian follicular concentration of IL-12, IL-15, IL-18 and p40 subunit of IL-12 and IL-23
Hum. Reprod., October 1, 2006; 21(10): 2650 - 2655.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. A. Nelson, S. R. Walker, W. Li, X. S. Liu, and D. A. Frank
Identification of Human STAT5-dependent Gene Regulatory Elements Based on Interspecies Homology
J. Biol. Chem., September 8, 2006; 281(36): 26216 - 26224.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
T. K. Tso, W.-N. Huang, H.-Y. Huang, and C.-K. Chang
Relationship of plasma interleukin-18 concentrations to traditional and non-traditional cardiovascular risk factors in patients with systemic lupus erythematosus
Rheumatology, September 1, 2006; 45(9): 1148 - 1153.
[Abstract] [Full Text] [PDF]


Home page
JCOHome page
J. P. Monk, G. Phillips, R. Waite, J. Kuhn, L. J. Schaaf, G. A. Otterson, D. Guttridge, C. Rhoades, M. Shah, T. Criswell, et al.
Assessment of Tumor Necrosis Factor Alpha Blockade As an Intervention to Improve Tolerability of Dose-Intensive Chemotherapy in Cancer Patients
J. Clin. Oncol., April 20, 2006; 24(12): 1852 - 1859.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
T K Tso, W-N Huang, H-Y Huang, and C-K Chang
Elevation of plasma interleukin-18 concentration is associated with insulin levels in patients with systemic lupus erythematosus
Lupus, April 1, 2006; 15(4): 207 - 212.
[Abstract] [PDF]


Home page
Ann Rheum DisHome page
L C W Lit, C K Wong, L S Tam, E K M Li, and C W K Lam
Raised plasma concentration and ex vivo production of inflammatory chemokines in patients with systemic lupus erythematosus
Ann Rheum Dis, February 1, 2006; 65(2): 209 - 215.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. M. Roda, R. Parihar, C. Magro, G. J. Nuovo, S. Tridandapani, and W. E. Carson III
Natural Killer Cells Produce T Cell-Recruiting Chemokines in Response to Antibody-Coated Tumor Cells
Cancer Res., January 1, 2006; 66(1): 517 - 526.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
S. A. Perez, L. G. Mahaira, P. A. Sotiropoulou, A. D. Gritzapis, E. G. Iliopoulou, D. K. Niarchos, N. T. Cacoullos, Y. G. Kavalakis, A. I. Antsaklis, N. N. Sotiriadou, et al.
Effect of IL-21 on NK cells derived from different umbilical cord blood populations
Int. Immunol., January 1, 2006; 18(1): 49 - 58.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Ing, M. Segura, N. Thawani, M. Tam, and M. M. Stevenson
Interaction of Mouse Dendritic Cells and Malaria-Infected Erythrocytes: Uptake, Maturation, and Antigen Presentation
J. Immunol., January 1, 2006; 176(1): 441 - 450.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. Schierloh, N. Yokobori, M. Aleman, R. M. Musella, M. Beigier-Bompadre, M. A. Saab, L. Alves, E. Abbate, S. S. de la Barrera, and M. C. Sasiain
Increased Susceptibility to Apoptosis of CD56dimCD16+ NK Cells Induces the Enrichment of IFN-{gamma}-Producing CD56bright Cells in Tuberculous Pleurisy
J. Immunol., November 15, 2005; 175(10): 6852 - 6860.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
R. Ing, P. Gros, and M. M. Stevenson
Interleukin-15 Enhances Innate and Adaptive Immune Responses to Blood-Stage Malaria Infection in Mice
Infect. Immun., May 1, 2005; 73(5): 3172 - 3177.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. Trotta, R. Parihar, J. Yu, B. Becknell, J. Allard II, J. Wen, W. Ding, H. Mao, S. Tridandapani, W. E. Carson, et al.
Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation
Blood, April 15, 2005; 105(8): 3011 - 3018.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. M. Grund, D. D. Spyropoulos, D. K. Watson, and R. C. Muise-Helmericks
Interleukins 2 and 15 Regulate Ets1 Expression via ERK1/2 and MNK1 in Human Natural Killer Cells
J. Biol. Chem., February 11, 2005; 280(6): 4772 - 4778.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
M. Croce, R. Meazza, A. M. Orengo, L. Radic', B. De Giovanni, C. Gambini, B. Carlini, V. Pistoia, L. Mortara, R. S. Accolla, et al.
Sequential Immunogene Therapy with Interleukin-12- and Interleukin-15-Engineered Neuroblastoma Cells Cures Metastatic Disease in Syngeneic Mice
Clin. Cancer Res., January 15, 2005; 11(2): 735 - 742.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
O. Alpdogan, J. M. Eng, S. J. Muriglan, L. M. Willis, V. M. Hubbard, K. H. Tjoe, T. H. Terwey, A. Kochman, and M. R. M. van den Brink
Interleukin-15 enhances immune reconstitution after allogeneic bone marrow transplantation
Blood, January 15, 2005; 105(2): 865 - 873.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. Egusa, H. Nikawa, S. Makihira, A. Jewett, H. Yatani, and T. Hamada
Intercellular Adhesion Molecule 1-Dependent Activation of Interleukin 8 Expression in Candida albicans-Infected Human Gingival Epithelial Cells
Infect. Immun., January 1, 2005; 73(1): 622 - 626.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
A. Mavropoulos, G. Sully, A. P. Cope, and A. R. Clark
Stabilization of IFN-{gamma} mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells
Blood, January 1, 2005; 105(1): 282 - 288.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Wysocka, B. M. Benoit, S. Newton, L. Azzoni, L. J. Montaner, and A. H. Rook
Enhancement of the host immune responses in cutaneous T-cell lymphoma by CpG oligodeoxynucleotides and IL-15
Blood, December 15, 2004; 104(13): 4142 - 4149.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Koka, P. Burkett, M. Chien, S. Chai, D. L. Boone, and A. Ma
Cutting Edge: Murine Dendritic Cells Require IL-15R{alpha} to Prime NK Cells
J. Immunol., September 15, 2004; 173(6): 3594 - 3598.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. M. Mooney, J. Klem, C. Wulfing, L. A. Mijares, P. L. Schwartzberg, M. Bennett, and J. D. Schatzle
The Murine NK Receptor 2B4 (CD244) Exhibits Inhibitory Function Independent of Signaling Lymphocytic Activation Molecule-Associated Protein Expression
J. Immunol., September 15, 2004; 173(6): 3953 - 3961.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. Eriksson, S. K. Meadows, C. R. Wira, and C. L. Sentman
Unique phenotype of human uterine NK cells and their regulation by endogenous TGF-{beta}
J. Leukoc. Biol., September 1, 2004; 76(3): 667 - 675.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
R. Parihar, P. Nadella, A. Lewis, R. Jensen, C. De Hoff, J. E. Dierksheide, A. M. VanBuskirk, C. M. Magro, D. C. Young, C. L. Shapiro, et al.
A Phase I Study of Interleukin 12 with Trastuzumab in Patients with Human Epidermal Growth Factor Receptor-2-Overexpressing Malignancies: Analysis of Sustained Interferon {gamma} Production in a Subset of Patients
Clin. Cancer Res., August 1, 2004; 10(15): 5027 - 5037.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. B. Lesinski, B. Badgwell, J. Zimmerer, T. Crespin, Y. Hu, G. Abood, and W. E. Carson III
IL-12 Pretreatments Enhance IFN-{alpha}-Induced Janus Kinase-STAT Signaling and Potentiate the Antitumor Effects of IFN-{alpha} in a Murine Model of Malignant Melanoma
J. Immunol., June 15, 2004; 172(12): 7368 - 7376.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Mattner, A. Wandersee-Steinhauser, A. Pahl, M. Rollinghoff, G. R. Majeau, P. S. Hochman, and C. Bogdan
Protection against Progressive Leishmaniasis by IFN-{beta}
J. Immunol., June 15, 2004; 172(12): 7574 - 7582.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
M. Suzui, T. Kawai, H. Kimura, K. Takeda, H. Yagita, K. Okumura, P. N. Shek, and R. J. Shephard
Natural killer cell lytic activity and CD56dim and CD56bright cell distributions during and after intensive training
J Appl Physiol, June 1, 2004; 96(6): 2167 - 2173.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
H. Kono, H. Fujii, M. Asakawa, A. Maki, H. Amemiya, Y. Hirai, M. Matsuda, and M. Yamamoto
Medium-chain triglycerides enhance secretory IgA expression in rat intestine after administration of endotoxin
Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G1081 - G1089.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan
TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells
J. Immunol., June 1, 2004; 172(11): 7002 - 7007.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. A. Muhlen, J. Schumann, F. Wittke, S. Stenger, N. van Rooijen, L. van Kaer, and G. Tiegs
NK Cells, but Not NKT Cells, Are Involved in Pseudomonas aeruginosa Exotoxin A-Induced Hepatotoxicity in Mice
J. Immunol., March 1, 2004; 172(5): 3034 - 3041.
[Abstract] [Full Text] [PDF]


Home page
J. Pharmacol. Exp. Ther.Home page
H. Kono, M. Asakawa, H. Fujii, A. Maki, H. Amemiya, M. Yamamoto, M. Matsuda, and Y. Matsumoto
Edaravone, a Novel Free Radical Scavenger, Prevents Liver Injury and Mortality in Rats Administered Endotoxin
J. Pharmacol. Exp. Ther., October 1, 2003; 307(1): 74 - 82.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
P. C. Reading and G. L. Smith
Vaccinia Virus Interleukin-18-Binding Protein Promotes Virulence by Reducing Gamma Interferon Production and Natural Killer and T-Cell Activity
J. Virol., September 15, 2003; 77(18): 9960 - 9968.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
C. N. Baxevanis, A. D. Gritzapis, and M. Papamichail
In Vivo Antitumor Activity of NKT Cells Activated by the Combination of IL-12 and IL-18
J. Immunol., September 15, 2003; 171(6): 2953 - 2959.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J.H. Zhang, H. He, A.M. Borzychowski, K. Takeda, S. Akira, and B.A. Croy
Analysis of Cytokine Regulators Inducing Interferon Production by Mouse Uterine Natural Killer Cells
Biol Reprod, August 1, 2003; 69(2): 404 - 411.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
A. M. Orengo, E. Di Carlo, A. Comes, M. Fabbi, T. Piazza, M. Cilli, P. Musiani, and S. Ferrini
Tumor Cells Engineered with IL-12 and IL-15 Genes Induce Protective Antibody Responses in Nude Mice
J. Immunol., July 15, 2003; 171(2): 569 - 575.
[Abstract] [Full Text] [PDF]


Home page
Rheumatology (Oxford)Home page
C. Pridgeon, G. P. Lennon, L. Pazmany, R. N. Thompson, S. E. Christmas, and R. J. Moots
Natural killer cells in the synovial fluid of rheumatoid arthritis patients exhibit a CD56bright,CD94bright,CD158negative phenotype
Rheumatology, July 1, 2003; 42(7): 870 - 878.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
C. P. Kalberer, U. Siegler, and A. Wodnar-Filipowicz
Human NK cell development in NOD/SCID mice receiving grafts of cord blood CD34+ cells
Blood, July 1, 2003; 102(1): 127 - 135.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Strengell, S. Matikainen, J. Siren, A. Lehtonen, D. Foster, I. Julkunen, and T. Sareneva
IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-{gamma} Production in Human NK and T Cells
J. Immunol., June 1, 2003; 170(11): 5464 - 5469.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Schroder, C. Meisel, K. Buhl, N. Profanter, N. Sievert, H.-D. Volk, and G. Grutz
Different Modes of IL-10 and TGF-{beta} to Inhibit Cytokine-Dependent IFN-{gamma} Production: Consequences for Reversal of Lipopolysaccharide Desensitization
J. Immunol., May 15, 2003; 170(10): 5260 - 5267.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. G. Chiorean, S. J. Dylla, K. Olsen, T. Lenvik, Y. Soignier, and J. S. Miller
BCR/ABL alters the function of NK cells and the acquisition of killer immunoglobulin-like receptors (KIRs)
Blood, May 1, 2003; 101(9): 3527 - 3533.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. A. Fehniger, M. A. Cooper, G. J. Nuovo, M. Cella, F. Facchetti, M. Colonna, and M. A. Caligiuri
CD56bright natural killer cells are present in human lymph nodes and are activated by T cell-derived IL-2: a potential new link between adaptive and innate immunity
Blood, April 15, 2003; 101(8): 3052 - 3057.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. Arase, H. Arase, S. Hirano, T. Yokosuka, D. Sakurai, and T. Saito
IgE-Mediated Activation of NK Cells Through Fc{gamma}RIII
J. Immunol., March 15, 2003; 170(6): 3054 - 3058.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
J. Schumann, K. Muhlen, A. K. Kiemer, A. M. Vollmar, and G. Tiegs
Parenchymal, But Not Leukocyte, TNF Receptor 2 Mediates T Cell-Dependent Hepatitis in Mice
J. Immunol., February 15, 2003; 170(4): 2129 - 2137.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
E. M. Schneider, I. Lorenz, M. Muller-Rosenberger, G. Steinbach, M. Kron, and G. E. Janka-Schaub
Hemophagocytic lymphohistiocytosis is associated with deficiencies of cellular cytolysis but normal expression of transcripts relevant to killer-cell-induced apoptosis
Blood, September 26, 2002; 100(8): 2891 - 2898.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
K. Artavanis-Tsakonas and E. M. Riley
Innate Immune Response to Malaria: Rapid Induction of IFN-{gamma} from Human NK Cells by Live Plasmodium falciparum-Infected Erythrocytes
J. Immunol., September 15, 2002; 169(6): 2956 - 2963.
[Abstract] [Full Text] [PDF]


Home page
Clin. Cancer Res.Home page
S. S. Farag, S. L. George, E. J. Lee, M. Baer, R. K. Dodge, B. Becknell, T. Fehniger, L. R. Silverman, J. Crawford, C. D. Bloomfield, et al.
Postremission Therapy with Low-dose Interleukin 2 with or without Intermediate Pulse Dose Interleukin 2 Therapy Is Well Tolerated in Elderly Patients with Acute Myeloid Leukemia: Cancer and Leukemia Group B Study 9420
Clin. Cancer Res., September 1, 2002; 8(9): 2812 - 2819.
[Abstract] [Full Text] [PDF]


Home page
CVIHome page
D. Haller, P. Serrant, D. Granato, E. J. Schiffrin, and S. Blum
Activation of Human NK Cells by Staphylococci and Lactobacilli Requires Cell Contact-Dependent Costimulation by Autologous Monocytes
Clin. Vaccine Immunol., May 1, 2002; 9(3): 649 - 657.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. G. Dorner, A. Scheffold, M. S. Rolph, M. B. Huser, S. H. E. Kaufmann, A. Radbruch, I. E. A. Flesch, and R. A. Kroczek
MIP-1alpha , MIP-1beta , RANTES, and ATAC/lymphotactin function together with IFN-gamma as type 1 cytokines
PNAS, April 30, 2002; 99(9): 6181 - 6186.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
R. Hoontrakoon, H. W. Chu, S. J. Gardai, S. E. Wenzel, P. McDonald, V. A. Fadok, P. M. Henson, and D. L. Bratton
Interleukin-15 Inhibits Spontaneous Apoptosis in Human Eosinophils via Autocrine Production of Granulocyte Macrophage-Colony Stimulating Factor and Nuclear Factor-kappa B Activation
Am. J. Respir. Cell Mol. Biol., April 1, 2002; 26(4): 404 - 412.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Vankayalapati, B. Wizel, S. E. Weis, H. Safi, D. L. Lakey, O. Mandelboim, B. Samten, A. Porgador, and P. F. Barnes
The NKp46 Receptor Contributes to NK Cell Lysis of Mononuclear Phagocytes Infected with an Intracellular Bacterium
J. Immunol., April 1, 2002; 168(7): 3451 - 3457.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
M. J. Robertson
Role of chemokines in the biology of natural killer cells
J. Leukoc. Biol., February 1, 2002; 71(2): 173 - 183.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
I. R. Blanca, E. W. Bere, H. A. Young, and J. R. Ortaldo
Human B Cell Activation by Autologous NK Cells Is Regulated by CD40-CD40 Ligand Interaction: Role of Memory B Cells and CD5+ B Cells
J. Immunol., December 1, 2001; 167(11): 6132 - 6139.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Faggioni, R. C. Cattley, J. Guo, S. Flores, H. Brown, M. Qi, S. Yin, D. Hill, S. Scully, C. Chen, et al.
IL-18-Binding Protein Protects Against Lipopolysaccharide- Induced Lethality and Prevents the Development of Fas/Fas Ligand-Mediated Models of Liver Disease in Mice
J. Immunol., November 15, 2001; 167(10): 5913 - 5920.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
P. A. Reche, V. Soumelis, D. M. Gorman, T. Clifford, M.-r. Liu, M. Travis, S. M. Zurawski, J. Johnston, Y.-J. Liu, H. Spits, et al.
Human Thymic Stromal Lymphopoietin Preferentially Stimulates Myeloid Cells
J. Immunol., July 1, 2001; 167(1): 336 - 343.
[Abstract] [Full Text] [PDF]


Home page
Infect. Immun.Home page
H. H. Tong, Y. Chen, M. James, J. Van Deusen, D. B. Welling, and T. F. DeMaria
Expression of Cytokine and Chemokine Genes by Human Middle Ear Epithelial Cells Induced by Formalin-Killed Haemophilus influenzae or Its Lipooligosaccharide htrB and rfaD Mutants
Infect. Immun., June 1, 2001; 69(6): 3678 - 3684.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Vankayalapati, B. Wizel, D. L. Lakey, Y. Zhang, K. A. Coffee, D. E. Griffith, and P. F. Barnes
T Cells Enhance Production of IL-18 by Monocytes in Response to an Intracellular Pathogen
J. Immunol., June 1, 2001; 166(11): 6749 - 6753.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. A. Cooper, T. A. Fehniger, S. C. Turner, K. S. Chen, B. A. Ghaheri, T. Ghayur, W. E. Carson, and M. A. Caligiuri
Human natural killer cells: a unique innate immunoregulatory role for the CD56bright subset
Blood, May 15, 2001; 97(10): 3146 - 3151.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
N. J. Horwood, J. Elliott, T. J. Martin, and M. T. Gillespie
IL-12 Alone and in Synergy with IL-18 Inhibits Osteoclast Formation In Vitro
J. Immunol., April 15, 2001; 166(8): 4915 - 4921.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
K. Suzuki, H. Nakazato, H. Matsui, M. Hasumi, Y. Shibata, K. Ito, Y. Fukabori, K. Kurokawa, and H. Yamanaka
NK cell-mediated anti-tumor immune response to human prostate cancer cell, PC-3: immunogene therapy using a highly secretable form of interleukin-15 gene transfer
J. Leukoc. Biol., April 1, 2001; 69(4): 531 - 537.
[Abstract] [Full Text]


Home page
JEMHome page
T. A. Fehniger, K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, and M. A. Caligiuri
Fatal Leukemia in Interleukin 15 Transgenic Mice Follows Early Expansions in Natural Killer and Memory Phenotype Cd8+ T Cells
J. Exp. Med., January 15, 2001; 193(2): 219 - 232.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
G. Lertmemongkolchai, G. Cai, C. A. Hunter, and G. J. Bancroft
Bystander Activation of CD8+ T Cells Contributes to the Rapid Production of IFN-{{gamma}} in Response to Bacterial Pathogens
J. Immunol., January 15, 2001; 166(2): 1097 - 1105.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
S. Hyun Kim, L. L. Reznikov, R. J. L. Stuyt, C. H. Selzman, G. Fantuzzi, T. Hoshino, H. A. Young, and C. A. Dinarello
Functional Reconstitution and Regulation of IL-18 Activity by the IL-18R{beta} Chain
J. Immunol., January 1, 2001; 166(1): 148 - 154.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. A. Fehniger and M. A. Caligiuri
Interleukin 15: biology and relevance to human disease
Blood, January 1, 2001; 97(1): 14 - 32.
[Full Text] [PDF]


Home page
Antimicrob. Agents Chemother.Home page
G. S. Deepe Jr. and R. Gibbons
Recombinant Murine Granulocyte-Macrophage Colony-Stimulating Factor Modulates the Course of Pulmonary Histoplasmosis in Immunocompetent and Immunodeficient Mice
Antimicrob. Agents Chemother., December 1, 2000; 44(12): 3328 - 3336.
[Abstract] [Full Text]


Home page
Infect. Immun.Home page
G. Cai, R. Kastelein, and C. A. Hunter
Interleukin-18 (IL-18) Enhances Innate IL-12-Mediated Resistance to Toxoplasma gondii
Infect. Immun., December 1, 2000; 68(12): 6932 - 6938.
[Abstract] [Full Text] [PDF]


Home page
LupusHome page
C K Wong, C. Y Ho, E. Li, and C. Lam
Elevation of proinflammatory cytokine (IL-18, IL-17, IL-12) and Th2 cytokine (IL-4) concentrations in patients with systemic lupus erythematosus
Lupus, October 1, 2000; 9(8): 589 - 593.
[Abstract] [PDF]


Home page
J. Gen. Virol.Home page
S. Goodbourn, L. Didcock, and R. E. Randall
Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures
J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364.
[Full Text]


Home page
Rheumatology (Oxford)Home page
C. K. Wong, E. K. Li, C. Y. Ho, and C. W. K. Lam
Elevation of plasma interleukin-18 concentration is correlated with disease activity in systemic lupus erythematosus
Rheumatology, October 1, 2000; 39(10): 1078 - 1081.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. Di Carlo, A. Comes, S. Basso, A. De Ambrosis, R. Meazza, P. Musiani, K. Moelling, A. Albini, and S. Ferrini
The Combined Action of IL-15 and IL-12 Gene Transfer Can Induce Tumor Cell Rejection Without T and NK Cell Involvement
J. Immunol., September 15, 2000; 165(6): 3111 - 3118.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. R. Lauwerys, N. Garot, J.-C. Renauld, and F. A. Houssiau
Cytokine Production and Killer Activity of NK/T-NK Cells Derived with IL-2, IL-15, or the Combination of IL-12 and IL-18
J. Immunol., August 15, 2000; 165(4): 1847 - 1853.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
W. E. Carson, J. E. Dierksheide, S. Jabbour, M. Anghelina, P. Bouchard, G. Ku, H. Yu, H. Baumann, M. H. Shah, M. A. Cooper, et al.
Coadministration of interleukin-18 and interleukin-12 induces a fatal inflammatory response in mice: critical role of natural killer cell interferon-gamma production and STAT-mediated signal transduction
Blood, August 15, 2000; 96(4): 1465 - 1473.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
M. Lohoff, G. S. Duncan, D. Ferrick, H.-W. Mittrucker, S. Bischof, S. Prechtl, M. Rollinghoff, E. Schmitt, A. Pahl, and T. W. Mak
Deficiency in the Transcription Factor Interferon Regulatory Factor (Irf)-2 Leads to Severely Compromised Development of Natural Killer and T Helper Type 1 Cells
J. Exp. Med., August 7, 2000; 192(3): 325 - 336.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Fehniger, T. A.
Right arrow Articles by Caligiuri, M. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Fehniger, T. A.
Right arrow Articles by Caligiuri, M. A.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS