| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
,
,
Department of Internal Medicine, Divisions of
*
Hematology/Oncology and
Human Cancer Genetics,
Department of Medical Microbiology and Immunology, and the Comprehensive Cancer Center, Ohio State University, Columbus, OH 43210; and
§
PE Applied Biosystems, Foster City, CA 94404
 |
Abstract |
|---|
 Top Abstract IntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
protein (225 ± 52 ng/ml) and a 1393 ± 643-fold
increase in IFN- gene expression over those in resting NK cells.
IL-15 and IL-12 induced less IFN- protein (24 ± 10 ng/ml;
p < 0.007) and only a 45 ± 19-fold increase
in IFN- gene expression over those in resting NK cells. The
CD56bright NK cell subset produced significantly more
IFN- following IL-18 and IL-12 compared with CD56dim NK
cells (p < 0.008). However, the combination of
IL-15 and IL-12 was significantly more potent than that of IL-18 and
IL-12 for NK cell production of IL-10, macrophage inflammatory
protein-1
, macrophage inflammatory protein-1ß, and TNF- at the
protein and transcript levels. Granulocyte-macrophage CSF was optimally
induced by IL-15 and IL-18. Resting CD56+ NK cells
expressed IL-18R transcript that was up-regulated by IL-12 or IL-15.
Our results show that distinct cytokine and chemokine patterns are
induced in NK cells in response to different costimulatory signals from
these three monokines. This suggests that NK cell cytokine production
may be governed in part by the monokine milieu induced during the early
proinflammatory response to infection and by the subset of NK cells
present at the site of inflammation. |
Introduction |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production
(12). NK cells may also influence the type of Th cell responses
generated through their early production of immunoregulatory cytokines
such as IFN-, during T cell clonal expansion (11, 13, 14).
IL-12 is a proinflammatory and immunomodulatory cytokine produced
by activated macrophages in response to infection and has a central
role in directing the type 1 cytokine response as well as inducing NK
cell cytotoxicity (reviewed in 3, 5). IL-12 has been shown to
stimulate human NK cell cytokine and chemokine production, usually in
synergy with other costimulatory cytokines (15, 16, 17, 18, 19). IL-15, a cytokine
that shares biological functions and uses shared receptor components
with IL-2, is also produced by macrophages activated with bacterial
products (12, 20, 21). We have previously shown that these monokines,
IL-15 and IL-12, are potent inducers of IFN-, TNF-,
granulocyte-macrophage CSF (GM-CSF), macrophage inflammatory
protein-1 (MIP-1), and MIP-1ß production by human NK cells (12, 16, 17, 19).
IL-18 is a novel proinflammatory cytokine produced by activated
macrophages in response to bacterial components and appears to use
IL-1R-related protein (IL-1Rrp) to mediate intracellular signals
similar to those induced by IL-1 (reviewed in 22, 23). Alone,
IL-18 has the ability to augment murine (24) and human (25) NK cell
cytotoxicity and up-regulate murine NK cell expression of Fas ligand
(26); in combination with IL-12 it induces IFN- production by murine
NK1.1+CD3- cells (27). To date, reports of the
effects of IL-18 on human cells have focused on the bulk stimulation of
PBMC or purified primary T cells (25, 28, 29, 30). These studies have shown
that IL-18 in combination with Con A or TCR/CD3 cross-linking induced
IFN- by human PBMC (25), and that IL-18 plus TCR/CD3 signals induced
IFN- and GM-CSF production by primary human T cells (28). Recently,
IL-18 alone has been shown to induce IL-8 production by human PBMC and
purified NK cells (29). However, the direct effects of IL-18 on
cytokine and chemokine production by purified populations of
human NK cells have not, to the best of our knowledge, been
reported.
In the present study we characterized the effects of rhIL-18, alone and
in combination with rhIL-12, on the induction of cytokine (IFN-,
IL-10, TNF-, and GM-CSF) and C-C chemokine (MIP-1 and MIP-1ß)
transcript and protein production by resting human NK cells. In
addition, we directly compared the effects of various combinations of
three monokines, i.e., IL-18, IL-15, and IL-12, on the induction of
cytokine and chemokines, thereby providing some insight into the
cytokine profiles induced by these different monokine combinations. Our
results show that different combinations of IL-18, IL-15, and IL-12
optimally induced distinct cytokine and chemokine patterns, and these
patterns vary between NK cell subsets.
|
Materials and Methods |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
Purified rhIL-15 was provided by Immunex (Seattle, WA). Purified
rhIL-12 (sp. act., 4.5 x 106 U/mg) was obtained from
Genetics Institute (Cambridge, MA). Purified rhIL-18 was a gift from
Vertex Pharmaceuticals (Cambridge, MA). All cytokines were
reconstituted in sterile PBS with 0.1% human albumin (Armour,
Kankakee, IL) and were endotoxin free. PE-conjugated anti-human
CD56 mAb was purchased from Coulter Immunology (Hialeah, FL), and
PE-isotype control mAb was purchased from Becton Dickinson (San Jose,
CA). FITC-conjugated anti-human IFN- mAb and isotype control mAb
were purchased from PharMingen (San Diego, CA).
Isolation of human NK cells
Normal donor PBMC were obtained from leukopacs (American
Red Cross, Columbus, OH) using Ficoll-Hypaque (Sigma, St. Louis, MO)
density gradient centrifugation. RBC were lysed, after which PBMC were
washed twice in RPMI 1640 supplemented with 10% human AB serum (HAB;
C-six Diagnostics, Mequon, WI), antibiotics, and
anti-pleuropneumonia-like organism (Life Technologies, Grand Island,
NY; 10% HAB) and cultured for 2 h in plastic tissue
culture dishes to remove adherent monocytes. T cells, B cells, and
remaining monocytes were depleted using goat anti-mouse
immunomagnetic beads (PerSeptive Biosystems, Framingham, MA) and a
combination of murine mAb reactive against CD3, CD20, and HLA-DR, as
described previously (31). Nondepleted cells were then stained with
CD56-PE mAb, washed in 10% HAB, and isolated by FACS for total
CD56+ NK cells or CD56bright and
CD56dim NK cell subsets on a Coulter ELITE flow cytometer
(Coulter Immunology). Sorted CD56+ NK cells were routinely
98% pure as determined by flow cytometric analysis. NK cells
enriched by negative selection (85% pure) were used for Northern
analysis of IL-18R expression.
Stimulation of human NK cells with recombinant human monokines
For analysis of cytokine protein production, FACS-purified
CD56+ NK cells were cultured at 0.5 x
106/ml (unless otherwise indicated) in 10% HAB and plated
in 96-well U-bottom plates. After 72 h, cell-free culture
supernatants were harvested, centrifuged to remove any cells or debris,
and frozen at -80°C until assayed by commercial ELISA. Supernatants
underwent only one freeze-thaw cycle before quantitation by ELISA. For
analysis of cytokine protein by intracellular flow cytometry, purified
NK cells or FACS sorted NK cell subsets were cultured (1 x
106/ml) for 24 h in 10% HAB in 96-well U-bottom
plates, harvested, and immediately stained for IFN- protein.
Brefeldin A (Sigma) was added at a final concentration of 10 µg/ml
during the final 4 h of culture. For quantitation of cytokine
transcript by real-time PCR, cell sorted CD56+ NK cells
were either placed immediately in 300 µl of RNA lysis buffer (Ambion,
Austin, TX) or cultured (3 x 106/ml) in 24-well
flat-bottom plates with IL-12 (10 U/ml), IL-15 (100 ng/ml), and/or
IL-18 (100 ng/ml) at 37°C for the indicated times, followed by lysis
in RNA lysis buffer. For analysis of steady state IL-18R (IL-1Rrp)
transcript by Northern blot, enriched (85%) CD56+ NK
cells were cultured (3 x 106/ml) in 24-well
flat-bottom plates in medium, IL-12 (10 U/m), or IL-15 (100 ng/ml) for
24 h, followed by lysis in RNA lysis buffer. Samples in RNA lysis
buffer were stored at -80°C until RNA isolation was performed.
Measurement of NK cell cytokine protein in cell culture supernatants
Human NK cell production of IFN-, TNF-, GM-CSF
(sensitivity, 20 pg/ml; Endogen, Woburn, MA), IL-10 (sensitivity, 0.625
pg/ml; BioSource International, Camarillo, CA), MIP-1, and MIP-1ß
(sensitivity, 20 pg/ml; R&D Systems, Minneapolis, MN) protein was
measured in duplicate from cell-free culture supernatants with
commercial ELISA kits, following the manufacturers’ instructions.
Detection of IFN- production by intracellular flow cytometry
Following 24-h culture in the indicated monokine(s),
CD56+ NK cells were harvested and transferred into 5-ml
flow tubes. Cells were then surface stained with anti-CD56-PE mAb,
washed in FACS buffer (PBS with 1% FCS), and fixed in 2%
paraformaldehyde for 30 min at room temperature. After fixation, cells
were washed, resuspended in 25 µl of permeabilization buffer (PBS
with 0.5% saponin), and incubated for 30 min at room temperature.
Next, anti-IFN--FITC or isotype control-FITC mAb were added at a
final dilution of 1/100, and cells were incubated for an additional 30
min at room temperature. Cells were then washed twice with FACS buffer
and resuspended in a total volume of 1 ml of FACS buffer for analysis.
Forward scatter, side scatter, and fluorescence data were collected on
a Coulter XL flow cytometer (Coulter Immunology) and analyzed with the
WinMDI software program (Joseph Trotter, Scripps Research Institute, La
Jolla, CA). The percentage of CD56+ cells expressing
detectable IFN- and the mean fluorescence intensity (MFI) are
indicated in the appropriate quadrant of each dot plot. Nonreactive
FITC-isotype control staining of identical cells was used to set the
quadrant gates, with 99.5% of cells located in the negative
quadrants.
Quantitation of NK cell cytokine transcripts by real-time PCR
Real-time RT-PCR is a novel method that allows a rapid,
accurate, and precise quantitation of gene transcripts (32, 33).
Real-time PCR assays were performed with modifications to specifically
quantitate human cytokine and chemokine (IFN-, IL-10, TNF-,
MIP-1, and MIP-1ß) transcripts. Total cellular RNA was extracted
using RNAqueous total RNA isolation kits (Ambion), and cDNAs were
generated by RT of 1–2 µg of cellular RNA in the presence of random
hexamer primers (Clontech, Palo Alto, CA) following the manufacturer’s
recommendations. Each cDNA sample (2.5 µl) was then used as a
template for a PCR amplification mixture containing forward and reverse
primers (900 nM each), 6-carboxy-fluorescein-labeled probe (125 nM) for
the target cytokine (i.e., IFN-, IL-10, TNF-, MIP-1, or
MIP-1ß), forward and reverse primers for the 18S ribosomal RNA (rRNA;
50 nM each), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein-labeled
probe (50 nM) for 18S rRNA (internal control), and 2x TaqMan Universal
PCR Master Mix (PE Applied Biosystems, Foster City, CA). The PCR
amplifications for target cytokine and internal control 18S rRNA were
performed in the same well of capped 96-well optical plates. Reaction
mixtures were subjected to the following amplification scheme: one
cycle at 50°C for 2 min (AmpErase UNG deactivation) and one cycle at
95°C for 10 min (AmpliTaq Gold activation), followed by 40 cycles at
95°C (denaturation) for 15 s and 60°C (anneal/extension) for 1
min. Real-time PCR data were analyzed using Sequence Detector version
1.6 software included with the 7700 Sequence Detector (PE Applied
Biosystems). Final quantitation was derived using the comparative
CT method (see below) and is reported as the n-fold
difference relative to a calibrator cDNA (resting NK cell sample from
each donor) prepared in parallel with the experimental cDNAs. In some
instances the absolute fold increase was normalized to the optimal
stimulation conditions (i.e., the stimulation that resulted in the
greatest absolute fold increase) and expressed as a percentage of the
maximal fold increase. All data calculations were performed with the
Microsoft Excel software program (Microsoft, Redmond, WA).
The comparative CT method
The fractional cycle number at which the reporter fluorescence
generated by the cleavage of the probe passes a fixed threshold above
baseline is defined as the parameter threshold cycle (CT).
18S rRNA was used as an internal control to distinguish true target
negatives from PCR inhibition and also to normalize for differences in
the amount of total nucleic acid added to a reaction. The detection of
multiple target cDNAs in the same tube was achieved by labeling probes
with different and distinguishable reporter dyes. For relative
quantitation, values are expressed relative to a reference sample,
called the calibrator (resting NK cell cDNA in this study), and
relative quantitation was calculated by the comparative CT
method. First, the CT for the target amplicon and the
CT for the internal control were determined for each
sample. Differences in the CT for the target and the
CT for the internal control, called 
CT, were
calculated to normalize for the differences in the amount of total
nucleic acid added to each reaction. Then the CT for
each experimental sample was subtracted from the CT of
calibrator. This difference is termed the CT.
Finally, the amount of target, normalized to an internal control and
relative to the calibrator, was calculated by
2-CT. Thus, all experimental
samples are expressed as an n-fold difference relative to the
calibrator.
Quality control of the real-time PCR
All human cytokine and chemokine primers and probes used for
this study were obtained from PE Applied Biosystems and are
commercially available. Before analyzing experimental samples, primer
and probe concentrations were optimized for each target cytokine. In
addition, positive control cDNA (PHA-activated human PBL), negative
control cDNA (P815 murine cell line), and human genomic DNA samples
were tested to ensure the specificity of primers and probes for
amplification of the target cDNA. The comparative CT method
was validated for each target cytokine by demonstrating that
CT varied with serial template dilution.
Northern analysis for IL-1Rrp expression
The IL-18R (IL-1Rrp) cDNA probe was generated by PCR
amplification using primers synthesized based upon the published cDNA
sequence (5' primer, CTTTGCTGAATGAAGAGGATGTAAT; 3' primer,
CTTTCAAGTTCATACCTGACCTCAT) (34). Total cellular RNA was extracted
from resting and monokine-activated NK cell lysates using RNAqueous
total RNA isolation kits (Ambion). After isolation, RNA (15 µg) was
diluted to a total volume of 15 µl with RNA sample loading buffer
containing ethidium bromide. RNA was size fractionated through a 1%
agarose-formaldehyde gel, and equal loading of RNA was verified by
ethidium bromide staining of 28S and 18S rRNA. The size-fractionated
RNA was transferred overnight to a nitrocellulose membrane in 20x SSC
buffer and then cross-linked by UV irradiation. The membrane was
prehybridized at 42°C for 2 h with 15 ml of prehybridization
solution (50% formamide, 3x Denhardt’s solution, 0.5% SDS,
heat-denatured salmon sperm DNA (0.5 mg), and yeast transfer RNA (0.2
mg)). Radiolabel (32P) was incorporated into the probe by
random primer labeling using the PrimeIt II kit (Stratagene, La Jolla,
CA). Following prehybridization, the membrane was hybridized overnight
with the denatured, radiolabeled probe at 42°C in 15 ml of
hybridization solution (50% formamide, 1.33x Denhardt’s solution,
0.5% SDS, heat-denatured salmon sperm DNA (0.5 mg), and yeast transfer
RNA (0.2 mg)). The membrane was washed twice at room temperature for 10
min in 2x SSC/0.1% SDS followed by two 20-min washes at 50°C in
0.1x SSC/0.1% SDS. The membrane was then exposed to x-ray film
(Eastman Kodak, Rochester, NY) for 72 h at -80°C. The size of
the observed IL-18R band (
3.5 kb) was calculated by measuring the
distance of migration relative to that of a fluorescent ethidium
bromide-stained marker on the agarose-formaldehyde gel. The band
migrated below the 28S rRNA as previously described (34). For a
positive control, RNA isolated from PHA-activated human PBL was
analyzed in parallel with the NK cell samples.
RT-PCR analysis for AcPL expression
Total cellular RNA was extracted using RNAqueous total RNA isolation kits (Ambion), and cDNAs were generated by RT of 1–2 µg of cellular RNA in the presence of random hexamer primers (Clontech), following the manufacturer’s recommendations. Each cDNA sample (5 µl) was then used as a template for a PCR reaction containing primers for the gene of interest (AcPL or hypoxanthine phosphoribosyltransferase (HPRT); 20 µM), 1x PCR buffer (1.5 mM MgCl2, 10 mM Tris (pH 9.0), 50 mM KCl, and 0.1% Triton X-100), dNTPs (20 mM), and 1 U of AmpliTaq Gold polymerase (PE Applied Biosystems). The PCR amplification was performed in a GeneAmp 9700 thermocycler (PE Applied Biosystems). Reaction mixtures were subjected to the following amplification scheme: one cycle at 95°C for 2 min, and 35 cycles at 95°C for 30 s, 60°C for 30 s, and 72°C for 45 s. PCR products were then electrophoresed on a 2% agarose gel, stained with ethidium bromide, and visualized by UV fluorescence. Primers for AcPL were: 5' primer, 5'-GATCAGACGCTTGGGGATAA-3'; and 3' primer, 5'-TGTTTGATCATCCAAGGCAA-3'. Primers for HPRT were described previously (35).
Statistical analysis
Statistics were determined using Student’s paired t test, with p < 0.05 considered significant.
|
Results |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
protein production by
resting CD56+ NK cells than IL-15 plus IL-12
The monokine combination of IL-18 and IL-12 has recently been
shown to costimulate abundant IFN- production by human PBMC,
activated human T cells, and murine NK1.1+CD3-
cells (25, 27, 28). We have previously shown that the monokine
combination of IL-15 and IL-12 synergistically induced abundant IFN-
protein production by resting human NK cells (16). We therefore
directly compared the monokine combination of IL-18 and IL-12 to that
of IL-15 and IL-12 for the ability to stimulate CD56+ NK
cell IFN- production. Using a constant dose of rhIL-12 (10 U/ml) and
increasing costimulatory doses of rhIL-18 and rhIL-15, IL-18 induced
far greater IFN- protein production by resting human NK cells (Fig. 1
A, note log y-axis
scale). IL-18, IL-12, and IL-15 alone induced little (<1 ng/ml) or no
IFN- production in these assays. Comparing one concentration of
IL-18 or IL-15 (100 ng/ml), IFN- levels were 10- to 20-fold higher
in the IL-18- plus IL-12-stimulated cultures than in the IL-15- plus
IL-12-stimulated cultures (p < 0.007; Fig. 1B). Stimulation of NK cells with all three monokines
(IL-12, IL-18, and IL-15) yielded similar amounts of IFN- compared
with stimulation with IL-18 and IL-12 (data not shown). To further
clarify the cellular mechanism underlying the increased IFN-
production in response to IL-18 and IL-12, enriched CD56+
cells (85% pure) were cultured for 24 h in various combinations
of IL-15, IL-18, and IL-12 and assayed for IFN- production by
intracellular flow cytometry (Fig. 2A). Consistent with the
results of IFN- in cell culture supernatants, stimulation with IL-15
or IL-18 alone yielded very few (<2%) CD56+ cells that
were low IFN- producers (<102 log-FITC fluorescence).
Stimulation with IL-12 alone gave a low (5.6%) number of
CD56+ cells, the majority of which were low IFN-
producers. IL-18 and IL-12 induced a greater percentage of high IFN-
producers (>102 log-FITC fluorescence) compared with IL-15
and IL-12, while the percentages of total (low and high) IFN-
producers were very similar (32 vs 37%, respectively). These data are
consistent with the results above showing that IL-18 and IL-12 induce
much greater IFN- in cell culture supernatants compared with IL-15
and IL-12 and suggest that this results from a greater production of
IFN- by IL-18 and IL-12 on a per cell basis.
|
|
compared with CD56dim NK cells
Human NK cells may be divided into phenotypic and functional
subsets based upon surface expression of CD56 (7). We have previously
observed that CD56bright NK cells produce significantly
greater amounts of IFN- protein following costimulation with IL-15
and IL-12 compared with CD56dim NK cells (36). We therefore
purified CD56bright and CD56dim NK cells by
cell sorting and compared the IFN- induction by IL-18 and IL-12 to
that by IL-15 and IL-12. NK cell-derived IFN- was significantly
greater in CD56bright vs CD56dim when subsets
were stimulated with IL-18 and IL-12 (p <
0.008) or IL-15 and IL-12 (p < 0.02). The
majority of IFN- appeared to originate from the
CD56bright NK cell subset, which comprises only 10% of the
total CD56+ NK cells and 1% of lymphocytes (Fig. 1
C). Consistent with results obtained with total
CD56+ cells (Fig. 1, A and B), both
NK cell subsets produced little or no IFN- protein in response to
IL-15, IL-18, or IL-12 alone, and IL-18 and IL-12 was the most potent
costimulus for IFN- production in both NK cell subsets. To compare
the effects of IL-18 and IL-12 to those of IL-15 and IL-12 on
individual CD56bright vs CD56dim NK cells,
these NK cell subsets were analyzed for intracellular IFN-
production by flow cytometry (Fig. 2B). Costimulation of
CD56bright NK cells (Fig. 2B, right upper
panel) with IL-18 and IL-12 resulted in a striking IFN- protein
signal (MFI = 662) and production of IFN- by the vast majority
of cells (>95%). However, costimulation with IL-15 and IL-12 (Fig. 2B, left upper panel) resulted in about 50% of
CD56bright NK cells producing lower amounts of IFN-
(MFI = 38.2). Approximately 50% of CD56dim NK cells
stimulated with IL-18 and IL-12 (Fig. 2B, right lower
panel) produced IFN-, with those cells expressing a broad
continuum of IFN- (MFI = 223). In contrast, very few
CD56dim NK cells (8%) produced low amounts of IFN-
(MFI = 17.4) in response to IL-15 and IL-12 (Fig. 2B, lower
left panel). These results are consistent with the IFN- protein
measured in cell culture supernatants and suggest that one mechanism
for differential IFN- production in response to IL-18 and IL-12 vs
IL-15 and IL-12 involves the recruitment of different subsets of human
NK cells.
IL-18 and IL-12 induced a greater increase in IFN- transcript
levels in resting human NK cells compared with IL-15 and IL-12
We next measured IFN- mRNA in these NK cell cultures to
determine whether the striking production of IFN- protein in
response to IL-18 and IL-12, and the difference observed between
costimulation with IL-18 vs IL-15, were mediated at the level of gene
expression. In these experiments, FACS-purified CD56+ NK
cells were stimulated for various amounts of time with IL-15 or IL-18
plus IL-12, and total cellular RNA was isolated and reverse transcribed
into cDNA. To quantitate differences in IFN- mRNA levels, we used
real-time RT-PCR. Both rhIL-18 (100 ng/ml) and rhIL-15 (100 ng/ml) plus
rhIL-12 (10 U/ml) stimulated a rapid and sustained increase in IFN-
mRNA that was detectable at 1 h and peaked at 12 h (Fig. 3, A and B, note
log axes). After 12 h the amount of IFN- transcript plateaued
and was sustained for at least 24 h (data not shown). Consistent
with IFN- protein production, the combination of IL-18 and IL-12
invariably induced significantly higher (1393 ± 643-fold greater
than resting) IFN- transcript at 12 h compared with IL-15 and
IL-12 (45 ± 19-fold greater than resting; p <
0.025; Fig. 3, B and C). Identical concentrations
of IL-15 or IL-12 alone induced a modest (<3-fold) increase, while
IL-18 induced no increase in IFN- mRNA levels compared with
identical cultures of resting NK cells. Normalizing the absolute fold
increase for each experimental condition to the optimal (IL-18 and
IL-12) condition showed that the combination of IL-18 and IL-12 was
clearly the most potent costimulus tested for up-regulation of IFN-
mRNA in human NK cells (Fig. 3C). Therefore, while the
monokine combinations of IL-18 plus IL-12 and IL-15 plus IL-12 induced
significant increases in IFN- gene expression and protein production
by human NK cells, the former was the more potent stimulus.
|
The induction of IL-10 mRNA and protein by human NK cells was
recently demonstrated in response to the cytokine combination of IL-2
and IL-12 (18). We therefore compared the effects of IL-18 or IL-15
plus IL-12 on IL-10 gene expression and protein production by resting
CD56+ NK cells. We examined IL-10 protein in
monokine-stimulated NK cell culture supernatants 3–6 days after the
addition of the indicated cytokines (Fig. 4A). Stimulation of
CD56+ NK cells (1 x 106/ml) with IL-15,
IL-12, or IL-18 alone induced <10 pg/ml IL-10 protein in culture
supernatants. IL-15 (100 ng/ml) and IL-12 (10 U/ml) induced
significantly greater IL-10 protein production than IL-18 (100 ng/ml)
and IL-12 (p < 0.02). Consistent with these
results, real-time PCR demonstrated that IL-15 and IL-12 induced
significantly higher increases in IL-10 transcript than IL-18 and IL-12
(p < 0.05; Fig. 4B). The relative
difference between IL-15 or IL-18 plus IL-12 was similar to that
observed for IFN- (Figs. 1 and 3); however, in this case the
combination of IL-15 and IL-12 was the optimal stimulus.
|
and MIP-1ß production
by human NK compared with IL-18 and IL-12
Human NK cells produce abundant amounts of the C-C
chemokines MIP-1 and MIP-1ß protein following costimulation with
IL-15 and IL-12 (17, 19). We also examined the ability of IL-18 and
IL-12 to stimulate MIP-1 and MIP-1ß production by human NK cells.
IL-18 (100 ng/ml) and IL-12 (100 ng/ml) alone stimulated little or no
MIP-1 protein or increase in transcript levels (Fig. 5, A and B). In
contrast, there was a synergistic induction of MIP-1 by the
combination of IL-18 and IL-12. However, identical NK cell cultures
stimulated with IL-15 and IL-12 produced significantly greater amounts
of MIP-1 protein (p < 0.05) and greater
increases in MIP-1 transcript levels (p <
0.01). Of note, IL-15 is the only single monokine that stimulated
MIP-1 protein and transcript, albeit at lower levels than when
combined with IL-12. A similar pattern of induction was observed for
another C-C chemokine, MIP-1ß (Fig. 5, C and
D), with IL-15 and IL-12 inducing significantly greater
amounts of MIP-1ß protein (p < 0.05) and
increased MIP-1ß transcript levels (p <
0.025) compared with IL-18 and IL-12. Stimulation with all three
monokines (IL-12, IL-15, and IL-18) yielded similar levels of MIP-1
and MIP-1ß as those produced by IL-15 and IL-12 stimulation (data not
shown).
|
production by human NK
cells compared with IL-18 and IL-12
We have previously shown that human NK cells also produce the
proinflammatory cytokine TNF- following costimulation with IL-15 and
IL-12 (16). We therefore compared the ability of IL-18 or IL-15 plus
IL-12 to directly induce TNF- transcript and protein by resting NK
cells. As shown in Fig. 6A,
IL-18 and IL-12 alone stimulated no TNF-, whereas IL-15 alone
induced measurable TNF- protein in the NK cell culture supernatants.
While both IL-18 and IL-15 synergized with IL-12 to induce TNF-
protein production by NK cells, the combination of IL-15 and IL-12 was
a more potent stimulus (p < 0.05). Stimulation
with all three monokines (IL-12, IL-15, and IL-18) induced modestly
higher amounts (about twofold) of TNF- than stimulation with IL-15
and IL-12 (data not shown). A similar pattern, with IL-15 and IL-12
inducing a greater increase in TNF- levels than IL-18 and IL-12
(p < 0.05), was observed at the transcript
level using real-time PCR (Fig. 6B).
|
The production of GM-CSF by human PBMC and T cells in response to
IL-18 plus T cell mitogens has been reported (25, 28). We examined the
ability of IL-18, alone and in combination with IL-12 or IL-15, to
induce GM-CSF production by CD56+ NK cells. Consistent with
our previous results (16), IL-15 alone (100 ng/ml) induced GM-CSF
protein production (Fig. 7), and the
addition of IL-12 did not significantly alter the amount of GM-CSF
produced. While individually IL-18 and IL-12 induced no GM-CSF
production, in combination these monokines synergized to induce
significant amounts of GM-CSF protein. Interestingly, the combination
of IL-15 and IL-18 was the most potent stimulus for NK cell GM-CSF
production, inducing greater amounts than IL-15 alone or IL-18 and
IL-12 (p < 0.05). The combination of IL-18 and
IL-15 induced similar amounts of IFN-, TNF-, MIP-1, and
MIP-1ß as IL-15 alone (data not shown).
|
IL-18 has been shown to use a member of the IL-1R family, IL-1Rrp,
for binding and signaling (37). To confirm our functional results
suggesting that monokine-activated NK cells express the IL-18R, we
examined resting and activated human NK cells for expression of IL-1Rrp
transcript. CD56+ NK cells were enriched to 85% purity
by negative selection and were cultured (1 x 106/ml)
for 24 h in medium, IL-12 (10 U/ml), or IL-15 (100 ng/ml). The NK
cells were then harvested, and total cellular RNA was analyzed by
Northern blot for expression of IL-1Rrp message, as described in
Materials and Methods. Resting human NK cells expressed low,
but detectable, IL-1Rrp, and stimulation with IL-12 or IL-15 resulted
in an increase in the amount of signal, consistent with an increase in
IL-18R expression (Fig. 8). IL-18 has
also recently been shown to use another receptor component, AcPL, for
signaling (38). We also examined expression of AcPL mRNA by RT-PCR in
resting and monokine-activated NK cells. Resting human NK cells
expressed AcPL; however, there was no clear up-regulation by
semiquantitative RT-PCR, suggesting that this IL-18R subunit may be
constitutively expressed by resting NK cells and not regulated by IL-12
or IL-15 (data not shown).
|
|
Discussion |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
production. IL-18, in the
presence of IL-12, induced a striking, dose-dependent increase in the
amount of IFN- protein measured in CD56+ NK cell culture
supernatants. The combination of IL-18 and IL-12 was also shown to
induce a very distinct subset of NK cells (i.e.,
CD56bright) to produce relatively high amounts of IFN-
compared with the more numerous CD56dim subset.
Individually, IL-18 and IL-12 failed to induce IFN- protein by human
NK cells, consistent with previous findings that optimal NK cell
production of IFN- requires costimulation by more than one monokine
(16). Moreover, as other monokines (e.g., IL-15 and TNF-) also
potentiate IFN- production in combination with IL-12 (12, 16), these
data provide additional evidence that an IL-12-derived signal may be
critical for monokine stimulation of abundant IFN- production by
this lymphocyte population. To determine whether the dramatic increase
in IFN- protein production induced by IL-18 and IL-12 was mediated
at the level of transcription, we next measured IFN- mRNA expression
in monokine-stimulated CD56+ NK cells. IFN- transcript
levels in IL-18- and IL-12-stimulated NK cells were >1000-fold higher
than those in resting NK cells, as quantitated by real-time RT-PCR.
This striking activation of IFN- gene expression paralleled the
synergistic induction of IFN- protein, as identical concentrations
of IL-18 or IL-12 alone induced a 
3-fold increase in IFN- mRNA
levels.
We have previously shown that IL-15 synergistically potentiates
IL-12-induced NK cell production of IFN- (12, 16), and we next
directly compared the abilities of IL-15 and IL-18 to costimulate
IFN- production. While both IL-15 plus IL-12 and IL-18 plus IL-12
induced synergistic production of IFN-, the latter combination
consistently induced 20- to 30-fold greater amounts of IFN- protein
and gene expression (p < 0.025). IL-18 and
IL-12 also induced a greater percentage of high IFN--producing NK
cells compared with IL-15 and IL-12. These data suggest that IL-18
produced by macrophages in response to certain infectious pathogens may
be an important monokine for optimal stimulation of NK cell IFN-.
Indeed, in a murine model of Cryptococcus neoformans
infection, culture of peritoneal exudate cells with a combination of
IL-12 and IL-18 induced antifungal activity through induction of NK
cell IFN- and macrophage nitric oxide (39). In addition,
administration of anti-IL-18 Abs in vivo rendered mice more
susceptible to Yersinia enterocolitica infection (40) and
reduced carrageenin-induced local inflammation in vivo (41). Further
studies are needed to definitively prove a role for IL-18 in the
induction of protective IFN- in human infectious disease. Our
findings that IL-18 potently costimulated human NK cell IFN-
production are consistent with those of other studies demonstrating
that IL-18 potentiates IFN- production in TCR/CD3 cross-linked or
mitogen-stimulated purified human T cells, Th1 cell clones, and bulk
PBMC (25, 28, 30). Tomura et al. recently documented a similar role for
IL-18 in the costimulation of IFN- protein production by freshly
isolated murine NK1.1+CD3- splenocytes in
combination with IL-12 (27). Collectively, the data presented in this
report and these previous studies define a potential role for IL-18
produced by pathogen-activated macrophages in the induction of early NK
cell-derived IFN- as well as late T cell-derived IFN-.
Human NK cells may be divided into functional subsets based upon their
surface expression of CD56, an isoform of the neural cell adhesion
molecule, and CD16 (FcRIII) (7, 42, 43). A minority of NK cells
(10%) express CD56 at high density
(CD56brightCD16dim/neg) and have unique
characteristics among NK cells, including constitutive expression of a
functional high affinity IL-2Rß (44, 45), the c-kit
tyrosine kinase receptor (31), and high levels of L-selectin (CD62
ligand) (46). The majority of human NK cells are
CD56dimCD16bright, express the intermediate
affinity IL-2Rß, and mediate cytotoxicity that is increased upon
stimulation with nanomolar concentrations of IL-2, IL-15, or IL-12. The
CD56bright NK cell subset is selectively expanded in
patients with cancer and/or AIDS when they are administered low doses
of exogenous rhIL-2 (35, 47, 48, 49, 50). We have previously shown that the
CD56bright NK cell subset produced significantly greater
amounts of macrophage-activating factors (IFN-, TNF-, and GM-CSF)
when costimulated with nanomolar amounts of IL-2 or IL-15 in
combination with IL-12 compared with CD56dim NK cells (36).
We therefore examined IFN- production by these two NK cell subsets
in response to IL-18 and IL-12. CD56bright NK cells
produced 20- to 30-fold greater amounts of IFN- protein in cell
culture supernatants following stimulation with IL-18 and IL-12
compared with an equal number of CD56dim NK cells.
Intracellular flow cytometry revealed that nearly all
CD56bright NK cells became high IFN- producers following
IL-18 and IL-12 costimulation, while only a fraction of
CD56dim NK cells became IFN- producers (Fig. 2B). Voss et al. have recently shown that resting
CD56bright, but not CD56dim, NK cells produce
IFN- in response to ligation of the C-type lectin NK receptor CD94
in combination with IL-2 or IL-15 (51). These data suggest that even
though CD56bright NK cells are the numerically minor NK
cell subset, they may be the major source of IFN- in response to
monokines such as IL-15 or IL-18 plus IL-12 as well as from cell
surface-derived signals through NK cell receptors. A recent report
characterizing IL-18R (IL-1Rrp) expression by flow cytometry on human
peripheral blood cells demonstrated that nearly all resting
CD56bright NK cells express IL-18R, which was up-regulated
by IL-12 (52). This appears to be one mechanism for the differential
production of IFN- by these NK cell subsets, but others may include
differences in the levels of intracellular signaling molecules, cell
surface costimulatory molecules, or activation state or an intrinsic
functional difference in the potential to produce cytokines. Studies
are underway to fully characterize the differences in cytokine and
chemokine production between CD56bright and
CD56dim NK cell subsets (T. A. Fehniger and M. A.
Caligiuri, manuscript in preparation). It is notable that expression of
the IL-18R (IL-1Rrp) has recently been suggested as a stable cell
surface marker for Th1 cells (41). CD56bright NK cells
share many functional (e.g., potent IFN- production) and phenotypic
(e.g., constitutive IL-18R, IL-12R, and IL-2/15Rß expression)
properties with Th1 cells. As such, the human CD56bright NK
cell subset may be considered closely related to Th1 cells and may have
a similar immunoregulatory role in the early innate immune response to
infection.
While the combination of IL-18 and IL-12 was clearly the optimal
stimulus for IFN- production by human NK cells, this was not the
case for several other cytokines and chemokines examined. IL-10
production was induced by IL-15 and IL-12, while little IL-10 was
induced by IL-18 and IL-12. Such differential induction by monokines
may be important for the interaction between NK cells and macrophages
via innate paracrine cytokine loops. The present study also described a
role for IL-18 in combination with IL-12 in the induction of TNF- as
well as the C-C chemokines MIP-1 and MIP-1ß by resting human NK
cells. Similar to the observations with IFN- and IL-10, IL-18 alone
failed to induce TNF-, MIP-1, or MIP-1ß protein and transcript
by CD56+ NK cells. Synergistic production of these factors
was induced at both the protein and transcript levels when IL-18 was
combined with IL-12. In contrast to the results for IFN-, when the
combination of IL-18 and IL-12 was directly compared with that of IL-15
and IL-12 for the ability to induce these factors, IL-15 and IL-12 was
the optimal monokine combination. Of note, IL-15 alone stimulated
significantly greater amounts of MIP-1 and MIP-1ß protein than
medium controls, IL-18 alone, or IL-12 alone. Our preliminary studies
(36) indicate that IL-15 and IL-12 selectively induce TNF- and
GM-CSF in the CD56bright NK cell subset, and experiments
are ongoing to fully compare the cytokine and chemokine profiles
produced by these NK cell subsets in response to various stimuli
(T. A. Fehniger and M. A. Caligiuri, manuscript in
preparation). A recent report showed that IL-18 (10 nM, 18 ng/ml)
alone directly induced IL-8 production by purified human NK cells (29).
In this study Puren et al. also suggest that this IL-8 production was
partially dependent on endogenous TNF-, as the addition of a soluble
recombinant TNF binding protein decreased the IL-8 measured. However,
endogenous TNF- production was not measured at the protein or
transcript level. In our experiments, we observed no increase in
TNF- gene expression and no TNF- protein production induced by
IL-18 alone at concentrations up to 100 ng/ml. While IL-18 and IL-12
again synergized in the induction of GM-CSF production by NK cells, the
levels were approximately equivalent to those induced by IL-15 with or
without IL-12. Unexpectedly, the optimal costimulatory
monokine combination for GM-CSF production by human NK cells was IL-15
and IL-18.
The results of this study and others discussed above suggest that the particular monokines (e.g., IL-18, IL-15, and IL-12) that are induced by an infectious pathogen may determine in part the pattern of cytokines and chemokines produced by human NK cells during the early response to infection. Responsiveness to these monokines depends upon the NK cell subsets present and the surface expression of their respective receptors. This report provided data demonstrating that mRNA for one component of the IL-18R, IL-1Rrp, is expressed on resting human NK cells and is up-regulated by IL-12 or IL-15. This is consistent with recent work showing that resting human NK cells express IL-1Rrp by flow cytometry, and this expression is increased by IL-12 (52). Such receptor modulation may also be an important regulatory mechanism determining when and which NK cell subsets are responsive to certain monokines. Another component of the IL-18R complex required for signaling in response to IL-18, AcPL, was recently identified (38) and appears to be constitutively expressed at the transcript level by resting human NK cells (data not shown). It is likely that additional components of the functional IL-18R important for high affinity binding have yet to be identified (23) and may also contribute to selective IL-18 responsiveness via cell type-specific or cytokine-regulated expression.
Interaction of different monokine-induced transcription factors at the
promoters of monokine-responsive NK cell genes represent one final
point of integration determining their expression. Barbulescu et al.
have recently reported that anti-CD3/CD28 Abs, IL-12, and IL-18
have distinct effects on the IFN- promoter in primary human
CD4+ T cells (30). IL-18 induced binding of a transcription
factor to an AP-1 site located in the -265 to -186 region of the
IFN- promoter, which conferred high promoter activity. In contrast,
IL-12 induced binding of a transcription factor to a STAT binding site,
but this conferred low promoter activity. When these T cells were
stimulated with anti-CD3/CD28 Abs and IL-12, there was concurrent
binding to both the AP-1 site and the STAT binding site resulting in
high promoter activity. However, the authors did not test the effects
of IL-12, anti-CD3/CD28, and IL-18, precluding analysis of the
synergistic increase in IFN- production at the promoter level in
CD4+ T cells. As the cis-acting elements that
control IFN- gene expression are complex (53, 54, 55, 56, 57), IL-15 may
potentiate IL-12-induced IFN- through induction of AP-1 or by
inducing other IFN- promoter binding proteins, such as STAT5, in
human NK cells (58, 59). Studies examining the molecular mechanisms of
intracellular signaling involved in activating different NK cell
cytokine and chemokine patterns, with comparison to T cells, may yield
additional NK cell-specific targets to up- or down-regulate certain NK
cell effector functions. Further studies examining how NK cells
integrate various signals from monokines, cell surface costimulatory
molecules, and NK-activating receptors will help clarify how this
innate immune cytokine response is orchestrated to efficiently contain
the pathogen and direct the development of a protective Ag-specific
immune response. Understanding the complex cytokine networks integrated
by human NK cells to induce immunoregulatory cytokine and chemokine
production may provide novel therapeutic strategies for augmenting,
diminishing, or redirecting the early innate immune response to
infectious insult.
|
Acknowledgments |
|---|
|
Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Michael A. Caligiuri, Ohio State University, 458A Starling-Loving Hall, 320 West 10th Ave., Columbus, OH 43210. E-mail address:
3 Abbreviations used in this paper: monokine, monocyte-derived cytokine; GM-CSF, granulocyte-macrophage CSF; MIP, macrophage inflammatory protein; IL-1Rrp, IL-1 receptor-related protein; rh, recombinant human; PE, phycoerythrin; HAB, human AB serum; MFI, mean fluorescence intensity; rRNA, ribosomal ribonucleic acid; CT, parameter threshold cycle; AP-1, activator protein-1; AcPL, accessory protein-like.
Received for publication November 18, 1998. Accepted for publication January 28, 1999.
|
References |
|---|
|
TopAbstractIntroductionMaterials and MethodsResultsDiscussionReferences |
|---|
). Curr. Opin. Immunol. 9:17.[Medline]
by an intracellular parasite and induces resistance in T-cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115. by natural killer cells in vitro. J. Clin. Invest. 96:2578.
production by natural killer cell stimulatory factor: characterization of the responder cells and synergy with other inducers. J. Exp. Med. 173:869. in response to monocyte-derived cytokines. J. Clin. Invest. 97:2722.[Medline]
production by IL-12 and IL-18. Curr. Opin. Immunol. 10:159.
inducing factor. J. Leukoc. Biol. 63:658.[Abstract]
production by T cells. Nature 378:88.[Medline]
-inducing factor, expression in Escherichia coli, and studies on the biologic activities of the protein. J. Immunol. 156:4274.[Abstract]
-inducing factor up-regulates Fas ligand-mediated cytotoxic activity of murine natural killer cell clones. J. Immunol. 157:3967.[Abstract]
-inducing factor enhances T helper 1 cytokine production by stimulated human T cells: synergism with interleukin-12 for interferon- production. Eur. J. Immunol. 26:1647.[Medline]
-inducing factor) induces IL-8 and IL-1ß via TNF production from non-CD14+ human blood mononuclear cells. J. Clin. Invest. 101:711.[Medline]
promoter in primary CD4+ T lymphocytes. J. Immunol. 160:3642. interferon by natural killer cells. Infect. Immun. 65:3594.[Abstract]
-inducing factor) regulates early cytokine production in, and promotes resolution of, bacterial infection in mice. J. Immunol. 160:299.RIII-positive and negative natural killer cells. J. Immunol. 143:3183.[Abstract]
gene expression. J. Interferon Res. 16:563.
interferon promoter through two mechanisms: inhibition of AP1 binding and activation of a silencer element. Mol. Cell. Biol. 16:4744.[Abstract]
interferon promoter elements in naive and memory (effector) CD4 T cells and CD8 T cells. Mol. Cell. Biol. 17:199.[Abstract]
B and NFAT with the interferon- promoter. J. Biol. Chem. 272:30412.This article has been cited by other articles:
|
|
 |
|
  M. P. Longhi, C. Trumpfheller, J. Idoyaga, M. Caskey, I. Matos, C. Kluger, A. M. Salazar, M. Colonna, and R. M. Steinman Dendritic cells require a systemic type I interferon response to mature and induce CD4+ Th1 immunity with poly IC as adjuvant J. Exp. Med., July 6, 2009; 206(7): 1589 - 1602. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. C. Rodriguez-Galan, D. Reynolds, S. G. Correa, P. Iribarren, M. Watanabe, and H. A. Young Coexpression of IL-18 Strongly Attenuates IL-12-Induced Systemic Toxicity through a Rapid Induction of IL-10 without Affecting its Antitumor Capacity J. Immunol., July 1, 2009; 183(1): 740 - 748. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. C. Robson, H. Wei, T. McAlpine, N. Kirkpatrick, J. Cebon, and E. Maraskovsky Activin-A attenuates several human natural killer cell functions Blood, April 2, 2009; 113(14): 3218 - 3225. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y.-C. Huang, S.-W. Hung, T.-R. Jan, K.-W. Liao, C.-H. Cheng, Y.-S. Wang, and R.-M. Chu CD5-low expression lymphocytes in canine peripheral blood show characteristics of natural killer cells J. Leukoc. Biol., December 1, 2008; 84(6): 1501 - 1510. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Wu, M. L. Craft, P. Wang, K. R. Wyburn, G. Chen, J. Ma, B. Hambly, and S. J. Chadban IL-18 Contributes to Renal Damage after Ischemia-Reperfusion J. Am. Soc. Nephrol., December 1, 2008; 19(12): 2331 - 2341. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Guo, A. Samarakoon, B. Vanhaesebroeck, and S. Malarkannan The p110{delta} of PI3K plays a critical role in NK cell terminal maturation and cytokine/chemokine generation J. Exp. Med., September 29, 2008; 205(10): 2419 - 2435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Trotta, J. D. Col, J. Yu, D. Ciarlariello, B. Thomas, X. Zhang, J. Allard II, M. Wei, H. Mao, J. C. Byrd, et al. TGF-{beta} Utilizes SMAD3 to Inhibit CD16-Mediated IFN-{gamma} Production and Antibody-Dependent Cellular Cytotoxicity in Human NK Cells J. Immunol., September 15, 2008; 181(6): 3784 - 3792. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Dulphy, P. Haas, M. Busson, S. Belhadj, R. Peffault de Latour, M. Robin, M. Carmagnat, P. Loiseau, R. Tamouza, C. Scieux, et al. An Unusual CD56brightCD16low NK Cell Subset Dominates the Early Posttransplant Period following HLA-Matched Hematopoietic Stem Cell Transplantation J. Immunol., August 1, 2008; 181(3): 2227 - 2237. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. D. Smithgall, M. R. Comeau, B.-R. Park Yoon, D. Kaufman, R. Armitage, and D. E. Smith IL-33 amplifies both Th1- and Th2-type responses through its activity on human basophils, allergen-reactive Th2 cells, iNKT and NK Cells Int. Immunol., August 1, 2008; 20(8): 1019 - 1030. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Caligiuri Human natural killer cells Blood, August 1, 2008; 112(3): 461 - 469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Guia, C. Cognet, L. de Beaucoudrey, M. S. Tessmer, E. Jouanguy, C. Berger, O. Filipe-Santos, J. Feinberg, Y. Camcioglu, J. Levy, et al. A role for interleukin-12/23 in the maturation of human natural killer and CD56+ T cells in vivo Blood, May 15, 2008; 111(10): 5008 - 5016. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Athie-Morales, G. M. O'Connor, and C. M. Gardiner Activation of Human NK Cells by the Bacterial Pathogen-Associated Molecular Pattern Muramyl Dipeptide J. Immunol., March 15, 2008; 180(6): 4082 - 4089. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Johnson and R. I. Tapping Microbial Products Stimulate Human Toll-like Receptor 2 Expression through Histone Modification Surrounding a Proximal NF-{kappa}B-binding Site J. Biol. Chem., October 26, 2007; 282(43): 31197 - 31205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Trotta, D. Ciarlariello, J. D. Col, J. Allard II, P. Neviani, R. Santhanam, H. Mao, B. Becknell, J. Yu, A. K. Ferketich, et al. The PP2A inhibitor SET regulates natural killer cell IFN-{gamma} production J. Exp. Med., October 1, 2007; 204(10): 2397 - 2405. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Wang, B. Grzywacz, D. Sukovich, V. McCullar, Q. Cao, A. B. Lee, B. R. Blazar, D. N. Cornfield, J. S. Miller, and M. R. Verneris The unexpected effect of cyclosporin A on CD56+CD16 and CD56+CD16+ natural killer cell subpopulations Blood, September 1, 2007; 110(5): 1530 - 1539. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Cerboni, A. Zingoni, M. Cippitelli, M. Piccoli, L. Frati, and A. Santoni Antigen-activated human T lymphocytes express cell-surface NKG2D ligands via an ATM/ATR-dependent mechanism and become susceptible to autologous NK- cell lysis Blood, July 15, 2007; 110(2): 606 - 615. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Becknell, T. L. Hughes, A. G. Freud, B. W. Blaser, J. Yu, R. Trotta, H. C. Mao, M. L. Caligiuri de Jesus, M. Alghothani, D. M. Benson Jr, et al. Hlx homeobox transcription factor negatively regulates interferon-{gamma} production in monokine-activated natural killer cells Blood, March 15, 2007; 109(6): 2481 - 2487. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Rafei, J. H. Wu, B. Annabi, L. Lejeune, M. Francois, and J. Galipeau A GMCSF and IL-15 fusokine leads to paradoxical immunosuppression in vivo via asymmetrical JAK/STAT signaling through the IL-15 receptor complex Blood, March 1, 2007; 109(5): 2234 - 2242. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Rodriguez, B. P. Arulanandam, V. L. Hodara, H. M. McClure, E. K. Cobb, M. T. Salas, R. White, and K. K. Murthy Influence of interleukin-15 on CD8+ natural killer cells in human immunodeficiency virus type 1-infected chimpanzees J. Gen. Virol., February 1, 2007; 88(2): 641 - 651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. Grzywacz, N. Kataria, M. Sikora, R. A. Oostendorp, E. A. Dzierzak, B. R. Blazar, J. S. Miller, and M. R. Verneris Coordinated acquisition of inhibitory and activating receptors and functional properties by developing human natural killer cells Blood, December 1, 2006; 108(12): 3824 - 3833. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Yang, D. Rangasamy, K. I. Matthaei, A. J. Frew, N. Zimmmermann, S. Mahalingam, D. C. Webb, D. J. Tremethick, P. J. Thompson, S. P. Hogan, et al. Inhibition of Arginase I Activity by RNA Interference Attenuates IL-13-Induced Airways Hyperresponsiveness J. Immunol., October 15, 2006; 177(8): 5595 - 5603. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Aranami, S. Miyake, and T. Yamamura Differential Expression of CD11c by Peripheral Blood NK Cells Reflects Temporal Activity of Multiple Sclerosis J. Immunol., October 15, 2006; 177(8): 5659 - 5667. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Vujisic, S. Z. Lepej, I. Emedi, R. Bauman, A. Remenar, and M. K. Tiljak Ovarian follicular concentration of IL-12, IL-15, IL-18 and p40 subunit of IL-12 and IL-23 Hum. Reprod., October 1, 2006; 21(10): 2650 - 2655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Nelson, S. R. Walker, W. Li, X. S. Liu, and D. A. Frank Identification of Human STAT5-dependent Gene Regulatory Elements Based on Interspecies Homology J. Biol. Chem., September 8, 2006; 281(36): 26216 - 26224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T. K. Tso, W.-N. Huang, H.-Y. Huang, and C.-K. Chang Relationship of plasma interleukin-18 concentrations to traditional and non-traditional cardiovascular risk factors in patients with systemic lupus erythematosus Rheumatology, September 1, 2006; 45(9): 1148 - 1153. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. P. Monk, G. Phillips, R. Waite, J. Kuhn, L. J. Schaaf, G. A. Otterson, D. Guttridge, C. Rhoades, M. Shah, T. Criswell, et al. Assessment of Tumor Necrosis Factor Alpha Blockade As an Intervention to Improve Tolerability of Dose-Intensive Chemotherapy in Cancer Patients J. Clin. Oncol., April 20, 2006; 24(12): 1852 - 1859. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 T K Tso, W-N Huang, H-Y Huang, and C-K Chang Elevation of plasma interleukin-18 concentration is associated with insulin levels in patients with systemic lupus erythematosus Lupus, April 1, 2006; 15(4): 207 - 212. [Abstract] [PDF]
|
|
|
|
 |
|
 L C W Lit, C K Wong, L S Tam, E K M Li, and C W K Lam Raised plasma concentration and ex vivo production of inflammatory chemokines in patients with systemic lupus erythematosus Ann Rheum Dis, February 1, 2006; 65(2): 209 - 215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Roda, R. Parihar, C. Magro, G. J. Nuovo, S. Tridandapani, and W. E. Carson III Natural Killer Cells Produce T Cell-Recruiting Chemokines in Response to Antibody-Coated Tumor Cells Cancer Res., January 1, 2006; 66(1): 517 - 526. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. A. Perez, L. G. Mahaira, P. A. Sotiropoulou, A. D. Gritzapis, E. G. Iliopoulou, D. K. Niarchos, N. T. Cacoullos, Y. G. Kavalakis, A. I. Antsaklis, N. N. Sotiriadou, et al. Effect of IL-21 on NK cells derived from different umbilical cord blood populations Int. Immunol., January 1, 2006; 18(1): 49 - 58. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Ing, M. Segura, N. Thawani, M. Tam, and M. M. Stevenson Interaction of Mouse Dendritic Cells and Malaria-Infected Erythrocytes: Uptake, Maturation, and Antigen Presentation J. Immunol., January 1, 2006; 176(1): 441 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A. Sotiropoulou, S. A. Perez, A. D. Gritzapis, C. N. Baxevanis, and M. Papamichail Interactions Between Human Mesenchymal Stem Cells and Natural Killer Cells Stem Cells, January 1, 2006; 24(1): 74 - 85. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Schierloh, N. Yokobori, M. Aleman, R. M. Musella, M. Beigier-Bompadre, M. A. Saab, L. Alves, E. Abbate, S. S. de la Barrera, and M. C. Sasiain Increased Susceptibility to Apoptosis of CD56dimCD16+ NK Cells Induces the Enrichment of IFN-{gamma}-Producing CD56bright Cells in Tuberculous Pleurisy J. Immunol., November 15, 2005; 175(10): 6852 - 6860. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Ing, P. Gros, and M. M. Stevenson Interleukin-15 Enhances Innate and Adaptive Immune Responses to Blood-Stage Malaria Infection in Mice Infect. Immun., May 1, 2005; 73(5): 3172 - 3177. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Trotta, R. Parihar, J. Yu, B. Becknell, J. Allard II, J. Wen, W. Ding, H. Mao, S. Tridandapani, W. E. Carson, et al. Differential expression of SHIP1 in CD56bright and CD56dim NK cells provides a molecular basis for distinct functional responses to monokine costimulation Blood, April 15, 2005; 105(8): 3011 - 3018. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Grund, D. D. Spyropoulos, D. K. Watson, and R. C. Muise-Helmericks Interleukins 2 and 15 Regulate Ets1 Expression via ERK1/2 and MNK1 in Human Natural Killer Cells J. Biol. Chem., February 11, 2005; 280(6): 4772 - 4778. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Croce, R. Meazza, A. M. Orengo, L. Radic', B. De Giovanni, C. Gambini, B. Carlini, V. Pistoia, L. Mortara, R. S. Accolla, et al. Sequential Immunogene Therapy with Interleukin-12- and Interleukin-15-Engineered Neuroblastoma Cells Cures Metastatic Disease in Syngeneic Mice Clin. Cancer Res., January 15, 2005; 11(2): 735 - 742. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Alpdogan, J. M. Eng, S. J. Muriglan, L. M. Willis, V. M. Hubbard, K. H. Tjoe, T. H. Terwey, A. Kochman, and M. R. M. van den Brink Interleukin-15 enhances immune reconstitution after allogeneic bone marrow transplantation Blood, January 15, 2005; 105(2): 865 - 873. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Egusa, H. Nikawa, S. Makihira, A. Jewett, H. Yatani, and T. Hamada Intercellular Adhesion Molecule 1-Dependent Activation of Interleukin 8 Expression in Candida albicans-Infected Human Gingival Epithelial Cells Infect. Immun., January 1, 2005; 73(1): 622 - 626. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Mavropoulos, G. Sully, A. P. Cope, and A. R. Clark Stabilization of IFN-{gamma} mRNA by MAPK p38 in IL-12- and IL-18-stimulated human NK cells Blood, January 1, 2005; 105(1): 282 - 288. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Wysocka, B. M. Benoit, S. Newton, L. Azzoni, L. J. Montaner, and A. H. Rook Enhancement of the host immune responses in cutaneous T-cell lymphoma by CpG oligodeoxynucleotides and IL-15 Blood, December 15, 2004; 104(13): 4142 - 4149. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Koka, P. Burkett, M. Chien, S. Chai, D. L. Boone, and A. Ma Cutting Edge: Murine Dendritic Cells Require IL-15R{alpha} to Prime NK Cells J. Immunol., September 15, 2004; 173(6): 3594 - 3598. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. M. Mooney, J. Klem, C. Wulfing, L. A. Mijares, P. L. Schwartzberg, M. Bennett, and J. D. Schatzle The Murine NK Receptor 2B4 (CD244) Exhibits Inhibitory Function Independent of Signaling Lymphocytic Activation Molecule-Associated Protein Expression J. Immunol., September 15, 2004; 173(6): 3953 - 3961. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Eriksson, S. K. Meadows, C. R. Wira, and C. L. Sentman Unique phenotype of human uterine NK cells and their regulation by endogenous TGF-{beta} J. Leukoc. Biol., September 1, 2004; 76(3): 667 - 675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Parihar, P. Nadella, A. Lewis, R. Jensen, C. De Hoff, J. E. Dierksheide, A. M. VanBuskirk, C. M. Magro, D. C. Young, C. L. Shapiro, et al. A Phase I Study of Interleukin 12 with Trastuzumab in Patients with Human Epidermal Growth Factor Receptor-2-Overexpressing Malignancies: Analysis of Sustained Interferon {gamma} Production in a Subset of Patients Clin. Cancer Res., August 1, 2004; 10(15): 5027 - 5037. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. B. Lesinski, B. Badgwell, J. Zimmerer, T. Crespin, Y. Hu, G. Abood, and W. E. Carson III IL-12 Pretreatments Enhance IFN-{alpha}-Induced Janus Kinase-STAT Signaling and Potentiate the Antitumor Effects of IFN-{alpha} in a Murine Model of Malignant Melanoma J. Immunol., June 15, 2004; 172(12): 7368 - 7376. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Mattner, A. Wandersee-Steinhauser, A. Pahl, M. Rollinghoff, G. R. Majeau, P. S. Hochman, and C. Bogdan Protection against Progressive Leishmaniasis by IFN-{beta} J. Immunol., June 15, 2004; 172(12): 7574 - 7582. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Suzui, T. Kawai, H. Kimura, K. Takeda, H. Yagita, K. Okumura, P. N. Shek, and R. J. Shephard Natural killer cell lytic activity and CD56dim and CD56bright cell distributions during and after intensive training J Appl Physiol, June 1, 2004; 96(6): 2167 - 2173. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kono, H. Fujii, M. Asakawa, A. Maki, H. Amemiya, Y. Hirai, M. Matsuda, and M. Yamamoto Medium-chain triglycerides enhance secretory IgA expression in rat intestine after administration of endotoxin Am J Physiol Gastrointest Liver Physiol, June 1, 2004; 286(6): G1081 - G1089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Papadakis, J. L. Prehn, C. Landers, Q. Han, X. Luo, S. C. Cha, P. Wei, and S. R. Targan TL1A Synergizes with IL-12 and IL-18 to Enhance IFN-{gamma} Production in Human T Cells and NK Cells J. Immunol., June 1, 2004; 172(11): 7002 - 7007. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Muhlen, J. Schumann, F. Wittke, S. Stenger, N. van Rooijen, L. van Kaer, and G. Tiegs NK Cells, but Not NKT Cells, Are Involved in Pseudomonas aeruginosa Exotoxin A-Induced Hepatotoxicity in Mice J. Immunol., March 1, 2004; 172(5): 3034 - 3041. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Kono, M. Asakawa, H. Fujii, A. Maki, H. Amemiya, M. Yamamoto, M. Matsuda, and Y. Matsumoto Edaravone, a Novel Free Radical Scavenger, Prevents Liver Injury and Mortality in Rats Administered Endotoxin J. Pharmacol. Exp. Ther., October 1, 2003; 307(1): 74 - 82. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. C. Reading and G. L. Smith Vaccinia Virus Interleukin-18-Binding Protein Promotes Virulence by Reducing Gamma Interferon Production and Natural Killer and T-Cell Activity J. Virol., September 15, 2003; 77(18): 9960 - 9968. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. N. Baxevanis, A. D. Gritzapis, and M. Papamichail In Vivo Antitumor Activity of NKT Cells Activated by the Combination of IL-12 and IL-18 J. Immunol., September 15, 2003; 171(6): 2953 - 2959. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J.H. Zhang, H. He, A.M. Borzychowski, K. Takeda, S. Akira, and B.A. Croy Analysis of Cytokine Regulators Inducing Interferon Production by Mouse Uterine Natural Killer Cells Biol Reprod, August 1, 2003; 69(2): 404 - 411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. M. Orengo, E. Di Carlo, A. Comes, M. Fabbi, T. Piazza, M. Cilli, P. Musiani, and S. Ferrini Tumor Cells Engineered with IL-12 and IL-15 Genes Induce Protective Antibody Responses in Nude Mice J. Immunol., July 15, 2003; 171(2): 569 - 575. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Pridgeon, G. P. Lennon, L. Pazmany, R. N. Thompson, S. E. Christmas, and R. J. Moots Natural killer cells in the synovial fluid of rheumatoid arthritis patients exhibit a CD56bright,CD94bright,CD158negative phenotype Rheumatology, July 1, 2003; 42(7): 870 - 878. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. P. Kalberer, U. Siegler, and A. Wodnar-Filipowicz Human NK cell development in NOD/SCID mice receiving grafts of cord blood CD34+ cells Blood, July 1, 2003; 102(1): 127 - 135. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Strengell, S. Matikainen, J. Siren, A. Lehtonen, D. Foster, I. Julkunen, and T. Sareneva IL-21 in Synergy with IL-15 or IL-18 Enhances IFN-{gamma} Production in Human NK and T Cells J. Immunol., June 1, 2003; 170(11): 5464 - 5469. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Schroder, C. Meisel, K. Buhl, N. Profanter, N. Sievert, H.-D. Volk, and G. Grutz Different Modes of IL-10 and TGF-{beta} to Inhibit Cytokine-Dependent IFN-{gamma} Production: Consequences for Reversal of Lipopolysaccharide Desensitization J. Immunol., May 15, 2003; 170(10): 5260 - 5267. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. G. Chiorean, S. J. Dylla, K. Olsen, T. Lenvik, Y. Soignier, and J. S. Miller BCR/ABL alters the function of NK cells and the acquisition of killer immunoglobulin-like receptors (KIRs) Blood, May 1, 2003; 101(9): 3527 - 3533. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Fehniger, M. A. Cooper, G. J. Nuovo, M. Cella, F. Facchetti, M. Colonna, and M. A. Caligiuri CD56bright natural killer cells are present in human lymph nodes and are activated by T cell-derived IL-2: a potential new link between adaptive and innate immunity Blood, April 15, 2003; 101(8): 3052 - 3057. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Arase, H. Arase, S. Hirano, T. Yokosuka, D. Sakurai, and T. Saito IgE-Mediated Activation of NK Cells Through Fc{gamma}RIII J. Immunol., March 15, 2003; 170(6): 3054 - 3058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Schumann, K. Muhlen, A. K. Kiemer, A. M. Vollmar, and G. Tiegs Parenchymal, But Not Leukocyte, TNF Receptor 2 Mediates T Cell-Dependent Hepatitis in Mice J. Immunol., February 15, 2003; 170(4): 2129 - 2137. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. M. Schneider, I. Lorenz, M. Muller-Rosenberger, G. Steinbach, M. Kron, and G. E. Janka-Schaub Hemophagocytic lymphohistiocytosis is associated with deficiencies of cellular cytolysis but normal expression of transcripts relevant to killer-cell-induced apoptosis Blood, September 26, 2002; 100(8): 2891 - 2898. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Artavanis-Tsakonas and E. M. Riley Innate Immune Response to Malaria: Rapid Induction of IFN-{gamma} from Human NK Cells by Live Plasmodium falciparum-Infected Erythrocytes J. Immunol., September 15, 2002; 169(6): 2956 - 2963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. S. Farag, S. L. George, E. J. Lee, M. Baer, R. K. Dodge, B. Becknell, T. Fehniger, L. R. Silverman, J. Crawford, C. D. Bloomfield, et al. Postremission Therapy with Low-dose Interleukin 2 with or without Intermediate Pulse Dose Interleukin 2 Therapy Is Well Tolerated in Elderly Patients with Acute Myeloid Leukemia: Cancer and Leukemia Group B Study 9420 Clin. Cancer Res., September 1, 2002; 8(9): 2812 - 2819. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Haller, P. Serrant, D. Granato, E. J. Schiffrin, and S. Blum Activation of Human NK Cells by Staphylococci and Lactobacilli Requires Cell Contact-Dependent Costimulation by Autologous Monocytes Clin. Vaccine Immunol., May 1, 2002; 9(3): 649 - 657. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. G. Dorner, A. Scheffold, M. S. Rolph, M. B. Huser, S. H. E. Kaufmann, A. Radbruch, I. E. A. Flesch, and R. A. Kroczek MIP-1alpha , MIP-1beta , RANTES, and ATAC/lymphotactin function together with IFN-gamma as type 1 cytokines PNAS, April 30, 2002; 99(9): 6181 - 6186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Hoontrakoon, H. W. Chu, S. J. Gardai, S. E. Wenzel, P. McDonald, V. A. Fadok, P. M. Henson, and D. L. Bratton Interleukin-15 Inhibits Spontaneous Apoptosis in Human Eosinophils via Autocrine Production of Granulocyte Macrophage-Colony Stimulating Factor and Nuclear Factor-kappa B Activation Am. J. Respir. Cell Mol. Biol., April 1, 2002; 26(4): 404 - 412. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Vankayalapati, B. Wizel, S. E. Weis, H. Safi, D. L. Lakey, O. Mandelboim, B. Samten, A. Porgador, and P. F. Barnes The NKp46 Receptor Contributes to NK Cell Lysis of Mononuclear Phagocytes Infected with an Intracellular Bacterium J. Immunol., April 1, 2002; 168(7): 3451 - 3457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. J. Robertson Role of chemokines in the biology of natural killer cells J. Leukoc. Biol., February 1, 2002; 71(2): 173 - 183. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. R. Blanca, E. W. Bere, H. A. Young, and J. R. Ortaldo Human B Cell Activation by Autologous NK Cells Is Regulated by CD40-CD40 Ligand Interaction: Role of Memory B Cells and CD5+ B Cells J. Immunol., December 1, 2001; 167(11): 6132 - 6139. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Faggioni, R. C. Cattley, J. Guo, S. Flores, H. Brown, M. Qi, S. Yin, D. Hill, S. Scully, C. Chen, et al. IL-18-Binding Protein Protects Against Lipopolysaccharide- Induced Lethality and Prevents the Development of Fas/Fas Ligand-Mediated Models of Liver Disease in Mice J. Immunol., November 15, 2001; 167(10): 5913 - 5920. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. A. Reche, V. Soumelis, D. M. Gorman, T. Clifford, M.-r. Liu, M. Travis, S. M. Zurawski, J. Johnston, Y.-J. Liu, H. Spits, et al. Human Thymic Stromal Lymphopoietin Preferentially Stimulates Myeloid Cells J. Immunol., July 1, 2001; 167(1): 336 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. H. Tong, Y. Chen, M. James, J. Van Deusen, D. B. Welling, and T. F. DeMaria Expression of Cytokine and Chemokine Genes by Human Middle Ear Epithelial Cells Induced by Formalin-Killed Haemophilus influenzae or Its Lipooligosaccharide htrB and rfaD Mutants Infect. Immun., June 1, 2001; 69(6): 3678 - 3684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. Vankayalapati, B. Wizel, D. L. Lakey, Y. Zhang, K. A. Coffee, D. E. Griffith, and P. F. Barnes T Cells Enhance Production of IL-18 by Monocytes in Response to an Intracellular Pathogen J. Immunol., June 1, 2001; 166(11): 6749 - 6753. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. A. Cooper, T. A. Fehniger, S. C. Turner, K. S. Chen, B. A. Ghaheri, T. Ghayur, W. E. Carson, and M. A. Caligiuri Human natural killer cells: a unique innate immunoregulatory role for the CD56bright subset Blood, May 15, 2001; 97(10): 3146 - 3151. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. J. Horwood, J. Elliott, T. J. Martin, and M. T. Gillespie IL-12 Alone and in Synergy with IL-18 Inhibits Osteoclast Formation In Vitro J. Immunol., April 15, 2001; 166(8): 4915 - 4921. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Suzuki, H. Nakazato, H. Matsui, M. Hasumi, Y. Shibata, K. Ito, Y. Fukabori, K. Kurokawa, and H. Yamanaka NK cell-mediated anti-tumor immune response to human prostate cancer cell, PC-3: immunogene therapy using a highly secretable form of interleukin-15 gene transfer J. Leukoc. Biol., April 1, 2001; 69(4): 531 - 537. [Abstract] [Full Text]
|
|
|
|
|
|
T. A. Fehniger, K. Suzuki, A. Ponnappan, J. B. VanDeusen, M. A. Cooper, S. M. Florea, A. G. Freud, M. L. Robinson, J. Durbin, and M. A. Caligiuri Fatal Leukemia in Interleukin 15 Transgenic Mice Follows Early Expansions in Natural Killer and Memory Phenotype CD8+ T Cells J. Exp. Med., January 16, 2001; 193(2): 219 - 232. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Lertmemongkolchai, G. Cai, C. A. Hunter, and G. J. Bancroft Bystander Activation of CD8+ T Cells Contributes to the Rapid Production of IFN-{{gamma}} in Response to Bacterial Pathogens J. Immunol., January 15, 2001; 166(2): 1097 - 1105. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Hyun Kim, L. L. Reznikov, R. J. L. Stuyt, C. H. Selzman, G. Fantuzzi, T. Hoshino, H. A. Young, and C. A. Dinarello Functional Reconstitution and Regulation of IL-18 Activity by the IL-18R{beta} Chain J. Immunol., January 1, 2001; 166(1): 148 - 154. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Fehniger and M. A. Caligiuri Interleukin 15: biology and relevance to human disease Blood, January 1, 2001; 97(1): 14 - 32. [Full Text] [PDF]
|
|
|
|
 |
|
 G. S. Deepe Jr. and R. Gibbons Recombinant Murine Granulocyte-Macrophage Colony-Stimulating Factor Modulates the Course of Pulmonary Histoplasmosis in Immunocompetent and Immunodeficient Mice Antimicrob. Agents Chemother., December 1, 2000; 44(12): 3328 - 3336. [Abstract] [Full Text]
|
|
|
|
|
|
G. Cai, R. Kastelein, and C. A. Hunter Interleukin-18 (IL-18) Enhances Innate IL-12-Mediated Resistance to Toxoplasma gondii Infect. Immun., December 1, 2000; 68(12): 6932 - 6938. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C K Wong, C. Y Ho, E. Li, and C. Lam Elevation of proinflammatory cytokine (IL-18, IL-17, IL-12) and Th2 cytokine (IL-4) concentrations in patients with systemic lupus erythematosus Lupus, October 1, 2000; 9(8): 589 - 593. [Abstract] [PDF]
|
|
|
|
|
|
S. Goodbourn, L. Didcock, and R. E. Randall Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures J. Gen. Virol., October 1, 2000; 81(10): 2341 - 2364. [Full Text]
|
|
|
|
|
|
C. K. Wong, E. K. Li, C. Y. Ho, and C. W. K. Lam Elevation of plasma interleukin-18 concentration is correlated with disease activity in systemic lupus erythematosus Rheumatology, October 1, 2000; 39(10): 1078 - 1081. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. Di Carlo, A. Comes, S. Basso, A. De Ambrosis, R. Meazza, P. Musiani, K. Moelling, A. Albini, and S. Ferrini The Combined Action of IL-15 and IL-12 Gene Transfer Can Induce Tumor Cell Rejection Without T and NK Cell Involvement J. Immunol., September 15, 2000; 165(6): 3111 - 3118. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
B. R. Lauwerys, N. Garot, J.-C. Renauld, and F. A. Houssiau Cytokine Production and Killer Activity of NK/T-NK Cells Derived with IL-2, IL-15, or the Combination of IL-12 and IL-18 J. Immunol., August 15, 2000; 165(4): 1847 - 1853. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. E. Carson, J. E. Dierksheide, S. Jabbour, M. Anghelina, P. Bouchard, G. Ku, H. Yu, H. Baumann, M. H. Shah, M. A. Cooper, et al. Coadministration of interleukin-18 and interleukin-12 induces a fatal inflammatory response in mice: critical role of natural killer cell interferon-gamma production and STAT-mediated signal transduction Blood, August 15, 2000; 96(4): 1465 - 1473. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Lohoff, G. S. Duncan, D. Ferrick, H.-W. Mittrucker, S. Bischof, S. Prechtl, M. Rollinghoff, E. Schmitt, A. Pahl, and T. W. Mak Deficiency in the Transcription Factor Interferon Regulatory Factor (IRF)-2 Leads to Severely Compromised Development of Natural Killer and T Helper Type 1 Cells J. Exp. Med., July 31, 2000; 192(3): 325 - 336. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Hochholzer, G. B. Lipford, H. Wagner, K. Pfeffer, and K. Heeg Role of Interleukin-18 (IL-18) during Lethal Shock: Decreased Lipopolysaccharide Sensitivity but Normal Superantigen Reaction in IL-18-Deficient Mice Infect. Immun., June 1, 2000; 68(6): 3502 - 3508. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. A. Fehniger, H. Yu, M. A. Cooper, K. Suzuki, M. H. Shah, and M. A. Caligiuri Cutting Edge: IL-15 Costimulates the Generalized Shwartzman Reaction and Innate Immune IFN-{gamma} Production In Vivo J. Immunol., February 15, 2000; 164(4): 1643 - 1647. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
