|
|
||||||||





*
Rheumatology, Immunology, and Genetics Program, Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan; and
Division of Allergology and Rheumatology, Department of Medicine, University of Tokyo, Tokyo, Japan;
Department of Immunology, Juntendo University School of Medicine, Juntendo, Japan; and
§
Department of Allergy and Immunology, National Childrens Medical Research Center, Tokyo, Japan
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
T cells require at least two distinct signals for full activation: one is through TCR, and the other is through costimulatory molecules. TCR signal transduction without the costimulatory signals does not activate T cells but, rather, induces anergy (15). The best characterized costimulatory signaling systems are CD28 and CTLA-4 on T cells and their ligands, B7-1, and B7-2 on APCs (16, 17). CD28 gives a positive signal for T cell activation, but the signal through CTLA-4 remains controversial. Early studies suggested that CTLA-4 delivers a synergistic signal with CD28 (18). However, recent studies using anti-CTLA-4 Abs and CTLA-4-deficient mice have demonstrated that CTLA-4 is a negative regulator of T cell activation (19, 20, 21, 22). Furthermore, CTLA-4 has been reported to be involved in immune disorders as follows. First, in vivo administration of anti-CTLA-4 Abs exacerbated the severity of experimental autoimmune encephalomyelitis in murine models (23, 24, 25). Second, lymphocyte infiltration into various organs of CTLA-4-deficient mice, is similar to that seen in autoimmune mice (21, 22). Third, a skewed CTLA-4 gene polymorphism has been reported in patients with Graves disease (26, 27) and autoimmune diabetes mellitus (27).
In this study we prepared four recombinant proteins of CTLA-4, CD28, B7-1, and B7-2 and investigated the presence of autoantibodies to these molecules in the sera of patients with various autoimmune disorders. Anti-CTLA-4 Abs were detected frequently. In contrast, Abs to the remaining three molecules were rare. In addition, we investigated the epitope regions on the CTLA-4 molecule and the actual binding of purified anti-CTLA-4 Abs to native CTLA-4 expressed on mammalian cells.
| Materials and Methods |
|---|
|
|
|---|
Serum samples were obtained from a total of 162 patients with systemic autoimmune diseases (138 women and 24 men; mean age, 50.2 yr; age range, 2079 yr). They included 49 patients with SLE (46 women and 3 men; mean age, 42.3 yr; age range, 2072 yr), 48 patients with rheumatoid arthritis (RA; 39 women and 9 men; mean age, 56.1 yr; age range, 2279 yr), 32 patients with systemic sclerosis (SSc; 28 women and 4 men; mean age, 52.2 yr; age range, 2971 yr), 22 patients with Behçets disease (14 women and 8 men; mean age, 50.9 yr; age range 2478 yr), and 15 patients with Sjögrens syndrome (Sjs; 15 women; mean age, 49.4 yr; age range, 3266 yr). Four patients with both RA and Sjs were included in the respective groups. The diseases were diagnosed according to the standard criteria of each disease (28, 29, 30, 31, 32). Control serum samples were obtained from 82 healthy donors (68 women and 14 men; mean age, 49.5 yr; age range, 2282 yr). The patients were being treated at the hospital of the University of Tokyo or the hospital of St. Marianna University School of Medicine.
Preparation of CTLA-4, CD28, B7-1, and B7-2 cDNA
Based on the previously reported nucleotide sequences of human
CTLA-4 (33), CD28 (34), B7-1 (35), and B7-2 (36, 37), four sets of
oligo-DNA primers were synthesized (Table I
), and PCR
was performed. Each primer pair was used to amplify the DNA fragments
that encode the full protein-coding region of CTLA-4, CD28, B7-1, and
B7-2. All the PCR products were confirmed by sequencing.
|
The cDNA fragments that encode CTLA-4 (672 bp) and B7-2 (972 bp) were each subcloned into pTEX7 (38), a derivative of the previously reported plasmid expression vector pEX2 (39). In this expression system, the proteins are expressed as ß-galactosidase fusion proteins. The cDNA fragments that encode CD28 (663 bp) and B7-1 (867 bp) were each subcloned into pTEX7-His, which is a derivative of the plasmid expression vector pTEX7. With this plasmid, a continuous stretch of six histidines (His)6, which can be used for affinity purification, are expressed between ß-galactosidase and the protein of interest.
Construction of the expression plasmids of three cDNA fragments of CTLA-4
To map the autoepitopes, we prepared three fragments of CTLA-4 (F1, F2, and F3). The pTEX7 with the F1 fragment (pTEX7-cDNAF1) was constructed by removing an EcoT22I/PstI fragment, nucleotides 184672, from the pTEX7 plasmid with the cDNA of CTLA-4 (pTEX7-cDNACTLA-4). Similarly, pTEX7-cDNAF2 was constructed by removing an EcoRI/EcoT22I fragment, nucleotides 1184, and an NcoI/PstI fragment, nucleotides 363672, from pTEX7-cDNACTLA-4. The pTEX7-cDNAF3 was constructed by removing an EcoT22I/NcoI fragment, nucleotides 1363, from pTEX7-cDNACTLA-4.
Expression and purification of the recombinant fusion proteins
Escherichia coli (POP2136) transformed with each of these recombinant pTEX7 plasmids was grown in 2XYT medium overnight at 30°C, after which the temperature was increased to 42°C. Incubation for 2 h induced a sufficient amount of fusion protein. For purification of the CTLA-4 and B7-2 proteins, bacteria were harvested from 100-ml cultures by centrifugation, lysed in 4 ml of a lysozyme solution (1 mg/ml lysozyme, 8% sucrose, 5% Triton X-100, 50 mM EDTA, and 50 mM Tris-HCl, pH 8.0), and then sonicated to fragment the bacterial DNA. After centrifugation, the pellets were suspended in 4 ml of a DNase buffer (5 µg/ml of DNase I, 150 mM NaCl, 10 mM MnCl2, and 50 mM Tris-HCl, pH 7.6) for 2 h at 37°C and subjected to another sonication. After a second centrifugation, the pellets were washed twice with a solution containing 0.5% Triton X-100, 10 mM EDTA, 50 mM NaCl, and 50 mM Tris-HCl, pH 7.6. The pellets were then solubilized in 1 ml of 8 M urea.
To purify the recombinant CD28 and B7-1 proteins, the bacteria in which the recombinant proteins were induced, were lysed in 6 M guanidium buffer and sonicated. After centrifugation, the lysate was applied to a column charged with ProBond resin (NiCl2; Invitrogen, San Diego, CA) in a binding buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 7.8). The column was then developed in buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 6.0 and pH 5.3). The (His)6-tagged recombinant proteins were eluted with an elution buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 4.0).
The concentration of fusion proteins was determined from absorbances at 280 and 260 nm, which was corrected for background activity at 320 nm using appropriately diluted samples.
ELISA
Each well of a multititer plate (Cook, Dynatech, Alexandria, VA)
was coated with 10 µg/ml of the individual purified fusion protein or
ß-galactosidase (as a background) in a carbonate buffer (50 mM sodium
carbonate, pH 9.6), followed by blocking with PBS containing 3% BSA
and 0.1% Tween 20. To adsorb the reactivity of the serum samples to
bacterial proteins and ß-galactosidase, the serum samples were
diluted and incubated with 20 µg/ml of bacterial lysate containing
nonrecombinant pTEX7 product in PBS containing 3% BSA and 0.1%
Tween-20 for 2 h at room temperature before incubation with the
coated recombinants. The serum dilution that exhibited the highest
specific binding was determined to be 1/700 for CTLA-4 and B7-2 and
1/2000 for CD28 and B7-1. After reacting with the coated recombinants
for 2 h, the wells were washed 10 times in PBS with 0.1%
Tween-20. Next, the bound Abs were incubated with horseradish
peroxidase-conjugated goat anti-human IgG (specific for
-chain;
Zymed, San Francisco, CA) at a 1/4000 dilution for 8 h at 4°C,
then reacted with o-phenylenediamine as a substrate, and
quantitated using a microplate photometer at 492 nm.
In the screening of autoantibodies to CTLA-4, CD28, B7-1, and B7-2, serum samples from 162 patients with systemic autoimmune disease and 82 sex- and age-matched healthy donors (68 women and 14 men; mean age, 49.5 yr; age range, 2282 yr) were prepared. In the screening of autoantibodies to CTLA-4 in the respective diseases, serum samples from 40 of the healthy donors (38 women and 2 men; mean age, 43.0 yr; age range, 2666 yr) for SLE, from 40 of the healthy donors (32 women and 8 men; mean age, 55.9 yr; range, 2882 yr) for RA, from 40 of the healthy donors (35 women and 5 men; mean age, 52.2 yr; age rangie, 3171 yr) for SSc, from 40 of the healthy donors (26 women and 14 men; mean age, 49.5 yr; age range, 2273 yr) for Behçets disease, and from 40 of the healthy donors (40 women; mean age, 49.8 yr; age range, 3073 yr) for Sjs were prepared.
The reactivity to the fusion protein in ELISA was expressed in units according to the formula: sample (binding unit) = [ODsample*/(mean ODsample* + 3 SD of normal sera)] x 100. For each sample, the OD value of ß-galactosidase was subtracted from the OD value of the fusion protein to obtain ODsample*. According to this formula, 100 binding units is the cutoff point.
Immunoblotting
Immunoblotting was performed as previously described (40). Briefly, 5 µg of each purified fusion protein or ß-galactosidase (as a control), separated by 8% SDS-PAGE, was transferred onto nitrocellulose membranes. After blocking with PBS containing 3% BSA and 0.1% Tween 20 for 1 h and washing in PBS with 0.1% Tween-20 for 30 min, each membrane was then incubated with the respective protein-specific Ab (goat anti-human CTLA-4 Ab, goat anti-human CD28 Ab, goat anti-human B7-1 Ab, or goat anti-human B7-2 Ab; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-ß-galactosidase Ab (Chemicon, Temecula, CA), or serum samples diluted adequately in PBS containing 3% BSA and 0.1% Tween-20 for 1 h. In the case of the serum samples, they were diluted at 1/500 and preincubated with 20 µg/ml of the bacterial lysate containing nonrecombinant pTEX7 product for 2 h at room temperature before incubation with the membranes. After three washings in PBS with 0.1% Tween 20, the bound Abs were reacted with horseradish peroxidase-conjugated rabbit anti-goat IgG (American Qualex, San Clemente, CA), goat anti-rabbit IgG (Medical & Biological Laboratories, Nagoya, Japan), or goat anti-human IgG (Zymed) diluted 1/5000 for 30 min. Finally, the bound Abs were visualized with diaminobenzidine.
Affinity purification of autoantibodies to fusion proteins
Adsorption and affinity purification were performed essentially according to the method of Olmsted (41). The partially purified recombinant proteins were separated by SDS-PAGE, then transferred onto nitrocellulose membranes. Next, the recombinant protein bands, visualized with a Ponceau S solution (Sigma, St. Louis, MO), were cut out and used for affinity purification. Each serum sample that had been preincubated with bacterial lysate containing nonrecombinant pTEX7 product for 2 h was diluted in PBS containing 3% BSA and 0.1% Tween 20 (1/500 dilution) and incubated for 2 h with the proteins fixed on the nitrocellulose membrane, after which the membrane was recovered. The bound Abs were eluted with 4 ml of 0.2 M glycine HCl buffer, pH 2.5, containing 0.15 M NaCl and 3% BSA, followed by neutralization with 600 µl of 2 M Tris base.
Establishment of stable transfectant
Human CTLA-4 cDNA was obtained from anti-CD3-activated PBMC by PCR using the sense primer (GATCCTCGAGATGGCTTGCCTTGGATTTCA) and the antisense primer (GATCGCGGCCGCTCAATTGATGGGAATAAA), where the recognition sites for the restriction enzymes used are underlined. The cDNA was cloned into the XhoI- and i-digested BCMGSneo expression vector containing a neomycin-resistant gene (42). Transfection of murine mastocytoma P815 cells was achieved by electroporation as described by Azuma et al. (43). The drug-resistant cells were harvested and cloned, and cells with the highest cell surface expression of CTLA-4 were selected by flow cytometry.
Indirect immunofluorescence and flow cytometry
Binding of the purified anti-CTLA-4 Abs to native CTLA-4 was detected by indirect immunofluorescence. To block the binding of Igs to mouse Fc receptors, the P815 cells and the CTLA-4-transfected P815 cells were preincubated with mouse serum diluted 1/10 for 1 h at 4°C. After washing the cells in a staining buffer (PBS containing 2% BSA), the cells were suspended in the staining buffer and reacted with Abs purified from the patients sera or anti-CTLA-4 mAb (Biostride, Palo Alto, CA) for 30 min on ice. After washing in the staining buffer, the cells were incubated with phycoerythrin-conjugated goat anti-human IgG (Southern Biotechnology Associates, Birmingham, AL) or phycoerythrin-conjugated rabbit anti-mouse Ig (Southern Biotechnology Associates), respectively, for 30 min on ice. The fluorescence intensity was measured by FACSCalibur (Becton Dickinson, Mountain View, CA).
Statistical analysis
Laboratory data are expressed as the mean ± SEM. The Mann-Whitney U test was used to examine differences in the clinical parameters of patients with or without anti-CTLA-4 Ab. Fishers exact test was used to examine the correlation between clinical features of the patients and the presence of anti-CTLA-4 Ab.
| Results |
|---|
|
|
|---|
DNA fragments encoding each of the human CTLA-4, CD28, B7-1, and
B7-2 molecules were obtained by PCR from cDNA of a healthy donor PBL
and then expressed as a ß-galactosidase fusion protein. Thus, we
obtained sufficient amounts of each fusion protein that had the
expected m.w. (Fig. 1
). We first confirmed the
antigenicity of each of these recombinant proteins by immunoblotting
using the respective protein-specific Abs. As shown in Fig. 1
, the
recombinant CTLA-4, B7-1, and B7-2 proteins were each stained as a
clear band. In the case of CD28, staining with its specific Ab produced
two major bands. Since the upper band had the expected m.w., the lower
band was thought to be a degraded product of the full-length CD28
fusion protein. In addition, since approximately half the purified
recombinant CD28 was the full-length CD28 fusion protein, the protein
was thought to be of sufficient quality for detecting autoantibodies in
ELISA.
|
The recombinant CTLA-4, CD28, B7-1, and B7-2 proteins were
used to detect the presence of the respective autoantibodies in the
sera of patients with various systemic autoimmune diseases by ELISA. As
shown in Fig. 2
, IgG-type anti-CTLA-4 Ab was
detected in the sera of 21 of the 162 patients (13.0%); however, the
sera of only three patients were positive for anti-B7-2 Ab, and no
patient was positive for anti-CD28 or for anti-B7-1 Ab.
Autoantibodies to each of the four molecules were not detected in the
sera of any of the healthy donors. In addition, the presence of
IgM-type anti-CTLA-4 Ab was determined in a similar way and was
detected in the sera of only three patients (data not shown).
|
|
|
Our findings showed that a considerable percentage of the tested autoimmune disease sera contained anti-CTLA-4 Abs. However, the recombinant CTLA-4 produced in E. coli and solubilized in 8 M urea is denatured, and thus would not be expected to have the native conformation.
Therefore, we further investigated whether the anti-CTLA-4
autoantibodies in the patients could bind to the native form of CTLA-4
molecules. Specifically, we purified the Abs bound to the recombinant
CTLA-4 and then examined whether these Abs bind to CTLA-4 molecules
expressed on mammalian cells (P815) by immunofluorescent staining
followed by FACS analysis. The purified anti-CTLA-4 fusion protein
Ab was able to bind to the TLA-4-transfected P815 cells, but not to
P815 cells. A representative case is shown in Fig. 5
.
These data provide direct evidence that the anti-CTLA-4
autoantibodies of patients react with the native form of the CTLA-4
molecules expressed on the mammalian cell surface.
|
To map the autoepitopes on the CTLA-4 protein, three pTEX7
plasmids with cDNA fragments F1, F2, and F3 (pTEX7-cDNAF1,
pTEX7-cDNAF2, and pTEX7-cDNAF3) were
constructed (Fig. 6
A). We obtained the
respective proteins shown in Fig. 6
B.
|
|
|
Since anti-CTLA-4 Abs were detected most frequently in the
sera of patients with Behçets disease, we compared the
laboratory data and the clinical features, including past history of
the anti-CTLA-4 Ab-positive and -negative Behçets disease
patients. There was no significant difference in the laboratory data
(erythrocyte sedimentation rate, peripheral lymphocyte count, and serum
levels of IgG, IgA, and IgM) of the two groups of Behçets
disease patients (Table III
). Similarly, most of the
clinical features of the two groups did not differ significantly.
However, uveitis was detected in 13 of the 15 (86.7%) Ab-negative
patients, but in only two of the seven (28.6%) Ab-positive patients,
and this difference is statistically significant (Table IV
).
|
|
| Discussion |
|---|
|
|
|---|
In our study, anti-CTLA-4 Abs were detected more frequently among patients with Behçets disease and RA than among those with SLE. This was unexpected, since ALAs are detected in a higher percentage of patients with SLE than in patients with Behçets disease and RA (2). This may be because CTLA-4 is a minor target of ALA (discussed below), and thus the prevalence of anti-CTLA-4 Ab would be different from the prevalence of total ALA previously reported (2). Alternatively, the discrepancy may be related to the detection method. The standard method for detection of ALAs is the microcytotoxicity test, in which the presence of ALA-mediated complement cytolysis is tested using PBL of healthy donors. This method may miss the ALAs to Ags that are temporarily expressed or induced by activation, such as CTLA-4. Thus, ALA detection using recombinant proteins may produce different results from those obtained by the conventional method. Screening of a larger number of serum samples than that reported here would be needed to resolve this issue.
The laboratory data and clinical features of patients did not correlate
with the presence or the absence of anti-CTLA-4 Ab among patients
with Behçets disease (Table II
), those with RA, and those with
SLE (data not shown). Previous reports indicated that the presence of
ALAs correlates with lymphopenia (4); however, our data showed that the
presence of anti-CTLA-4 Ab did not correlate with the lymphocyte
count. As to clinical features, it is interesting that a negative
correlation was found between uveitis and the presence of
anti-CTLA-4 Ab in Behçets disease patients. Although the
pathogenesis of Behçets disease remains unclear, immunological
abnormalities, in particular infiltration of predominantly T
lymphocytes in erythema nodosum like-lesions (44), oral ulcers (44),
terminal ileum (45), and ocular lesions (46), have been reported. Thus,
T cells play a role in the affected lesions. In this regard, the
anti-CTLA-4 Ab detected in the Behçets disease patients may
act to suppress the proliferation of uveitis-driving T cells. Decreased
function of suppressor T cells and subsequent increased B cell function
have been implicated in Behçets disease, and Sakane et al.
suggested that ALAs might be responsible for the loss of suppressor T
cell function (47). From this viewpoint, anti-CTLA-4 Abs may
suppress the function of such suppressor T cells and dysregulate B cell
function. In all patients with uveitis in our study, the uveitis was
inactive at the time their serum samples were obtained. Therefore,
further studies comparing disease activity with the titer of
anti-CTLA-4 Ab may give us some clues to understanding the role of
anti-CTLA-4 Ab in vivo. In RA, Verwilghen et al. reported that
anti-CTLA-4 mAb had an inhibitory effect on the mixed lymphocyte
cytotoxicity test when synovial fluid T cells from RA patients were
used as stimulatory cells (48). These findings suggest that
anti-CTLA-4 Ab in RA acts to suppress arthritis-driving T cell
function, similar to its role in suppressing uveitis in Behçets
disease.
Epitope mapping using three recombinant CTLA-4 fragments revealed that the CTLA-4 molecule contains at least three epitopes recognized by the IgG type of the anti-CTLA-4 Ab. Most of the anti-CTLA-4 Ab-positive sera reacted to more than one CTLA-4 fragment. This result indicates that the production of autoantibodies to CTLA-4 is induced by an Ag-driven mechanism, which is the main mode of production of many antinuclear Abs (49, 50). In addition, this diversity of anti-CTLA-4 Abs may indicate the existence of several kinds of anti-CTLA-4 Abs with different functions.
Among the four T cell costimulatory molecules tested, autoantibodies to CTLA-4 were frequently detected in patients with autoimmune disease, but autoantibodies to CD28, B7-1, and B7-2 were rare. In particular, CD28 shares 31% amino acid identity with CTLA-4 (51), but anti-CD28 Ab was not detected in any of the patients. This fact suggests the existence of a CTLA-4-specific immune response among the four costimulatory molecules tested in this study. This may be related to the difference in the manner in which the molecules are expressed, i.e., activation-induced or constitutive expression. Further studies are needed to elucidate this mechanism.
To screen autoantibodies to the costimulatory molecules, we used proteins produced in bacteria. Therefore, autoantibodies to the natural form of the molecules could have been missed. To detect such kinds of Abs, transfectants can be useful. We tried to detect anti-CTLA-4 Abs with the CTLA-4-transfected P815 cells using whole sera instead of purified anti-CTLA-4 Abs from patients. However, this was not effective, since a considerable number of serum samples strongly reacted to the transfectants and also to the control P815 cells (data not shown). It is possible that other kinds of autoantibodies in the sera cross-reacted with the surface molecules of the P815 cells. Thus, the transfectants were useful in determining whether an Ab specifically purified from sera could react to the natural form of the molecule, but was inadequate for screening of ALA using whole sera.
Several studies in mice and humans have indicated that a lack or modification of negative signals through CTLA-4 is implicated in autoimmune diseases (21, 22, 23, 24, 25, 26, 27). In addition, CTLA-4 was reported to be essential for peripheral tolerance of CD4+ T cells (52). From these findings, it is very likely that CTLA-4 is involved in the pathogenesis or abnormal immune responses in autoimmune diseases. The autoantibodies to CTLA-4 demonstrated here may modulate the immune response in patients with autoimmune disease.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Tomohiro Kato, Rheumatology, Immunology, and Genetics Program, Institute of Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-0015, Japan. E-mail address: ![]()
3 Abbreviations used in this paper: ALA, anti-lymphocyte antibodies; SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; SSc, systemic sclerosis; Sjs, Sjögrens syndrome. ![]()
Received for publication July 20, 1998. Accepted for publication December 21, 1998.
| References |
|---|
|
|
|---|
This article has been cited by other articles:
![]() |
W. Stohl, N. Jacob, W. J. Quinn III, M. P. Cancro, H. Gao, C. Putterman, X. Gao, L. Pricop, and M. N. Koss Global T Cell Dysregulation in Non-Autoimmune-Prone Mice Promotes Rapid Development of BAFF-Independent, Systemic Lupus Erythematosus-Like Autoimmunity J. Immunol., July 1, 2008; 181(1): 833 - 841. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Wan, H. Nie, A. Liu, G. Feng, D. He, R. Xu, Q. Zhang, C. Dong, and J. Z. Zhang Aberrant Regulation of Synovial T Cell Activation by Soluble Costimulatory Molecules in Rheumatoid Arthritis J. Immunol., December 15, 2006; 177(12): 8844 - 8850. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Xiang, T. Sekine, H. Nakamura, S. Imajoh-Ohmi, H. Fukuda, K. Yudoh, K. Masuko-Hongo, K. Nishioka, and T. Kato Fibulin-4 is a target of autoimmunity predominantly in patients with osteoarthritis. J. Immunol., March 1, 2006; 176(5): 3196 - 3204. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z Yao, H Nakamura, K Masuko-Hongo, M Suzuki-Kurokawa, K Nishioka, and T Kato Characterisation of cartilage intermediate layer protein (CILP)-induced arthropathy in mice Ann Rheum Dis, March 1, 2004; 63(3): 252 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Zheng and M. Monestier Inhibitory Signal Override Increases Susceptibility to Mercury-Induced Autoimmunity J. Immunol., August 1, 2003; 171(3): 1596 - 1601. [Abstract] [Full Text] [PDF] |
||||
![]() |
H Direskeneli Behcet's disease: infectious aetiology, new autoantigens, and HLA-B51 Ann Rheum Dis, November 1, 2001; 60(11): 996 - 1002. [Full Text] [PDF] |
||||
![]() |
X. Yu, T. Matsui, M. Otsuka, T. Sekine, K. Yamamoto, K. Nishioka, and T. Kato Anti-CD69 Autoantibodies Cross-React with Low Density Lipoprotein Receptor-Related Protein 2 in Systemic Autoimmune Diseases J. Immunol., January 15, 2001; 166(2): 1360 - 1369. [Abstract] [Full Text] [PDF] |
||||
![]() |
T Sekine, K Masuko-Hongo, T Matsui, H Asahara, M Takigawa, K Nishioka, and T Kato Recognition of YKL-39, a human cartilage related protein, as a target antigen in patients with rheumatoid arthritis Ann Rheum Dis, January 1, 2001; 60(1): 49 - 54. [Abstract] [Full Text] |
||||
![]() |
A. A. Hurwitz, T. J. Sullivan, R. A. Sobel, and J. P. Allison Cytotoxic T lymphocyte antigen-4 (CTLA-4) limits the expansion of encephalitogenic T cells in experimental autoimmune encephalomyelitis (EAE)-resistant BALB/c mice PNAS, March 5, 2002; 99(5): 3013 - 3017. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |