The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     
 


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, T.
Right arrow Articles by Kato, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, T.
Right arrow Articles by Kato, T.
The Journal of Immunology, 1999, 162: 4328-4335.
Copyright © 1999 by The American Association of Immunologists

Autoantibodies to T Cell Costimulatory Molecules in Systemic Autoimmune Diseases1

Toshihiro Matsui*,{dagger}, Manae Kurokawa*, Tetsuji Kobata*,{ddagger}, Shinji Oki§, Miyuki Azuma§, Shigeto Tohma{dagger}, Tetsufumi Inoue{dagger}, Kazuhiko Yamamoto{dagger}, Kusuki Nishioka* and Tomohiro Kato2,*

* Rheumatology, Immunology, and Genetics Program, Institute of Medical Science, St. Marianna University School of Medicine, Kawasaki, Kanagawa, Japan; and {dagger} Division of Allergology and Rheumatology, Department of Medicine, University of Tokyo, Tokyo, Japan; {ddagger} Department of Immunology, Juntendo University School of Medicine, Juntendo, Japan; and § Department of Allergy and Immunology, National Children’s Medical Research Center, Tokyo, Japan


    Abstract
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To determine whether antilymphocyte Abs to T cell costimulatory molecules are generated in patients with autoimmune diseases and, if they exist, to clarify the mechanism of their production and pathological roles, we investigated the presence of autoantibodies to CTLA-4 (CD152), CD28, B7-1 (CD80), and B7-2 (CD86) in serum samples obtained from patients with various autoimmune diseases and from normal subjects using recombinant fusion proteins. In ELISAs, anti-CD28, anti-B7-1, and anti-B7-2 Abs were rarely seen, whereas anti-CTLA-4 Abs were detected in 8.2% of the patients with systemic lupus erythematosus, 18.8% of those with rheumatoid arthritis, 3.1% of those with systemic sclerosis, 31.8% of those with Behçet’s disease, 13.3% of those with Sjögren’s syndrome, and 0% of healthy donors. This reactivity was confirmed by immunoblotting. More importantly, the purified anti-CTLA-4 Abs reacted with CTLA-4 expressed on P815 cells by flow cytometry. In addition, we found at least three epitopes on the CTLA-4 molecule. Furthermore, among the patients with Behçet’s disease, uveitis was seen significantly less frequently in the anti-CTLA-4 Ab-positive patients. Taken collectively, these data indicate that anti-CTLA-4 autoantibodies are generated in systemic autoimmune diseases by an Ag-driven mechanism and may modulate the immune response in vivo by binding to CTLA-4 on T cells.


    Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Autoantibodies to surface molecules on lymphocytes have been described in various immune conditions, such as autoimmune diseases, infections, blood transfusions, and multiple pregnancies (reviewed in Refs. 1 and 2). For instance, the presence of anti-lymphocyte Abs (ALAs)3 has been correlated with disease activity (3), lymphopenia (4), lymphocyte subset distortions (5, 6), and various functional abnormalities of T cells, B cells, and monocytes in systemic lupus erythematosus (SLE) (7, 8, 9, 10). However, the pathogenic roles of ALAs remain unclear mainly because ALAs are usually detected by the microcytotoxicity test (1, 2), which cannot differentiate target molecules. To further clarify the roles of ALAs, it is essential to identify their individual determinants. Only a few targets of ALAs, including CD45 (11, 12), ß2-microglobulin (13), and HLA class I molecules (14), have been described. Other surface molecules may also be targets. Thus, we tried to identify individual targets of ALAs. Specifically, we studied whether ALAs to T cell costimulatory molecules CTLA-4 (CD152), CD28, B7-1 (CD80), and B7-2 (CD86) are generated in autoimmune diseases, since T cells play central roles in the immune response.

T cells require at least two distinct signals for full activation: one is through TCR, and the other is through costimulatory molecules. TCR signal transduction without the costimulatory signals does not activate T cells but, rather, induces anergy (15). The best characterized costimulatory signaling systems are CD28 and CTLA-4 on T cells and their ligands, B7-1, and B7-2 on APCs (16, 17). CD28 gives a positive signal for T cell activation, but the signal through CTLA-4 remains controversial. Early studies suggested that CTLA-4 delivers a synergistic signal with CD28 (18). However, recent studies using anti-CTLA-4 Abs and CTLA-4-deficient mice have demonstrated that CTLA-4 is a negative regulator of T cell activation (19, 20, 21, 22). Furthermore, CTLA-4 has been reported to be involved in immune disorders as follows. First, in vivo administration of anti-CTLA-4 Abs exacerbated the severity of experimental autoimmune encephalomyelitis in murine models (23, 24, 25). Second, lymphocyte infiltration into various organs of CTLA-4-deficient mice, is similar to that seen in autoimmune mice (21, 22). Third, a skewed CTLA-4 gene polymorphism has been reported in patients with Grave’s disease (26, 27) and autoimmune diabetes mellitus (27).

In this study we prepared four recombinant proteins of CTLA-4, CD28, B7-1, and B7-2 and investigated the presence of autoantibodies to these molecules in the sera of patients with various autoimmune disorders. Anti-CTLA-4 Abs were detected frequently. In contrast, Abs to the remaining three molecules were rare. In addition, we investigated the epitope regions on the CTLA-4 molecule and the actual binding of purified anti-CTLA-4 Abs to native CTLA-4 expressed on mammalian cells.


    Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Patients and healthy donors

Serum samples were obtained from a total of 162 patients with systemic autoimmune diseases (138 women and 24 men; mean age, 50.2 yr; age range, 20–79 yr). They included 49 patients with SLE (46 women and 3 men; mean age, 42.3 yr; age range, 20–72 yr), 48 patients with rheumatoid arthritis (RA; 39 women and 9 men; mean age, 56.1 yr; age range, 22–79 yr), 32 patients with systemic sclerosis (SSc; 28 women and 4 men; mean age, 52.2 yr; age range, 29–71 yr), 22 patients with Behçet’s disease (14 women and 8 men; mean age, 50.9 yr; age range 24–78 yr), and 15 patients with Sjögren’s syndrome (Sjs; 15 women; mean age, 49.4 yr; age range, 32–66 yr). Four patients with both RA and Sjs were included in the respective groups. The diseases were diagnosed according to the standard criteria of each disease (28, 29, 30, 31, 32). Control serum samples were obtained from 82 healthy donors (68 women and 14 men; mean age, 49.5 yr; age range, 22–82 yr). The patients were being treated at the hospital of the University of Tokyo or the hospital of St. Marianna University School of Medicine.

Preparation of CTLA-4, CD28, B7-1, and B7-2 cDNA

Based on the previously reported nucleotide sequences of human CTLA-4 (33), CD28 (34), B7-1 (35), and B7-2 (36, 37), four sets of oligo-DNA primers were synthesized (Table IGo), and PCR was performed. Each primer pair was used to amplify the DNA fragments that encode the full protein-coding region of CTLA-4, CD28, B7-1, and B7-2. All the PCR products were confirmed by sequencing.


View this table:
[in this window]
[in a new window]
 
Table I. PCR primers used to amplify the DNA fragments encoding T cell costimulatory molecules

 
Construction of the expression plasmids of CTLA-4, B7-2, CD28, and B7-1

The cDNA fragments that encode CTLA-4 (672 bp) and B7-2 (972 bp) were each subcloned into pTEX7 (38), a derivative of the previously reported plasmid expression vector pEX2 (39). In this expression system, the proteins are expressed as ß-galactosidase fusion proteins. The cDNA fragments that encode CD28 (663 bp) and B7-1 (867 bp) were each subcloned into pTEX7-His, which is a derivative of the plasmid expression vector pTEX7. With this plasmid, a continuous stretch of six histidines (His)6, which can be used for affinity purification, are expressed between ß-galactosidase and the protein of interest.

Construction of the expression plasmids of three cDNA fragments of CTLA-4

To map the autoepitopes, we prepared three fragments of CTLA-4 (F1, F2, and F3). The pTEX7 with the F1 fragment (pTEX7-cDNAF1) was constructed by removing an EcoT22I/PstI fragment, nucleotides 184–672, from the pTEX7 plasmid with the cDNA of CTLA-4 (pTEX7-cDNACTLA-4). Similarly, pTEX7-cDNAF2 was constructed by removing an EcoRI/EcoT22I fragment, nucleotides 1–184, and an NcoI/PstI fragment, nucleotides 363–672, from pTEX7-cDNACTLA-4. The pTEX7-cDNAF3 was constructed by removing an EcoT22I/NcoI fragment, nucleotides 1–363, from pTEX7-cDNACTLA-4.

Expression and purification of the recombinant fusion proteins

Escherichia coli (POP2136) transformed with each of these recombinant pTEX7 plasmids was grown in 2XYT medium overnight at 30°C, after which the temperature was increased to 42°C. Incubation for 2 h induced a sufficient amount of fusion protein. For purification of the CTLA-4 and B7-2 proteins, bacteria were harvested from 100-ml cultures by centrifugation, lysed in 4 ml of a lysozyme solution (1 mg/ml lysozyme, 8% sucrose, 5% Triton X-100, 50 mM EDTA, and 50 mM Tris-HCl, pH 8.0), and then sonicated to fragment the bacterial DNA. After centrifugation, the pellets were suspended in 4 ml of a DNase buffer (5 µg/ml of DNase I, 150 mM NaCl, 10 mM MnCl2, and 50 mM Tris-HCl, pH 7.6) for 2 h at 37°C and subjected to another sonication. After a second centrifugation, the pellets were washed twice with a solution containing 0.5% Triton X-100, 10 mM EDTA, 50 mM NaCl, and 50 mM Tris-HCl, pH 7.6. The pellets were then solubilized in 1 ml of 8 M urea.

To purify the recombinant CD28 and B7-1 proteins, the bacteria in which the recombinant proteins were induced, were lysed in 6 M guanidium buffer and sonicated. After centrifugation, the lysate was applied to a column charged with ProBond resin (NiCl2; Invitrogen, San Diego, CA) in a binding buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 7.8). The column was then developed in buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 6.0 and pH 5.3). The (His)6-tagged recombinant proteins were eluted with an elution buffer (8 M urea, 20 mM sodium phosphate, and 500 mM NaCl, pH 4.0).

The concentration of fusion proteins was determined from absorbances at 280 and 260 nm, which was corrected for background activity at 320 nm using appropriately diluted samples.

ELISA

Each well of a multititer plate (Cook, Dynatech, Alexandria, VA) was coated with 10 µg/ml of the individual purified fusion protein or ß-galactosidase (as a background) in a carbonate buffer (50 mM sodium carbonate, pH 9.6), followed by blocking with PBS containing 3% BSA and 0.1% Tween 20. To adsorb the reactivity of the serum samples to bacterial proteins and ß-galactosidase, the serum samples were diluted and incubated with 20 µg/ml of bacterial lysate containing nonrecombinant pTEX7 product in PBS containing 3% BSA and 0.1% Tween-20 for 2 h at room temperature before incubation with the coated recombinants. The serum dilution that exhibited the highest specific binding was determined to be 1/700 for CTLA-4 and B7-2 and 1/2000 for CD28 and B7-1. After reacting with the coated recombinants for 2 h, the wells were washed 10 times in PBS with 0.1% Tween-20. Next, the bound Abs were incubated with horseradish peroxidase-conjugated goat anti-human IgG (specific for {gamma}-chain; Zymed, San Francisco, CA) at a 1/4000 dilution for 8 h at 4°C, then reacted with o-phenylenediamine as a substrate, and quantitated using a microplate photometer at 492 nm.

In the screening of autoantibodies to CTLA-4, CD28, B7-1, and B7-2, serum samples from 162 patients with systemic autoimmune disease and 82 sex- and age-matched healthy donors (68 women and 14 men; mean age, 49.5 yr; age range, 22–82 yr) were prepared. In the screening of autoantibodies to CTLA-4 in the respective diseases, serum samples from 40 of the healthy donors (38 women and 2 men; mean age, 43.0 yr; age range, 26–66 yr) for SLE, from 40 of the healthy donors (32 women and 8 men; mean age, 55.9 yr; range, 28–82 yr) for RA, from 40 of the healthy donors (35 women and 5 men; mean age, 52.2 yr; age rangie, 31–71 yr) for SSc, from 40 of the healthy donors (26 women and 14 men; mean age, 49.5 yr; age range, 22–73 yr) for Behçet’s disease, and from 40 of the healthy donors (40 women; mean age, 49.8 yr; age range, 30–73 yr) for Sjs were prepared.

The reactivity to the fusion protein in ELISA was expressed in units according to the formula: sample (binding unit) = [ODsample*/(mean ODsample* + 3 SD of normal sera)] x 100. For each sample, the OD value of ß-galactosidase was subtracted from the OD value of the fusion protein to obtain ODsample*. According to this formula, 100 binding units is the cutoff point.

Immunoblotting

Immunoblotting was performed as previously described (40). Briefly, 5 µg of each purified fusion protein or ß-galactosidase (as a control), separated by 8% SDS-PAGE, was transferred onto nitrocellulose membranes. After blocking with PBS containing 3% BSA and 0.1% Tween 20 for 1 h and washing in PBS with 0.1% Tween-20 for 30 min, each membrane was then incubated with the respective protein-specific Ab (goat anti-human CTLA-4 Ab, goat anti-human CD28 Ab, goat anti-human B7-1 Ab, or goat anti-human B7-2 Ab; Santa Cruz Biotechnology, Santa Cruz, CA), rabbit anti-ß-galactosidase Ab (Chemicon, Temecula, CA), or serum samples diluted adequately in PBS containing 3% BSA and 0.1% Tween-20 for 1 h. In the case of the serum samples, they were diluted at 1/500 and preincubated with 20 µg/ml of the bacterial lysate containing nonrecombinant pTEX7 product for 2 h at room temperature before incubation with the membranes. After three washings in PBS with 0.1% Tween 20, the bound Abs were reacted with horseradish peroxidase-conjugated rabbit anti-goat IgG (American Qualex, San Clemente, CA), goat anti-rabbit IgG (Medical & Biological Laboratories, Nagoya, Japan), or goat anti-human IgG (Zymed) diluted 1/5000 for 30 min. Finally, the bound Abs were visualized with diaminobenzidine.

Affinity purification of autoantibodies to fusion proteins

Adsorption and affinity purification were performed essentially according to the method of Olmsted (41). The partially purified recombinant proteins were separated by SDS-PAGE, then transferred onto nitrocellulose membranes. Next, the recombinant protein bands, visualized with a Ponceau S solution (Sigma, St. Louis, MO), were cut out and used for affinity purification. Each serum sample that had been preincubated with bacterial lysate containing nonrecombinant pTEX7 product for 2 h was diluted in PBS containing 3% BSA and 0.1% Tween 20 (1/500 dilution) and incubated for 2 h with the proteins fixed on the nitrocellulose membrane, after which the membrane was recovered. The bound Abs were eluted with 4 ml of 0.2 M glycine HCl buffer, pH 2.5, containing 0.15 M NaCl and 3% BSA, followed by neutralization with 600 µl of 2 M Tris base.

Establishment of stable transfectant

Human CTLA-4 cDNA was obtained from anti-CD3-activated PBMC by PCR using the sense primer (GATCCTCGAGATGGCTTGCCTTGGATTTCA) and the antisense primer (GATCGCGGCCGCTCAATTGATGGGAATAAA), where the recognition sites for the restriction enzymes used are underlined. The cDNA was cloned into the XhoI- and i-digested BCMGSneo expression vector containing a neomycin-resistant gene (42). Transfection of murine mastocytoma P815 cells was achieved by electroporation as described by Azuma et al. (43). The drug-resistant cells were harvested and cloned, and cells with the highest cell surface expression of CTLA-4 were selected by flow cytometry.

Indirect immunofluorescence and flow cytometry

Binding of the purified anti-CTLA-4 Abs to native CTLA-4 was detected by indirect immunofluorescence. To block the binding of Igs to mouse Fc receptors, the P815 cells and the CTLA-4-transfected P815 cells were preincubated with mouse serum diluted 1/10 for 1 h at 4°C. After washing the cells in a staining buffer (PBS containing 2% BSA), the cells were suspended in the staining buffer and reacted with Abs purified from the patients’ sera or anti-CTLA-4 mAb (Biostride, Palo Alto, CA) for 30 min on ice. After washing in the staining buffer, the cells were incubated with phycoerythrin-conjugated goat anti-human IgG (Southern Biotechnology Associates, Birmingham, AL) or phycoerythrin-conjugated rabbit anti-mouse Ig (Southern Biotechnology Associates), respectively, for 30 min on ice. The fluorescence intensity was measured by FACSCalibur (Becton Dickinson, Mountain View, CA).

Statistical analysis

Laboratory data are expressed as the mean ± SEM. The Mann-Whitney U test was used to examine differences in the clinical parameters of patients with or without anti-CTLA-4 Ab. Fisher’s exact test was used to examine the correlation between clinical features of the patients and the presence of anti-CTLA-4 Ab.


    Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Expression of four recombinant costimulatory molecules and their antigenicities

DNA fragments encoding each of the human CTLA-4, CD28, B7-1, and B7-2 molecules were obtained by PCR from cDNA of a healthy donor PBL and then expressed as a ß-galactosidase fusion protein. Thus, we obtained sufficient amounts of each fusion protein that had the expected m.w. (Fig. 1Go). We first confirmed the antigenicity of each of these recombinant proteins by immunoblotting using the respective protein-specific Abs. As shown in Fig. 1Go, the recombinant CTLA-4, B7-1, and B7-2 proteins were each stained as a clear band. In the case of CD28, staining with its specific Ab produced two major bands. Since the upper band had the expected m.w., the lower band was thought to be a degraded product of the full-length CD28 fusion protein. In addition, since approximately half the purified recombinant CD28 was the full-length CD28 fusion protein, the protein was thought to be of sufficient quality for detecting autoantibodies in ELISA.



View larger version (33K):
[in this window]
[in a new window]
 
FIGURE 1. The antigenicity of the CTLA-4, CD28, B7-1, and B7-2 recombinant proteins. The recombinant protein and ß-galactosidase (ßG) were separated by 8% SDS-PAGE and transferred onto nitrocellulose membranes. The antigenicity of each recombinant protein was tested using the respective protein-specific Ab by immunoblotting. High m.w. marker (lane 1) and ß-galactosidase (lane 2) were stained with Ponceau S.

 
Reactivity of the serum of patients with various systemic autoimmune diseases with the recombinant CTLA-4, CD28, B7-1, and B7-2 proteins

The recombinant CTLA-4, CD28, B7-1, and B7-2 proteins were used to detect the presence of the respective autoantibodies in the sera of patients with various systemic autoimmune diseases by ELISA. As shown in Fig. 2Go, IgG-type anti-CTLA-4 Ab was detected in the sera of 21 of the 162 patients (13.0%); however, the sera of only three patients were positive for anti-B7-2 Ab, and no patient was positive for anti-CD28 or for anti-B7-1 Ab. Autoantibodies to each of the four molecules were not detected in the sera of any of the healthy donors. In addition, the presence of IgM-type anti-CTLA-4 Ab was determined in a similar way and was detected in the sera of only three patients (data not shown).



View larger version (9K):
[in this window]
[in a new window]
 
FIGURE 2. The prevalence of autoantibodies to recombinant CTLA-4, CD28, B7-1, and B7-2 in the sera of 162 patients with systemic autoimmune disease and 82 healthy donors (normals) by ELISA. Serum dilutions were 1/700 for CTLA-4 and B7-2, and 1/2000 for CD28 and B7-1. The OD of each sample is indicated in binding units (see Materials and Methods). The dotted line represents the positive cutoff point, which was calculated as the mean binding units of 82 healthy donors + 3 SD.

 
The prevalence of the anti-CTLA-4 autoantibody in each disease is shown in Fig. 3Go. The anti-CTLA-4 Ab was detected in the sera of 4 of 49 patients with SLE (8.2%), 9 of 48 patients with RA (18.8%), 1 of 32 patients with SSc (3.1%), 7 of 22 patients with Behçet’s disease (31.8%), and 2 of 15 patients with Sjs (13.3%). The positive serum samples were further tested by immunoblotting. Of the 21 samples that were positive by ELISA, 19 reacted to CTLA-4. The results of 5 representative autoimmune disease patients are shown in Fig. 4Go.



View larger version (14K):
[in this window]
[in a new window]
 
FIGURE 3. Prevalence of autoantibodies to recombinant CTLA-4 in sera from patients with SLE, RA, Behçet’s disease, SSc, and Sjs and from healthy donors (normals). The serum dilution was 1/700. The OD of each sample is indicated in binding units (see Materials and Methods). The dotted line represents the positive cutoff point, which was calculated as the mean binding units of 40 sex- and age-matched healthy donors + 3 SD in the respective diseases. •, patient with both RA and Sjs.

 


View larger version (79K):
[in this window]
[in a new window]
 
FIGURE 4. Immunoreactivity of recombinant CTLA-4. Recombinant CTLA-4 and ß-galactosidase (ßG) were separated by 8% SDS-PAGE and were transferred onto nitrocellulose membranes. Serum samples that were anti-CTLA-4 Ab positive by ELISA were tested by immunoblotting. The control membranes were stained with Ponceau S. Five representative samples are shown. SLE6, SLE patient; RA5, RA patient; ns-27, 31, 51, Behçet’s disease patients.

 
Recognition of native CTLA-4 by the autoantibodies

Our findings showed that a considerable percentage of the tested autoimmune disease sera contained anti-CTLA-4 Abs. However, the recombinant CTLA-4 produced in E. coli and solubilized in 8 M urea is denatured, and thus would not be expected to have the native conformation.

Therefore, we further investigated whether the anti-CTLA-4 autoantibodies in the patients could bind to the native form of CTLA-4 molecules. Specifically, we purified the Abs bound to the recombinant CTLA-4 and then examined whether these Abs bind to CTLA-4 molecules expressed on mammalian cells (P815) by immunofluorescent staining followed by FACS analysis. The purified anti-CTLA-4 fusion protein Ab was able to bind to the TLA-4-transfected P815 cells, but not to P815 cells. A representative case is shown in Fig. 5Go. These data provide direct evidence that the anti-CTLA-4 autoantibodies of patients react with the native form of the CTLA-4 molecules expressed on the mammalian cell surface.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 5. Reactivity of anti-CTLA-4 Abs with CTLA-4-transfected P815 cells. P815 cells and CTLA-4-transfected P815 cells were examined by indirect immunofluorescence for reactivity with murine mAb to CTLA-4 (A and B) and with Abs eluted from the recombinant CTLA-4 of blots (C and D).

 
Epitope mapping of CTLA-4

To map the autoepitopes on the CTLA-4 protein, three pTEX7 plasmids with cDNA fragments F1, F2, and F3 (pTEX7-cDNAF1, pTEX7-cDNAF2, and pTEX7-cDNAF3) were constructed (Fig. 6GoA). We obtained the respective proteins shown in Fig. 6GoB.



View larger version (31K):
[in this window]
[in a new window]
 
FIGURE 6. A, CTLA-4 and truncated recombinant CTLA-4 fusion proteins (F1, F2, and F3) used in this study. Numbers denote the amino acid residues of the entire amino acid sequence of CTLA-4. These regions were expressed as ß-galactosidase fusion proteins in E. coli. B, A series of fusion proteins was analyzed by SDS-PAGE. Each purified fusion protein was separated by 8% SDS-PAGE, transferred onto a nitrocellulose membrane, and stained with Ponceau S. LS, leader sequence; TM, transmembrane region; CYT, cytoplasmic region; B-gal, ß-galactosidase.)

 
The reactivity of sera from 18 anti-CTLA-4 Ab-positive patients and 82 healthy donors to each fragment was examined by ELISA. Table IIGo shows that the sera of nine of the 18 (50%) patients reacted to all fragments, the sera of seven (38.8%) patients reacted to two fragments, and the sera of two (11.1%) patients reacted specifically to either F1 or F2. In total, the F1, F2, and F3 proteins were recognized by 14 (77.8%), 15 (83.3%), and 14 (77.8%), respectively, of 18 patients’ sera.


View this table:
[in this window]
[in a new window]
 
Table II. Reactivity of anti-CTLA-4 Ab-positive serum samples to the three truncated recombinant proteins of CTLA-4 as tested by ELISA

 
To confirm these reactivities, serially diluted serum samples were similarly tested by ELISA. Representative results (RA-5, ns-65, and ns-31) are shown in Fig. 7Go. Thus, most of the serum samples recognized multiple epitopes on CTLA-4.



View larger version (20K):
[in this window]
[in a new window]
 
FIGURE 7. Results of ELISA for anti-CTLA-4 fragments (F1, F2, and F3) in sequentially diluted sera obtained from anti-CTLA-4 Ab-positive patients. RA-5, RA patient with anti-F1, F2, and F3 Abs; ns-65, Behçet’s patient with anti-F1 and F2 Abs; ns-31, Behçet’s patient with anti-F1 Ab.

 
Laboratory data and clinical features of Behçet’s disease patients whose sera do and do not contain anti-CTLA-4 Abs

Since anti-CTLA-4 Abs were detected most frequently in the sera of patients with Behçet’s disease, we compared the laboratory data and the clinical features, including past history of the anti-CTLA-4 Ab-positive and -negative Behçet’s disease patients. There was no significant difference in the laboratory data (erythrocyte sedimentation rate, peripheral lymphocyte count, and serum levels of IgG, IgA, and IgM) of the two groups of Behçet’s disease patients (Table IIIGo). Similarly, most of the clinical features of the two groups did not differ significantly. However, uveitis was detected in 13 of the 15 (86.7%) Ab-negative patients, but in only two of the seven (28.6%) Ab-positive patients, and this difference is statistically significant (Table IVGo).


View this table:
[in this window]
[in a new window]
 
Table III. Laboratory parameters in the anti-CTLA-4 Ab-positive and -negative Behçet’s disease patients1

 

View this table:
[in this window]
[in a new window]
 
Table IV. Clinical features of the anti-CTLA-4 Ab-positive and -negative Behçet’s disease patients

 

    Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We have demonstrated for the first time that CTLA-4, a costimulatory molecule of T cell activation, is a target of ALAs. Furthermore, we showed that the autoantibody to CTLA-4 reacts with the native form of human CTLA-4 molecule expressed on the mammalian cell surface.

In our study, anti-CTLA-4 Abs were detected more frequently among patients with Behçet’s disease and RA than among those with SLE. This was unexpected, since ALAs are detected in a higher percentage of patients with SLE than in patients with Behçet’s disease and RA (2). This may be because CTLA-4 is a minor target of ALA (discussed below), and thus the prevalence of anti-CTLA-4 Ab would be different from the prevalence of total ALA previously reported (2). Alternatively, the discrepancy may be related to the detection method. The standard method for detection of ALAs is the microcytotoxicity test, in which the presence of ALA-mediated complement cytolysis is tested using PBL of healthy donors. This method may miss the ALAs to Ags that are temporarily expressed or induced by activation, such as CTLA-4. Thus, ALA detection using recombinant proteins may produce different results from those obtained by the conventional method. Screening of a larger number of serum samples than that reported here would be needed to resolve this issue.

The laboratory data and clinical features of patients did not correlate with the presence or the absence of anti-CTLA-4 Ab among patients with Behçet’s disease (Table IIGo), those with RA, and those with SLE (data not shown). Previous reports indicated that the presence of ALAs correlates with lymphopenia (4); however, our data showed that the presence of anti-CTLA-4 Ab did not correlate with the lymphocyte count. As to clinical features, it is interesting that a negative correlation was found between uveitis and the presence of anti-CTLA-4 Ab in Behçet’s disease patients. Although the pathogenesis of Behçet’s disease remains unclear, immunological abnormalities, in particular infiltration of predominantly T lymphocytes in erythema nodosum like-lesions (44), oral ulcers (44), terminal ileum (45), and ocular lesions (46), have been reported. Thus, T cells play a role in the affected lesions. In this regard, the anti-CTLA-4 Ab detected in the Behçet’s disease patients may act to suppress the proliferation of uveitis-driving T cells. Decreased function of suppressor T cells and subsequent increased B cell function have been implicated in Behçet’s disease, and Sakane et al. suggested that ALAs might be responsible for the loss of suppressor T cell function (47). From this viewpoint, anti-CTLA-4 Abs may suppress the function of such suppressor T cells and dysregulate B cell function. In all patients with uveitis in our study, the uveitis was inactive at the time their serum samples were obtained. Therefore, further studies comparing disease activity with the titer of anti-CTLA-4 Ab may give us some clues to understanding the role of anti-CTLA-4 Ab in vivo. In RA, Verwilghen et al. reported that anti-CTLA-4 mAb had an inhibitory effect on the mixed lymphocyte cytotoxicity test when synovial fluid T cells from RA patients were used as stimulatory cells (48). These findings suggest that anti-CTLA-4 Ab in RA acts to suppress arthritis-driving T cell function, similar to its role in suppressing uveitis in Behçet’s disease.

Epitope mapping using three recombinant CTLA-4 fragments revealed that the CTLA-4 molecule contains at least three epitopes recognized by the IgG type of the anti-CTLA-4 Ab. Most of the anti-CTLA-4 Ab-positive sera reacted to more than one CTLA-4 fragment. This result indicates that the production of autoantibodies to CTLA-4 is induced by an Ag-driven mechanism, which is the main mode of production of many antinuclear Abs (49, 50). In addition, this diversity of anti-CTLA-4 Abs may indicate the existence of several kinds of anti-CTLA-4 Abs with different functions.

Among the four T cell costimulatory molecules tested, autoantibodies to CTLA-4 were frequently detected in patients with autoimmune disease, but autoantibodies to CD28, B7-1, and B7-2 were rare. In particular, CD28 shares 31% amino acid identity with CTLA-4 (51), but anti-CD28 Ab was not detected in any of the patients. This fact suggests the existence of a CTLA-4-specific immune response among the four costimulatory molecules tested in this study. This may be related to the difference in the manner in which the molecules are expressed, i.e., activation-induced or constitutive expression. Further studies are needed to elucidate this mechanism.

To screen autoantibodies to the costimulatory molecules, we used proteins produced in bacteria. Therefore, autoantibodies to the natural form of the molecules could have been missed. To detect such kinds of Abs, transfectants can be useful. We tried to detect anti-CTLA-4 Abs with the CTLA-4-transfected P815 cells using whole sera instead of purified anti-CTLA-4 Abs from patients. However, this was not effective, since a considerable number of serum samples strongly reacted to the transfectants and also to the control P815 cells (data not shown). It is possible that other kinds of autoantibodies in the sera cross-reacted with the surface molecules of the P815 cells. Thus, the transfectants were useful in determining whether an Ab specifically purified from sera could react to the natural form of the molecule, but was inadequate for screening of ALA using whole sera.

Several studies in mice and humans have indicated that a lack or modification of negative signals through CTLA-4 is implicated in autoimmune diseases (21, 22, 23, 24, 25, 26, 27). In addition, CTLA-4 was reported to be essential for peripheral tolerance of CD4+ T cells (52). From these findings, it is very likely that CTLA-4 is involved in the pathogenesis or abnormal immune responses in autoimmune diseases. The autoantibodies to CTLA-4 demonstrated here may modulate the immune response in patients with autoimmune disease.


    Acknowledgments
 
We thank Mr. Kazunori Kiba for his technical assistance.


    Footnotes
 
1 This work was supported in part by a grant-in-aid from the Ministry of Health and Welfare and the Ministry of Education, Science, and Culture, Japan, and by the Rheumatism Foundation. Back

2 Address correspondence and reprint requests to Dr. Tomohiro Kato, Rheumatology, Immunology, and Genetics Program, Institute of Medical Science, St. Marianna University School of Medicine, 2-16-1 Sugao, Miyamae-ku, Kawasaki, Kanagawa 216-0015, Japan. E-mail address: Back

3 Abbreviations used in this paper: ALA, anti-lymphocyte antibodies; SLE, systemic lupus erythematosus; RA, rheumatoid arthritis; SSc, systemic sclerosis; Sjs, Sjögren’s syndrome. Back

Received for publication July 20, 1998. Accepted for publication December 21, 1998.


    References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Osman, C., A. J. G. Swaak. 1994. Lymphocytotoxic antibodies in SLE: a review of the literature. Clin. Rheum. 13:21.[Medline]
  2. Swaak, A. J. G. 1996. Lymphocytotoxic autoantibodies. In Autoantibodies. J. B. Peter and Y. Shoenfeld, eds. Elsevier Science, Amsterdam, p. 478.
  3. Winfield, J. B., T. Mimura. 1992. Pathogenetic significance of anti-lymphocyte autoantibodies in systemic lupus erythematosus. Clin. Immunol. Immunopathol. 63:13.[Medline]
  4. Winfield, J. B., R. J. Winchester, H. G. Kunkel. 1975. Association of cold-reactive antilymphocyte antibodies with lymphopenia in systemic lupus erythematosus. Arthritis Rheum. 18:587.[Medline]
  5. Morimoto, C., A. D. Steinberg, N. L. Letvin, M. Hagan, T. Takeuchi, J. Daley, H. Levine, S. F. Schlossman. 1987. A defect of immunoregulatory T cell subsets in systemic lupus erythematosus patients demonstrated with anti-2H4 antibody. J. Clin. Invest. 79:762.
  6. Tanaka, S., T. Matsuyama, A. D. Steinberg, S. F. Schlossman, C. Morimoto. 1989. Antilymphocyte antibodies against CD4+2H4+ cell populations in patients with systemic lupus erythematosus. Arthritis Rheum. 32:398.[Medline]
  7. Wernet, P., H. G. Kunkel. 1973. Antibodies to specific surface antigen on T cells in human sera inhibiting mixed leukocyte culture reactions. J. Exp. Med. 138:1021.[Abstract]
  8. Sakane, T., A. D. Steinberg, J. P. Reeves, I. Green. 1979. Studies of immune functions of patients with systemic lupus erythematosus: T-cell subsets and antibodies to T-cell subsets. J. Clin. Invest. 64:1260.
  9. Takeuchi, T., T. Abe, M. Kiyota, T. Toguchi, J. Koide, C. Morimoto, C. Homma. 1982. In vitro immune response of SLE lymphocytes: the mechanism involved in B-cell activation. Scand. J. Immunol. 16:369.[Medline]
  10. Morimoto, C., and S. Schlossman, F. 1987. Antilymphocyte antibodies and systemic lupus erythematosus. Arthritis Rheum. 30:225.
  11. Mimura, T., P. Fernsten, W. Jarjour, J. B. Winfield. 1990. Autoantibodies specific for different isoforms of CD45 in systemic lupus erythematosus. J. Exp. Med. 172:653.[Abstract/Free Full Text]
  12. Czyzyk, J., P. Fernsten, M. Shaw, J. B. Winfield. 1996. Cell-type specificity of anti-CD45 autoantibodies in systemic lupus erythematosus. Arthritis Rheum. 39:592.[Medline]
  13. Revillard, J. P., C. Vincent, S. Rivera. 1979. Anti-ß2-microglobulin lymphocytotoxic autoantibodies in systemic lupus erythematosus. J. Immunol. 122:614.[Abstract/Free Full Text]
  14. Propper, D. J., W. A. Lehney, S. J. Urbaniak, G. R. Catto, A. M. Macleod. 1991. Lymphocytotoxins in sera from highly sensitized multiparous dialysis patients: antibody class, relationship with the HLA and with paternal antigens. Clin. Sci. 80:87.[Medline]
  15. Mueller, D. L., M. K. Jenkins, R. H. Schwartz. 1989. Clonal expansion versus clonal inactivation: a costimulatory signaling pathway determines the outcome of T cell antigen receptor occupancy. Annu. Rev. Immunol. 7:445.[Medline]
  16. Lenschhow, D. J., T. L. Walunas, J. A. Bluestone. 1996. CD28/B7 system of T cell costimulation. Annu. Rev. Immunol. 14:233.[Medline]
  17. Gause, W. C., M. J. Halvorson, P. Lu, R. Greenwald, P. Linsley, J. F. Urban, F. D. Finkelman. 1997. The function of costimulatory molecules and the development of IL-4-producing T cells. Immunol. Today. 18:115.[Medline]
  18. Linsley, P. S., J. L. Greene, P. Tan, J. Bradshaw, J. A. Ledbetter, C. Anasetti, N. K. Damle. 1992. Coexpression and functional cooperation of CTLA-4 and CD28 on activated T lymphocytes. J. Exp. Med. 176:1595.[Abstract/Free Full Text]
  19. Walunas, T. L., D. J. Lenschow, C. Y. Bakker, P. S. Linsley, G. J. Freeman, J. M. Green, C. B. Thompson, J. A. Bluestone. 1994. CTLA-4 can function as a negative regulator of T cell activation. Immunity 1:405.[Medline]
  20. Krummel, M. F., J. P. Allison. 1995. CD28 and CTLA-4 have opposing effects on the response of T cells to stimulation. J. Exp. Med. 182:459.[Abstract/Free Full Text]
  21. Waterhouse, P., J. M. Penninger, E. Timms, A. Wakeham, A. Shahinian, K. P. Lee, C. B. Thompson, H. Griesser, T. W. Mak. 1995. Lymphoproliferative disorders with early lethality in mice deficient in Ctla-4. Science 270:985.[Abstract/Free Full Text]
  22. Tivol, E. A., F. Borriello, A. N. Schweitzer, W. P. Lynch, J. A. Bluestone, A. H. Sharpe. 1995. Loss of CTLA-4 leads to massive lymphoproliferation and fatal multiorgan tissue destruction, revealing a critical negative regulatory role of CTLA-4. Immunity 3:541.[Medline]
  23. Karandikar, N. J., C. L. Vanderlugt, T. L. Walunas, S. D. Miller, J. A. Bluestone. 1996. CTLA-4: a negative regulator of autoimmune disease. J. Exp. Med. 184:783.[Abstract/Free Full Text]
  24. Perrin, P. J., J. H. Maldonado, T. A. Davis, C. H. June, M. K. Racke. 1996. CTLA-4 blockade enhances clinical disease and cytokine production during experimental allergic encephalomyelitis. J. Immunol. 157:1333.[Abstract]
  25. Hurwitz, A. A., T. J. Sullivan, M. F. Krummel, R. A. Sobel, J. P. Allison. 1997. Specific blockade of CTLA-4/B7 interactions results in exacerbated clinical and histologic disease in an actively-induced model of experimental allergic encephalomyelitis. J. Neuroimmunol. 73:57.[Medline]
  26. Yanagawa, T., Y. Hidaka, V. Guimaraes, M. Soliman, L. J. DeGroot. 1995. CTLA-4 gene polymorphism associated with Graves’ disease in a Caucasian population. J. Clin. Endocrinol. Metab. 80:41.[Abstract]
  27. Donner, H., H. Rau, P. G. Walfish, J. Braun, T. Siegmund, R. Finke, J. Herwig, K. H. Usadel, K. Badenhoop. 1997. CTLA4 alanine-17 confers genetic susceptibility to Graves’ disease and to type 1 diabetes mellitus. J. Clin. Endocrinol. Metab. 82:143.[Abstract/Free Full Text]
  28. Tan, E. M., A. S. Cohen, J. F. Fries, D. J. McShane, N. F. Rothfield, J. G. Schaller, N. Talal, R. J. Winchester. 1982. The 1982 revised criteria for the classification of systemic lupus erythematosus. Arthritis Rheum. 25:1271.[Medline]
  29. Arnett, F. C., S. M. Edworthy, D. A. Bloch, D. J. McShane, J. F. Fries, N. S. Cooper, L. A. Healey, S. R. Kaplan, M. H. Liang, H. S. Luthra, et al 1988. The American Rheumatism Association 1987 revised criteria for the classification of rheumatoid arthritis. Arthritis Rheum. 31:315.[Medline]
  30. 1980. Preliminary criteria for the classification of systemic sclerosis (scleroderma). Arthritis Rheum. 23:581.[Medline]
  31. 1990. Criteria for diagnosis of Behçet’s disease. Lancet 335:1078.[Medline]
  32. Homma, M., T. Tojo, M. Akizuki, H. Yamagata. 1986. Criteria for Sjögren’s syndrome in Japan. Scand. J. Rheumatol. 61:(Suppl.):26.
  33. Dariavach, P., M. G. Mattei, P. Golstein, M. P. Lefranc. 1988. Human Ig superfamily CTLA-4 gene: chromosomal localization and identity of protein sequence between murine and human CTLA-4 cytoplasmic domains. Eur. J. Immunol. 18:1901.[Medline]
  34. Lee, K. P., C. Taylor, B. Petryniak, L. A. Turka, C. H. June, C. B. Thompson. 1990. The genomic organization of the CD28 gene: implications for the regulation of CD28 mRNA expression and heterogeneity. J. Immunol. 145:344.[Abstract]
  35. Freeman, G. J., A. S. Freedman, J. M. Segil, G. Lee, J. F. Whitman, L. M. Nadler. 1989. B7, a new member of the Ig superfamily with unique expression on activated and neoplastic B cells. J. Immunol. 143:2714.[Abstract]
  36. Freeman, G. J., J. G. Gribben, V. A. Boussiotis, J. W. Ng, V. A. Restivo, L. A. Lombard, G. S. Gray, L. M. Nadler. 1993. Cloning of B7-2: a CTLA-4 counter receptor that costimulates human T cell proliferation. Science 262:909.[Abstract/Free Full Text]
  37. Azuma, M., D. Ito, H. Yagita, K. Okumura, J. H. Phillips, L. L. Lanier, C. Somoza. 1993. B70 antigen is a second ligand for CTLA-4 and CD28. Nature 366:76.[Medline]
  38. Kato, T., S. Suzuki, K. Oda, K. Nishioka, K. Yamamoto. 1994. An improved expression vector producing a thrombin-cleavable fusion protein. Mol. Biol. 13:85.
  39. Stanley, K. K., J. P. Luzio. 1984. Construction of a new family of high efficiency bacterial expression vectors: identification of cDNA clones coding for human liver proteins. EMBO J. 3:1429.[Medline]
  40. Yamamoto, K., H. Miura, Y. Moroi, S. Yoshinoya, M. Goto, K. Nishioka, T. Miyamoto. 1988. Isolation and characterization of a complementary DNA expressing human U1 small nuclear ribonucleoprotein C polypeptide. J. Immunol. 140:311.[Abstract]
  41. Olmsted, J. B.. 1981. Affinity purification of antibodies from diazotized paper blots of heterogeneous protein samples. J. Biol. Chem. 256:11955.[Abstract/Free Full Text]
  42. Karasuyama, H., F. Melchers. 1988. Establishment of mouse cell lines which constitutively secrete large quantities of interleukin 2, 3, 4 or 5, using modified cDNA expression vectors. Eur. J. Immunol. 18:97.[Medline]
  43. Azuma, M., M. Cayabyab, D. Buck, J. H. Phillips, L. L. Lanier. 1992. CD28 interactions with B7 costimulates primary allogeneic proliferative responses and cytotoxicity mediated by small, resting T lymphocytes. J. Exp. Med. 175:353.[Abstract/Free Full Text]
  44. Kaneko, F., Y. Takahashi, Y. Muramatsu, Y. Miura. 1985. Immunological studies on aphthous ulcer and erythema nodosum-like eruption in Behçet’s disease. Br. J. Dermatol. 113:303.[Medline]
  45. Yamana, S., S. L. Jones, T. Shimamoto, T. Shiota, T. Aoyama, and K. Takasugi. 1986. Immunohistochemical analysis of lymphocytes infiltrating the terminal ileum in patients with Behçet’s disease. In Recent Advances in Behçet’s Disease. T. Lehner and C. G. Barnes, eds. Royal Society of Medicine Services, London, p. 129.
  46. Charteris, D. G., K. Barton, A. C. E. McCartney, S. L. Lightman. 1992. CD4+ lymphocyte involvement in ocular Behçet’s disease. Autoimmunity 12:201.[Medline]
  47. Sakane, T., H. Kotani, S. Takada, T. Tsunematsu. 1982. Functional aberration of T cell subsets in patients with Behçet’s disease. Arthritis Rheum. 25:1343.[Medline]
  48. Verwilghen, J., R. Lovis, B. M. De, P. S. Linsley, G. K. Haines, A. E. Koch, R. M. Pope. 1994. Expression of functional B7 and CTLA4 on rheumatoid synovial T cells. J. Immunol. 153:1378.[Abstract]
  49. Kato, T., K. Yamamoto, H. Takeuchi, M. Okubo, E. Hara, S. Nakada, K. Oda, K. Ito, K. Nishioka. 1993. Identification of a universal B cell epitope on DNA topoisomerase I, an autoantigen associated with scleroderma. Arthritis Rheum. 36:1580.[Medline]
  50. Kato, T., H. Sasakawa, S. Suzuki, M. Shirako, F. Tashiro, K. Nishioka, K. Yamamoto. 1995. Autoepitopes of the 52kd SS-A/Ro molecule. Arthritis Rheum. 38:990.[Medline]
  51. Harper, K., C. Balzano, E. Rouvier, M. G. Mattei, M. F. Luciani, P. Golstein. 1991. CTLA-4 and CD28 activated lymphocyte molecules are closely related in both mouse and human as to sequence, message expression, gene structure, and chromosomal location. J. Immunol. 147:1037.[Abstract]
  52. Perez, V. L., P. L. Van, A. Biuckians, X. X. Zheng, T. B. Strom, A. K. Abbas. 1997. Induction of peripheral T cell tolerance in vivo requires CTLA-4 engagement. Immunity 6:411.[Medline]



This article has been cited by other articles:


Home page
J. Immunol.Home page
W. Stohl, N. Jacob, W. J. Quinn III, M. P. Cancro, H. Gao, C. Putterman, X. Gao, L. Pricop, and M. N. Koss
Global T Cell Dysregulation in Non-Autoimmune-Prone Mice Promotes Rapid Development of BAFF-Independent, Systemic Lupus Erythematosus-Like Autoimmunity
J. Immunol., July 1, 2008; 181(1): 833 - 841.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
B. Wan, H. Nie, A. Liu, G. Feng, D. He, R. Xu, Q. Zhang, C. Dong, and J. Z. Zhang
Aberrant Regulation of Synovial T Cell Activation by Soluble Costimulatory Molecules in Rheumatoid Arthritis
J. Immunol., December 15, 2006; 177(12): 8844 - 8850.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Xiang, T. Sekine, H. Nakamura, S. Imajoh-Ohmi, H. Fukuda, K. Yudoh, K. Masuko-Hongo, K. Nishioka, and T. Kato
Fibulin-4 is a target of autoimmunity predominantly in patients with osteoarthritis.
J. Immunol., March 1, 2006; 176(5): 3196 - 3204.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
Z Yao, H Nakamura, K Masuko-Hongo, M Suzuki-Kurokawa, K Nishioka, and T Kato
Characterisation of cartilage intermediate layer protein (CILP)-induced arthropathy in mice
Ann Rheum Dis, March 1, 2004; 63(3): 252 - 258.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Zheng and M. Monestier
Inhibitory Signal Override Increases Susceptibility to Mercury-Induced Autoimmunity
J. Immunol., August 1, 2003; 171(3): 1596 - 1601.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. A. Hurwitz, T. J. Sullivan, R. A. Sobel, and J. P. Allison
Cytotoxic T lymphocyte antigen-4 (CTLA-4) limits the expansion of encephalitogenic T cells in experimental autoimmune encephalomyelitis (EAE)-resistant BALB/c mice
PNAS, February 20, 2002; (2002) 42684699.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
H Direskeneli
Behcet's disease: infectious aetiology, new autoantigens, and HLA-B51
Ann Rheum Dis, November 1, 2001; 60(11): 996 - 1002.
[Full Text] [PDF]


Home page
J. Immunol.Home page
X. Yu, T. Matsui, M. Otsuka, T. Sekine, K. Yamamoto, K. Nishioka, and T. Kato
Anti-CD69 Autoantibodies Cross-React with Low Density Lipoprotein Receptor-Related Protein 2 in Systemic Autoimmune Diseases
J. Immunol., January 15, 2001; 166(2): 1360 - 1369.
[Abstract] [Full Text] [PDF]


Home page
Ann Rheum DisHome page
T Sekine, K Masuko-Hongo, T Matsui, H Asahara, M Takigawa, K Nishioka, and T Kato
Recognition of YKL-39, a human cartilage related protein, as a target antigen in patients with rheumatoid arthritis
Ann Rheum Dis, January 1, 2001; 60(1): 49 - 54.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. A. Hurwitz, T. J. Sullivan, R. A. Sobel, and J. P. Allison
Cytotoxic T lymphocyte antigen-4 (CTLA-4) limits the expansion of encephalitogenic T cells in experimental autoimmune encephalomyelitis (EAE)-resistant BALB/c mice
PNAS, March 5, 2002; 99(5): 3013 - 3017.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Matsui, T.
Right arrow Articles by Kato, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Matsui, T.
Right arrow Articles by Kato, T.


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS