|
|
||||||||
Sir William Dunn School of Pathology, University of Oxford, Oxford, United Kingdom
| Abstract |
|---|
|
|
|---|
| Introduction |
|---|
|
|
|---|
production by NK and T cells and induces the development and
differentiation of Th1 cells (1). However, overproduction of IL-12 can
be dangerous to the host, e.g., in the immunopathology of
organ-specific autoimmune diseases (8), suggesting that the level of
this cytokine must be tightly controlled. IL-12 has features unique among cytokines. It is a 70-kDa heterodimer of two subunits, p40 (40 kDa) and p35 (35 kDa), encoded by separate genes, which are disulfide-bonded in the bioactive form of the protein (9, 10). Although both subunits must be coexpressed in the same cell to generate the bioactive form (10), production of the subunits is regulated independently (11, 12, 13, 14). Initially, it was reported that p35 transcripts were ubiquitously and constitutively expressed in various cell types, while p40 transcripts were highly regulated (1, 2). It was therefore believed that IL-12 expression was controlled at the level of p40 production. In fact, it has often been assumed that p40 mRNA or protein production alone is indicative of IL-12 heterodimer formation. However, recent evidence has shown that p35 transcripts are highly regulated in some cases (12, 13, 14, 15, 16, 17), and that expression of the p35 subunit can even determine the level of IL-12 heterodimer production (12, 13).
There have been many recent reports dealing with the molecular
mechanisms of p40 gene expression, where control seems to be mainly at
the level of transcription. Multiple regulatory elements have been
implicated in p40 regulation, in particular NF-
B (18), Ets-2 (19, 20), and members of the IFN regulatory factor (IRF) (21, 22), and CCAAT
enhancer binding protein (C/EBP) (23) families of transcription
factors. On the other hand, p35 gene regulation has remained
poorly defined. Our group and others have cloned and sequenced the
murine p35 subunit gene and its cDNA (24, 25, 26). We have determined that
p35 has multiple transcription start sites and can initiate from either
of two 5' exons, resulting in mRNA isoforms with different 5'
untranslated regions
(UTRs)3 (25).
In this paper we determined the mechanism of p35 gene regulation in two different cell types, the murine B cell lymphoma line A20 and bone marrow-derived dendritic cells (bmDC). In both cell types, we found that p35 mRNA was up-regulated by LPS stimulation, and that expression of the p35 subunit was further regulated at the level of translation. In nonstimulated cells, p35 transcripts contained an additional upstream ATG, whose presence in the 5' UTR was shown to inhibit translation of the p35 subunit from downstream. After LPS stimulation, however, transcription initiated from alternate positions, resulting in transcripts with a different 5' UTR that did not contain this upstream ATG. These transcripts were then able to support translation of the p35 subunit, which could subsequently dimerize with p40 to produce bioactive IL-12. The results presented here confirm that p35 is highly regulated and, unlike the p40 subunit, is controlled translationally as well as transcriptionally.
| Materials and Methods |
|---|
|
|
|---|
A20 and RAW 264 cells were cultured in Iscoves modified Dulbeccos medium supplemented with 5% FCS, 50 U/ml penicillin, and 50 µg/ml streptomycin. The bmDC were prepared from CBA/Ca mice based on the method of Inaba et al. (27) with minor modifications. Isolated bmDC were 9095% pure, as determined by expression of the dendritic cell marker CD11c. When required, A20, RAW 264, and bmDC were stimulated with LPS (20 µg/ml) for 42 h (luciferase assay), 24 h (primer extension assay, Northern blot hybridization, IL-12 bioassay), or 18 h (RACE, RT-PCR).
Primer extension assay
Primer extension was performed on poly(A)+ RNA (20
µg) from A20 cells using the following 32P-labeled
antisense primers: primer 1, GGCCAAACTGAGGTGGTTTAGGAGGGCAAGG,
corresponding to a sequence in exon 3; primer 2,
GACTTTCCCAGGACTGTGTCTCTTGC, corresponding to +235 to +260 in Fig. 2
A; or primer 3, AGGCTGTTGGAACGCTGACCATAGAGATATC,
spanning the exon 1/exon 2 splice junction at -461 to -450 (exon 1)
and +302 to +320 (exon 2) in Fig. 2
A. Purified primer
extension products were separated on a 6-M urea/6% polyacrylamide gel
in parallel with sequencing ladders prepared using the same primers.
|
The Pro1 and Pro3 promoter fragments were made by amplification
of a 0.81-kb fragment (Pro1, -458 to +354 in Fig. 2
A) or a
0.72-kb fragment (Pro3, -458 to +265 in Fig. 2
A) by PCR.
The Pro2 promoter fragment was made by mutation of the ATG codon (+288
to +290 in Fig. 2
A) to an ATC in the Pro1 fragment by PCR.
Amplified fragments were introduced into the pGL3-Enhancer Vector
(Promega, Madison, WI) upstream of the luciferase gene.
The p35 5' UTR fragments were made by PCR amplification using the
antisense primer P33
(CGTGGTCGACCCATGGTGGACCGGCACTGAGAGGAG) for fragments
pII, pIIa, pIV, pIVa, pIII, and pIIIc or the antisense primer P33F
(CGTGGTCGACCCATGGTGGCCGGCACTGAGAGGAG) for fragments
pIIIa and pIIIb. Primers P33 and P33F correspond to +340 to +375 in
Fig. 2
A and contain an NcoI site (underlined).
Primer P33F contains a -1 frame shift at +356. The sense primers used
were as follows: pII,
GACAAAGCTTAAAATGTGTCTCCCAAGGTCAGC; or pIIa,
GACAAAGCTTAAAATCTGTCTCCCAAGGTCAGC, both
corresponding to +275 to +307 in Fig. 2
A; pIV,
GACAAGCTTGTCCTTGAGATGTAGAG; or pIVa,
GACAAGCTTGTCCTTGAGATCTAGAG, both
corresponding to +196 to +221 in Fig. 2
A; pIII/pIIIa,
CATCCAAGCTTATCTCTATGGTCAGCGTTCC for the construction of
pIII and pIIIa; or pIIIb/pIIIc,
CATCCAAGCTTATCTCTATCGTCAGCGTTCC for the
construction of pIIIb and pIIIc, both spanning the exon 1/exon 2 splice
junction at -469 to -450 (exon 1) and +302 to +312 (exon 2) in Fig. 2
A. All sense primers contain a HindIII site
(underlined), and the pIIa, pIVa, and pIIIb/pIIIc primers contain an
ATG to ATC mutation (boldface). Fragments pIVb and pIVc were made by
PCR mutation of the ATG sequence (+288 to +290 in Fig. 2
A)
to an ATC in fragments pIV and pIVa, respectively. Fragments pIII,
pIIIa, pIIIb, and pIIIc were amplified on an exon 1-containing cDNA
template, while all other fragments were amplified on a genomic
template. All amplified products were then digested with
HindIII/NcoI and introduced into the pGL3-Control
Vector (Promega) upstream of the luciferase gene.
Cell transfection and luciferase assay
Transfection was performed by electroporation at 960 µF and 0.30 kV (A20) or 0.32 kV (RAW 264), using 2 x 107 cells, 2 µg of pRL-TK Vector (Promega) as an internal control, and either 10 µg (promoter assays) or 20 µg (5' UTR/translation assays) of reporter plasmid DNA per transfection. When required, cells were stimulated with LPS at 6 h post-transfection; all cells were harvested at 48 h post-transfection. Cell lysates were prepared and assayed for firefly and Renilla luciferase activities using the Dual Luciferase Assay Kit (Promega). Firefly luciferase activities were normalized to internal control Renilla luciferase values. Luciferase assays were performed at least three times.
Construction of p35/ATG stable transfectants
The full length coding region of p35 was amplified by PCR using
an antisense primer specific for the 3' end of the coding region and
sense primers specific to the different 5' UTRs of p35, resulting in
the following fragments: 35.I (5' end corresponding to +359 in Fig. 2
A), 35.II (5' end corresponding to +283 in Fig. 2
A), 35.III (5' end corresponding to -459 in Fig. 2
A), and 35.IIIa (5' end the same as in 35.III and the ATG
sequence at +362 to +364 in Fig. 2
A mutated to a GCG by
PCR). Fragments 35.I and 35.II were amplified on an intron 1-containing
cDNA template, while fragments 35.III and 35.IIIa were amplified on an
exon 1-containing cDNA template. These p35 cDNA fragments were then
introduced downstream of the elongation factor-1
(EF-1
) promoter
in the mammalian expression vector pOXCD59neo vector (containing
a neomycin resistance gene). The resulting expression plasmids were
transfected into RAW 264 cells by electroporation, and stable
transfectants were selected using G418 (1 mg/ml).
Northern blot hybridization
Total RNA (10 µg) from the indicated cells was separated on a 1% formaldehyde/agarose gel, transferred to a nylon membrane, and subjected to hybridization using 32P-labeled p35 or hypoxanthine phosphoribosyltransferase (HPRT) cDNA probes. Transcript levels were analyzed by phosphorimaging (Molecular Dynamics, Sunnyvale, CA) and autoradiography.
IL-12 bioassay
The bioassay for IL-12-induced IFN-
production was performed
as previously described (28), using splenocytes from CBA/Ca mice and
the mAbs C15.6.7 and C15.1.2 for capture of IL-12 and, when required,
the mAb C17.8 for neutralization. IFN-
production was measured by
ELISA. IL-12 mAbs were a gift from Dr. G. Trinchieri (Wistar Institute,
Philadelphia, PA).
Rapid amplification of cDNA ends (RACE)
RACE was performed as previously described (25) but with the following modifications. First-strand cDNA was synthesized using the SMART PCR cDNA Library Construction Kit (Clontech, Palo Alto, CA) according to the manufacturers specifications. The sense primer used in semi-nested PCR was a modified SMART primer containing an XbaI site (underlined): CAGTCTAGATACGGCTGAGAGAAGACGACAGAA. The semi-nested antisense primers both correspond to sequences located in exon 3 and have been previously described (25).
Semiquantitative RT-PCR
PCR amplification was performed for 18 cycles (p40, HPRT, p35
II/IV), 22 cycles (p35 I-IV), or 34 cycles (p35 III). These cycle
numbers were experimentally determined to be in the linear range of
amplification and detection for all cDNAs tested. The p35 I-IV, p35
II/IV, and p35 III fragments were amplified using the sense primers
PI-IV (GGCATCCAGCAGCTCCTCTCAGTGC, corresponding to +328 to +352 in
Fig. 2
A), PII/IV (GGAAAGTCCTGCCGGCTATCCAGAC, corresponding
to +253 to +277 in Fig. 2
A), and PIII
(GTGCACATCCAAGGATATCTCTATG, corresponding to -474 to -450 in Fig. 2
A), respectively, and a common antisense primer P35C2
(CTGTGGGGGCAGGCAGCTCCC, corresponding to a sequence in exon 6). The p40
and HPRT primers have been previously described (29). Amplified
products were analyzed by Southern blot hybridization using
32P-labeled cDNA probes. Transcript levels were analyzed by
phosphorimaging and autoradiography.
| Results |
|---|
|
|
|---|
We previously mapped the p35 transcription start sites in the
murine macrophage cell line WEHI-3D by 5' RACE (25). Start sites were
located in both exon 1, a 5' noncoding exon, and in exon 2, which
contains the ATG that encodes the first methionine of p35. Primer
extension analysis in the murine B cell line A20 has identified four
major transcription start sites in the intron region directly upstream
of exon 2 (26). Taken together, these mapping studies suggest that p35
transcription might be driven by two promoters, one upstream of exon 1
and one upstream of exon 2. Promoter activity has been detected in a
1.8-kb fragment containing both putative promoters (26). To further
characterize this promoter region, we analyzed the 5' flanking region
of exon 2 (containing intron 1 only) for promoter activity using a
luciferase reporter assay. A 0.81-kb fragment spanning the 5' end of
intron 1 to just before the first ATG of p35 was introduced upstream of
the luciferase reporter gene in the pGL3-Basic Vector and assayed for
luciferase activity in A20 cells under nonstimulated and LPS-stimulated
conditions. No promoter activity was detected using this reporter
construct, even after LPS stimulation (data not shown). Since p35
transcripts are usually expressed at low levels (1), it is likely that
the p35 promoter is relatively weak. Therefore, we inserted the same
0.81-kb fragment into the pGL3-Enhancer Vector, which contains an SV40
enhancer downstream of the luciferase gene. Promoter activity was
assayed using this construct (Pro1) and compared with levels produced
using pGL3-Enhancer Vector alone. Surprisingly, again no promoter
activity was detected in this fragment, even after LPS stimulation
(Fig. 1
).
|
Multiple transcription start sites result in the production of different mRNA isoforms
Given that ATG2 can inhibit translation from the first ATG in the
luciferase gene, it seemed likely that ATG2 could also inhibit
translation from the first ATG in the p35 gene. It was important,
therefore, to further analyze the different isoforms of p35 for the
presence of ATG2 and/or other upstream ATGs. From previous 5' mRNA
mapping studies (25, 26), four possible mRNA isoforms can be defined
based on the position and number of ATGs upstream of ATG1 in the 5' UTR
(Fig. 2
, A and B). We have previously defined
three of these isoforms (25): type I transcripts initiate from exon 2
and contain no additional ATG sequences; type II transcripts initiate
from intron 1 and contain ATG2; and type III transcripts initiate from
exon 1 and contain an additional ATG, designated ATG3, located 63 bp
upstream of ATG1. Based on the primer extension results reported for
the A20 cell line (26), we now define a new type of mRNA isoform, the
type IV transcript, which initiates further upstream in intron 1 and
contains ATG2 and ATG4. The open reading frames (ORFs) initiated by
each upstream ATG are shown in Fig. 2
C. ATG1 encodes the
first methionine of the p35 protein. ATG2 is out-of-frame relative to
ATG1 and initiates an ORF of 40 amino acids (aa), which terminates
downstream of ATG1. ATG3 is in-frame relative to ATG1 and so initiates
an ORF containing an additional 21 aa at the N-terminus of the p35
protein. ATG4 is followed directly by a stop codon, and so initiates an
ORF of only 1 aa.
In the primer extension assay used to identify the type IV transcripts
in A20 cells (26), the primer binding region was located upstream of
ATG2 in a position unsuitable for the detection of type I, II, and III
transcripts. To determine whether these transcripts were synthesized in
A20 cells, we performed primer extension analysis using three different
primers on mRNA from nonstimulated and LPS-stimulated A20 cells (Fig. 3
). The binding regions of these three
primers are shown in Fig. 3
C. The binding region of primer 1
was located in exon 3 for detection of all isoforms of p35 mRNA, the
binding region of primer 2 was located upstream of ATG2 for detection
of both type II and type IV transcripts, and the binding region of
primer 3 spanned the exon 1/exon 2 splice junction for detection of
only type III transcripts.
|
The presence of ATG2, but not ATG3 or ATG4, in the 5' UTR of p35 transcripts inhibits translation from p35 ATG1
Our results to date suggest that the presence of ATG2 in a
transcript can inhibit translation from a downstream ATG, and that ATG2
is present in the 5' UTR of a high proportion of p35 transcripts. To
further define the role of ATG2 and the other upstream ATGs in p35
expression, we used a luciferase reporter system similar to that used
in our promoter assay to measure the effect of these multiple ATGs on
translation from ATG1. The p35 cDNA fragments containing ATG1 and
upstream ATG sequences were introduced upstream of the luciferase
reporter gene under control of the SV40 promoter in the pGL3-Control
Vector. The structure of reporter plasmids is shown in Fig. 4
. The first ATG of luciferase was
"replaced" by the ATG1 of p35 in all reporter plasmids. To
determine the effect of ATG2 and ATG4 on translation from ATG1, these
upstream ATGs were, in some constructs, mutated to ATC codons either
independently or in combination. Because ATG3 is in-frame with ATG1,
translation from this upstream ATG would introduce an additional 21 aa
at the N-terminus of the luciferase protein. Luciferase proteins with
these additional 21 aa might retain activity, and so a detectable
difference in luciferase activity might not be observed as a result of
translation from ATG3. Thus, to assay the efficiency of translation
from ATG3 we introduced a -1 frame shift upstream of ATG1 so that, as
in constructs containing ATG2, translation from ATG3 is out-of-frame
with ATG1. Reporter plasmids were transiently transfected into both A20
cells and the murine macrophage cell line RAW 264 and assayed for
luciferase activity under nonstimulated and LPS-stimulated conditions
(Fig. 4
). Luciferase levels were measured relative to the level of
luciferase produced by the pGL3-Control Vector, which contained the
SV40 promoter but no p35 5' UTR insert. Reporter plasmids containing
ATG2 (Fig. 4
; pII, pIV, and pIVa) produced little or no luciferase
activity in all cell types analyzed. When ATG2 was mutated to an ATC
codon in these plasmids (Fig. 4
; pIIa, pIVb, and pIVc, respectively),
luciferase activity was restored to the level in the pGL3-Control.
Thus, the presence of ATG2 inhibits translation from ATG1, and
luciferase production is rescued by the mutation of this ATG to an ATC.
Mutating ATG4 to an ATC codon had no effect on luciferase activity in
any plasmid tested (Fig. 4
; pIV-pIVc). Similarly, the presence or the
absence of ATG3 had no effect on luciferase activity (Fig. 4
;
pIII-pIIIc), even when in combination with a -1 frame shift (Fig. 4
;
pIIIa and pIIIb). Taken together, these results indicate that in both
nonstimulated and LPS-stimulated cells, the presence of ATG2, but not
ATG3 or ATG4, inhibits translation from ATG1 in p355' UTR/luciferase
mRNAs. This strongly suggests that only the type I and type III
transcripts (those not containing ATG2) are capable of supporting
translation of the p35 subunit.
|
promoter. Stable transfectants were generated in
the RAW 264 cell line, which after LPS stimulation produces high levels
of p40 mRNA but little or no detectable p35 mRNA. Expression levels of
the p35 transgene were similar in all transfectants and undetectable in
untransfected RAW 264 cells, as measured by Northern blot hybridization
(Fig. 5
production from spleen cells (Fig. 5
production,
consistent with the fact that endogenous p35 levels in this cell line
are too low to contribute to IL-12 production. Only the supernatants
from transfectants 35.I and 35.III were capable of inducing high levels
of IFN-
. This IFN-
induction was a result of the presence of
bioactive IL-12 in supernatants, since IFN-
production was
completely abrogated by the addition of a neutralizing anti-IL-12
mAb. This confirmed our previous findings that the presence of ATG2 in
p35 mRNA almost completely inhibits translation from ATG1. In contrast,
the presence of ATG3 in transfectant 35.III had no effect on the
production of p35, since IL-12 levels in this transfectant were similar
to those secreted by transfectant 35.I. This was consistent with our
luciferase assay result, which indicated that no translation occurred
from ATG3. There was a small possibility that in transfectant 35.III,
translation initiated from ATG3 but that the additional 21 aa at the
N-terminus of the p35 protein had no effect on p35 secretion/function.
To exclude this possibility, ATG1 was mutated to an alanine codon (GCG)
in construct 35.III to make construct 35.IIIa. No IL-12 activity was
detected in the supernatant from this transfectant, confirming our
previous observation that initiation of translation does not occur from
ATG3.
|
Our bioassay results suggest that biologically significant amounts of the p35 subunit and IL-12 heterodimer can only be produced when type I and type III transcripts are present. By primer extension assay, however, we have shown that in both nonstimulated and LPS-stimulated A20 cells, the major type of p35 mRNA synthesized is the type IV transcript. This apparent paradox can be explained if we consider the possibility that minor start sites that represent transcripts not containing ATG2 may have been missed by primer extension analysis. We therefore sought to further analyze the p35 mRNA populations of these cells using the RACE method of 5' mRNA mapping (32) to identify any minor start sites. To ensure the selective amplification of full-length cDNA products, we used the cap-dependent SMART cDNA synthesis method, which has been used in conjunction with RACE for mapping the 5' ends of other genes (33, 34).
This RACE method was used to characterize the mRNA populations of
nonstimulated and LPS-stimulated A20 cells and bmDC, which are
physiological producers of IL-12 (4, 35). To reduce the likelihood that
our results were biased by PCR amplification, two independent
experiments were performed on the same mRNA sample, and similar results
were obtained in each. Approximately 6070 clones in total from each
cell type were analyzed and sequenced (Fig. 6
). Multiple start sites, including the
+95, +192, and +211 start sites identified by primer extension, were
found in all cell types tested. These start sites were clustered within
intron 1 (from +95 to +278) or within exon 2 (from +311 to +347) and
could be classified according to the position of the start site
relative to ATG2: 1) those start sites upstream of ATG2 that result in
type II or type IV transcripts (nonfunctional mRNA for p35
translation), and 2) those start sites downstream of ATG2 that result
in type I transcripts (functional mRNA for p35 translation). In
nonstimulated A20 cells, all transcripts initiated upstream of ATG2
(type II or type IV transcripts). After LPS stimulation, however, the
proportion of type I transcripts was up-regulated to 7.0% of the p35
mRNA population. In nonstimulated bmDC, 1.7% of transcripts initiated
from downstream of ATG2, and this was up-regulated to 16.4% after LPS
stimulation. Some of these transcripts, particularly type I
transcripts, were not previously detected in A20 cells because 5'
mapping in this cell line was performed using the less sensitive primer
extension method. These results indicate that in both A20 and bmDC, LPS
stimulation up-regulates the proportion of type I transcripts
(functional mRNA for p35 translation) within the p35 mRNA population.
|
p35 transcription can initiate from exon 1 after LPS stimulation
We had previously identified the presence of type III transcripts
in WEHI-3D cells (25), yet by RACE 5' mapping in A20 and bmDC, no
transcripts of this type were detected. We considered the possibility
that in these cells, type III transcripts might represent an even
smaller fraction of the mRNA population than do type I transcripts. To
explore this possibility, we performed semiquantitative RT-PCR on mRNA
from nonstimulated and LPS-stimulated A20 and bmDC (Fig. 7
). To characterize the p35 mRNA
populations in these cells, p35 sense primers were chosen whose binding
sites were located either upstream of ATG1 to identify all p35 isoforms
(Fig. 7
, p35 IIV), upstream of ATG2 to identify only the type II or
type IV isoforms (Fig. 7
, p35 II/IV), or upstream of ATG3 to identify
only type III isoforms (Fig. 7
, p35 III). Type II and type IV
transcripts cannot be differentiated using these primers. mRNA levels
of p40 and the housekeeping gene HPRT were also determined. Transcript
levels were determined by phosphorimager analysis and normalized to
HPRT levels.
|
By RACE and RT-PCR, we have shown that LPS-stimulated bmDC can produce
functional mRNA for translation of p35 (type I and type III
transcripts). These cells also synthesize p40 transcripts after LPS
stimulation (Fig. 7
) and thus can produce IL-12 heterodimer. A20 cells
differ from bmDC in their ability to produce IL-12 because they do not
synthesize p40 mRNA, even after LPS stimulation (Fig. 7
). However,
because A20 and bmDC have a similar pattern of p35 expression, and
because it has been shown that p35 and p40 are regulated independently
(11, 12, 13, 14), A20 is a good and useful model for the study of p35 gene
regulation.
Since the type I-IV, type II/IV, and type III mRNA isoforms were detected using different primer pairs, we cannot quantify the relative proportions of these transcripts in the p35 mRNA population from these RT-PCR results. However, our RACE data indicate that type II/IV transcripts are a significant portion of the p35 mRNA population before and after LPS stimulation in both cell types. Furthermore, the absence of type III transcripts in our RACE pool of 5' clones suggests that type III transcripts are a rare population of mRNAs in LPS-stimulated A20 and bmDC. Taken together with our RACE and primer extension data, these RT-PCR results clearly demonstrate that nonstimulated cells synthesize transcripts that initiate almost entirely from upstream of ATG2 (type II and type IV transcripts, nonfunctional for p35 translation), and upon LPS stimulation there is a shift in transcription initiation so that cells synthesize a higher proportion of transcripts that do not contain ATG2 (type I and type III transcripts, functional mRNA for p35 translation). These type I and type III mRNA isoforms, according to our luciferase assay and IL-12 bioassay results, can support translation of the p35 subunit and its incorporation into the IL-12 heterodimer.
| Discussion |
|---|
|
|
|---|
IL-12 gene regulation occurs at many levels. Coexpression of both subunits in the same cell is required to produce bioactive IL-12 heterodimer (10), yet these subunits are controlled independently (11, 12, 13, 14). We have shown here that the p35 gene is highly regulated at the level of translation by the presence or the absence of an upstream ATG in the 5' UTR. The majority of genes containing upstream ATGs are cytokines, cytokine receptors, growth factors, transcription factors, signal transduction molecules, and proto-oncogenes (31). These molecules, when overproduced, might constitute a potential danger to the host. Therefore, it seems likely that the reason why IL-12 expression is so tightly controlled is to ensure that enough safeguards are in place to prevent overproduction of this potentially dangerous cytokine. Furthermore, the independent regulation of the IL-12 subunits allows, in theory, for safe expression of only one subunit at a time (2, 16, 17, 38, 39). Thus, it is possible that during development, the IL-12 subunits are expressed one at a time to generate self tolerance without putting the host in the position of having to achieve immunological tolerance to a cytokine that itself counteracts tolerance (40).
We have demonstrated p35 promoter activity upstream of exon 2. This promoter activity is quite weak compared with that of the p40 gene (18, 19, 23) (M. Tone, unpublished observations). This may reflect an additional mechanism to prevent overproduction of IL-12. However, this would seem a disadvantage for a cell when it needs to rapidly induce expression of the IL-12 protein. The translational control of the p35 subunit may play a role here, whereby the continued synthesis of untranslatable p35 message would maintain the transcriptional locus in an open and active state, with the basal transcription machinery and most or all transcription factors already recruited and in place. The cell would only need to shift its site of transcriptional initiation so as to synthesize type I and/or type III transcripts (functional mRNA for p35 translation). Maintaining the transcription locus in an open form has also been suggested as a mechanism for the rapid induction of transcription in the IL-2 gene (41, 42). In resting T cells, the RNA polymerase is "paused" but not active at the start site of transcription, and only becomes active upon assembly of other enhancer/promoter elements upon T cell activation.
Synthesis of type II and type IV transcripts seems to be controlled by
a TATA-less promoter. Promoter activity upstream of exon 2 is not
dependent upon the presence of the TATA sequence (Fig. 1
, Pro3), and in
addition, this typical TATA sequence is located at position +281 to
+287 in the p35 gene, far downstream of the type II and type IV
transcription start sites. However, after LPS stimulation,
transcription can initiate from three start sites in exon 2, and the
major start site is located at position +311, 30 bp downstream of the
TATA box. It is possible, therefore, that the TATA box functions only
after LPS stimulation and may play a role in the switching of
transcriptional initiation to downstream of ATG2. It is of interest
that a structurally related cytokine, IL-6 (25, 43), contains a
functional TATA-like sequence in a position similar to that of the TATA
box in p35 (25). Thus, it is likely that the TATA box in the p35 gene
was at one time functional and may still continue to play a
well-defined role in the regulation of p35 gene expression.
The translational mechanism of p35 regulation defined here can explain
why, in some cases, the coexpression of p35 and p40 messages is not
sufficient to produce IL-12 heterodimer (16, 17, 38, 39). For example,
when macrophages from BALB/c mice are infected by Salmonella
dublin, there is a significant up-regulation of both p35 and p40
mRNA (15). However, while the p40 subunit was readily detected in
cultures of infected macrophages, no IL-12 protein was observed (38).
Pretreatment of macrophages with IFN-
, however, led to an increase
in IL-12 protein production after Salmonella infection.
Thus, it is likely that in this system, IFN-
can induce a shift in
transcription initiation in p35 so that the type I and/or type III
transcripts (functional mRNA for p35 translation) are synthesized.
Similarly, it has been reported that in microglia (17), the resident
macrophage of the brain, and astrocytes (39), the major glial cell type
in the central nervous system, LPS stimulation induces the expression
of both p35 and p40 mRNA but not that of IL-12 protein. Only after a
combination of LPS/IFN-
treatments can any IL-12 heterodimer be
detected in these cell cultures.
We have shown previously that LPS stimulation was sufficient to
up-regulate the transcription of p35 type I and type III mRNA isoforms
from the macrophage cell line WEHI-3D (25), and here we report a
similar finding in A20 cells and bmDC. However, in the case of
Salmonella-infected macrophages and LPS-stimulated
astrocytes and microglia, a single stimulus was not sufficient to drive
the production of IL-12 from these cells. Only the combined treatment
of LPS/IFN-
could induce IL-12 secretion. Thus, the mechanism
driving the switch in p35 transcription to make type I and/or type III
transcripts is likely to depend on both the nature of the stimulus and
the type of responding cell. In addition, the importance of CD40
ligation for the induction of IL-12 from APCs has been demonstrated
(7), and its role, if any, in the switching of transcription initiation
in p35 should be examined. We expect that CD40 ligation will induce a
similar change in the type of p35 message transcribed by APCs.
Although translational control is a potent mechanism of gene regulation, we cannot rule out the possibility that the type II and type IV transcripts might have another function aside from serving as a buffer of untranslatable message to prevent the overproduction of the p35 subunit. For example, the 40-aa peptide encoded by the ATG2 ORF may have a specific function unrelated to p35 translational control. However, database searches have not revealed any striking similarities with known proteins (J. Babik, unpublished observation).
Interestingly, the presence of ATG2 in the 5' UTR of p35 transcripts is conserved between human (44) and murine genes. The favorable context for translation initiation (30) around murine ATG2 is also exactly conserved in the human gene, so it is likely that translation occurs from this upstream ATG in human p35 mRNA. However, in the human gene, ATG2 is in-frame with the p35 protein, resulting in a potential additional 34-aa fragment at the N-terminus of the p35 signal peptide. In cells transfected with human p35 cDNA, translation of p35 occurs from constructs without the in-frame ATG2, and so the presence of this upstream ATG is not necessary for production of the p35 subunit (44). The effect of the in-frame ATG2 on the translational efficiency of human p35 transcripts has not been reported. It is possible that, given efficient translation from ATG2, the resulting modification of the signal peptide may affect the secretion and/or targeting of human p35. It has been suggested that this 34-aa sequence may be important for generating a membrane-bound form of human p35 (44), and indeed, human IL-12 has been shown to exist in a membrane-bound form on the surface of macrophages (45). Taken together, the regulatory mechanisms involved in human p35 expression remain poorly defined and demand further investigation.
Conventional methods of analyzing p35 expression levels (i.e., RT-PCR or Northern blot hybridization) cannot distinguish between the different isoforms of p35 and so do not accurately reflect the amount of translatable p35 message. Our results undermine the importance of analyzing p35 expression at the molecular level when studying IL-12 gene expression. Further investigation into the transcriptional and translational mechanisms of p35 gene regulation and the way in which these two processes interact will enhance our understanding of IL-12 gene expression.
| Acknowledgments |
|---|
| Footnotes |
|---|
2 Address correspondence and reprint requests to Dr. Masahide Tone, Sir William Dunn School of Pathology, South Parks Rd., Oxford, United Kingdom OX1 3RE. E-mail address: ![]()
3 Abbreviations used in this paper: UTR, untranslated region; bmDC, bone marrow-derived dendritic cells; RACE, rapid amplification of complementary deoxyribonucleic acid ends; EF-1
, elongation factor-1
; ORF, open reading frame; aa, amino acids; HPRT, hypoxanthine phosphoribosyltransferase. ![]()
Received for publication September 21, 1998. Accepted for publication January 6, 1999.
| References |
|---|
|
|
|---|
production by T helper 1 cells. Eur. J. Immunol. 26:659.[Medline]
by an intracellular parasite and induces resistance in T cell-deficient hosts. Proc. Natl. Acad. Sci. USA 90:6115.
of lipopolysaccharide-inducible p35 and p40 genes. Blood 86:646.
B half-site. Mol. Cell. Biol. 15:5258.[Abstract]
in monocytic cells. J. Exp. Med. 183:147.
production and lethality in lipopolysaccharide-induced shock in mice. Eur. J. Immunol. 25:672.[Medline]
-inducing factor) gene expression. J. Immunol. 159:6156.[Abstract]
This article has been cited by other articles:
![]() |
C. Richter, M. H. S. Juan, J. Will, R. P. Brandes, U. Kalinke, S. Akira, J. M. Pfeilschifter, M. Hultqvist, R. Holmdahl, and H. H. Radeke Ncf1 Provides a Reactive Oxygen Species-Independent Negative Feedback Regulation of TLR9-Induced IL-12p70 in Murine Dendritic Cells J. Immunol., April 1, 2009; 182(7): 4183 - 4191. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Rival, V. A. Guazzone, W. von Wulffen, H. Hackstein, E. Schneider, L. Lustig, A. Meinhardt, and M. Fijak Expression of co-stimulatory molecules, chemokine receptors and proinflammatory cytokines in dendritic cells from normal and chronically inflamed rat testis Mol. Hum. Reprod., December 1, 2007; 13(12): 853 - 861. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Heo, T. K. Mondal, D. Gao, J. Kasten-Jolly, H. Kishikawa, and D. A. Lawrence Posttranscriptional Inhibition of Interferon-Gamma Production by Lead Toxicol. Sci., March 1, 2007; 96(1): 92 - 100. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saito, M. Matsuura, and Y. Hirai Regulation of Lipopolysaccharide-Induced Interleukin-12 Production by Activation of Repressor Element GA-12 through Hyperactivation of the ERK Pathway. Clin. Vaccine Immunol., August 1, 2006; 13(8): 876 - 883. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, X. Guan, T. Tamura, K. Ozato, and X. Ma Synergistic Activation of Interleukin-12 p35 Gene Transcription by Interferon Regulatory Factor-1 and Interferon Consensus Sequence-binding Protein J. Biol. Chem., December 31, 2004; 279(53): 55609 - 55617. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Stassen, H. Jonuleit, C. Muller, M. Klein, C. Richter, T. Bopp, S. Schmitt, and E. Schmitt Differential Regulatory Capacity of CD25+ T Regulatory Cells and Preactivated CD25+ T Regulatory Cells on Development, Functional Activation, and Proliferation of Th2 Cells J. Immunol., July 1, 2004; 173(1): 267 - 274. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sheng, C.-H. Tsai-Morris, and M. L. Dufau Cell-specific and Hormone-regulated Expression of Gonadotropin-regulated Testicular RNA Helicase Gene (GRTH/Ddx25) Resulting from Alternative Utilization of Translation Initiation Codons in the Rat Testis J. Biol. Chem., July 18, 2003; 278(30): 27796 - 27803. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goriely, D. Demonte, S. Nizet, D. De Wit, F. Willems, M. Goldman, and C. Van Lint Human IL-12(p35) gene activation involves selective remodeling of a single nucleosome within a region of the promoter containing critical Sp1-binding sites Blood, June 15, 2003; 101(12): 4894 - 4902. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mirani, I. Elenkov, S. Volpi, N. Hiroi, G. P. Chrousos, and T. Kino HIV-1 Protein Vpr Suppresses IL-12 Production from Human Monocytes by Enhancing Glucocorticoid Action: Potential Implications of Vpr Coactivator Activity for the Innate and Cellular Immunity Deficits Observed in HIV-1 Infection J. Immunol., December 1, 2002; 169(11): 6361 - 6368. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. D. Joshi, D. V. Kalvakolanu, J. D. Hasday, R. J. Hebel, and A. S. Cross IL-18 Levels and the Outcome of Innate Immune Response to Lipopolysaccharide: Importance of a Positive Feedback Loop with Caspase-1 in IL-18 Expression J. Immunol., September 1, 2002; 169(5): 2536 - 2544. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kozak Constraints on reinitiation of translation in mammals Nucleic Acids Res., December 15, 2001; 29(24): 5226 - 5232. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kollet, C. Witek, J. D. Gentry, X. Liu, S. D. Schwartzbach, and T. M. Petro Deletional Analysis of the Murine IL-12 p35 Promoter Comparing IFN-{gamma} and Lipopolysaccharide Stimulation J. Immunol., November 15, 2001; 167(10): 5653 - 5663. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Qadir, A. Metwali, A. M. Blum, J. Li, D. E. Elliott, and J. V. Weinstock TGF-beta and IL-10 regulation of IFN-gamma produced in Th2-type schistosome granulomas requires IL-12 Am J Physiol Gastrointest Liver Physiol, October 1, 2001; 281(4): G940 - G946. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Goodridge, E. H. Wilson, W. Harnett, C. C. Campbell, M. M. Harnett, and F. Y. Liew Modulation of Macrophage Cytokine Production by ES-62, a Secreted Product of the Filarial Nematode Acanthocheilonema viteae J. Immunol., July 15, 2001; 167(2): 940 - 945. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Grazia Cappiello, F. S. Sutterwala, G. Trinchieri, D. M. Mosser, and X. Ma Suppression of IL-12 Transcription in Macrophages Following Fc{{gamma}} Receptor Ligation J. Immunol., April 1, 2001; 166(7): 4498 - 4506. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang-Hoover, A. Sutton, and J. Stein-Streilein CD40/CD40 Ligand Interactions Are Critical for Elicitation of Autoimmune-Mediated Fibrosis in the Lung J. Immunol., March 1, 2001; 166(5): 3556 - 3563. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Walter, N. Kajiwara, P. Karanja, M. Castro, and M. J. Holtzman Interleukin 12 P40 Production by Barrier Epithelial Cells during Airway Inflammation J. Exp. Med., February 5, 2001; 193(3): 339 - 352. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Goriely, B. Vincart, P. Stordeur, J. Vekemans, F. Willems, M. Goldman, and D. De Wit Deficient IL-12(p35) Gene Expression by Dendritic Cells Derived from Neonatal Monocytes J. Immunol., February 1, 2001; 166(3): 2141 - 2146. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Malmgaard, S. R. Paludan, S. C. Mogensen, and S. Ellermann-Eriksen Herpes simplex virus type 2 induces secretion of IL-12 by macrophages through a mechanism involving NF-{kappa}B J. Gen. Virol., December 1, 2000; 81(12): 3011 - 3020. [Abstract] [Full Text] |
||||
![]() |
M. Quinones, S. K. Ahuja, P. C. Melby, L. Pate, R. L. Reddick, and S. S. Ahuja Preformed Membrane-Associated Stores of Interleukin (Il)-12 Are a Previously Unrecognized Source of Bioactive IL-12 That Is Mobilized within Minutes of Contact with an Intracellular Parasite J. Exp. Med., August 21, 2000; 192(4): 507 - 516. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tone, M. J. Powell, Y. Tone, S. A. J. Thompson, and H. Waldmann IL-10 Gene Expression Is Controlled by the Transcription Factors Sp1 and Sp3 J. Immunol., July 1, 2000; 165(1): 286 - 291. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Carra, F. Gerosa, and G. Trinchieri Biosynthesis and Posttranslational Regulation of Human IL-12 J. Immunol., May 1, 2000; 164(9): 4752 - 4761. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. C. Ulett, N. Ketheesan, and R. G. Hirst Cytokine Gene Expression in Innately Susceptible BALB/c Mice and Relatively Resistant C57BL/6 Mice during Infection with Virulent Burkholderia pseudomallei Infect. Immun., April 1, 2000; 68(4): 2034 - 2042. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |