The JI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     
 

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, C. S.
Right arrow Articles by Lukacher, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, C. S.
Right arrow Articles by Lukacher, A. E.
The Journal of Immunology, 1999, 162: 3933-3941.
Copyright © 1999 by The American Association of Immunologists

Cross-Recognition of Two Middle T Protein Epitopes by Immunodominant Polyoma Virus-Specific CTL1

Christopher S. Wilson*, Janice M. Moser*, John D. Altman{ddagger}, Peter E. Jensen* and Aron E. Lukacher2,*

Departments of * Pathology and {dagger} Microbiology and Immunology and {ddagger} Emory Vaccine Center, Emory University School of Medicine, Atlanta, GA 30322


   Abstract
Top
 Abstract
Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We recently identified the immunodominant epitope for polyoma virus-specific CTL as the Dk-associated peptide MT389–397 derived from the middle T (MT) viral oncoprotein. Another Dk-restricted peptide corresponding to residues 236–244 of MT was recognized by nearly all MT389–397-reactive CTL clones, but required concentrations at least 2 logs higher to sensitize syngeneic target cells for lysis. Except for identity at the three putative Dk-peptide anchor residues, MT236–244 shares no homology with MT389–397. Using a novel europium-based class I MHC-peptide binding immunoassay, we determined that MT236–244 bound Dk 2–3 logs less well than MT389–397. Infection with a mutant polyoma virus whose MT is truncated just before the MT389–397 epitope or immunization with MT389–397 or MT236–244 peptides elicited CTL that recognized both MT389–397 and MT236–244. Importantly, infection with a polyoma virus lacking MT389–397 and mutated in an MT236–244 Dk anchor position induced polyoma virus-specific CTL recognizing neither MT389–397 nor MT236–244 epitopes. Despite predominant usage of the Vß6 gene segment, MT389–397/MT236–244 cross-reactive CTL clones possess diverse complementarity-determining region 3ß domains; this is functionally reflected in their heterogeneous recognition patterns of alanine-monosubstituted MT389–397 peptides. Using Dk/MT389–397 tetramers, we directly visualized MT236–244 peptide-induced TCR down-modulation of virtually all MT389–397-specific CD8+ T cells freshly explanted from polyoma-infected mice, suggesting that a single TCR recognizes both Dk-restricted epitopes. The availability of immunodominant epitope-specific CTL capable of recognizing a second epitope in MT, a viral protein essential for tumorigenesis, may serve to amplify the CTL response to the immunodominant epitope and prevent the emergence of immunodominant epitope-loss viruses and virus-induced tumors.


   Introduction
Top
 Abstract
 Introduction
Materials and Methods
 Results
 Discussion
 References
 
CD8+ CTL are critical components of the adaptive immune response to virus infections. The ligands for Ag receptors on antiviral CD8+ T cells (TCRs) are complexes of class I MHC molecules and 8- to 10-amino acid peptides that are usually derived from endogenously synthesized viral proteins (1, 2). The ligand specificity of the TCR is determined by the composition of its heterodimeric {alpha}ß glycoprotein chains. Each of these chains is created by recombining gene segments encoding variable (V), diversity (D; for ß-chains), joining (J), and constant (C) elements. The highest level of sequence diversity in the TCR resides in its complementarity determining region 3 (CDR3),3 the junctional domain created by rearrangement of individual V, D, and J elements as well as by the introduction of random, template-independent, N-nucleotides (3, 4). The recently solved crystal structures of TCR bound to class I MHC/peptide ligands confirm predictions that CDR3 amino acids primarily make contact with the antigenic peptide, but also indicate interactions between the peptide and CDR1 and CDR2 regions of the V{alpha} and Vß genes (5, 6).

CD8+ CTL typically express clonally distributed TCRs that possess exquisite specificity for MHC/peptide ligands. A number of recent studies, however, have documented degenerate recognition of MHC/peptide complexes by individual TCRs expressed by class I MHC- and class II MHC-restricted T cells; examples range from T cell recognition of dissimilar peptides by the same MHC molecules to recognition of identical peptides bound to different MHC molecules (7, 8, 9, 10, 11, 12). Perhaps the best illustration of degenerate peptide/MHC recognition by single TCRs takes place during positive selection in the thymus, where the interaction of individual TCRs with broad arrays of MHC-bound self-peptides is required for shaping a diverse T cell repertoire (13, 14, 15, 16, 17, 18). Homology in sequence or structure between self-T cell epitopes and those of infectious organisms, referred to as molecular mimicry, has been proposed as a mechanism for triggering autoimmunity (19, 20, 21, 22). Allen and co-workers recently demonstrated that two structurally dissimilar class II MHC-restricted epitopes within a single protein were cross-reactive at the single T cell level, a phenomenon they termed intramolecular mimicry (23). Whether intramolecular epitope mimicry also occurs among class I MHC-restricted T cells has not been determined.

T cells are essential for conferring protection against tumors induced by the murine Papovavirus, polyoma virus. We recently reported that deletion of polyoma virus-specific CD8+ CTL bearing Vß6 TCRs by the endogenous Mtv-7-encoded superantigen renders H-2k mice highly susceptible to polyoma virus-induced tumors (24). In resistant H-2k mice, this CTL response is heavily dominated by CTL directed to a Dk-restricted nine amino acid epitope, MT389–397, derived from the viral MT protein (25). Tumor-susceptible Mtv-7+, H-2k mice possess an approximately 20-fold lower frequency of CTL precursors specific for the MT389–397 epitope compared with syngeneic resistant mice. MT is a 421-amino acid type II integral membrane protein that associates with and activates an array of host cell enzymes, including Src family tyrosine kinases, phosphatidylinositol 3-kinase, protein phosphatase 2A, and phospholipase C-{gamma}, and interacts with the Shc adaptor proteins and proteins of the 14-3-3 family (reviewed in 26). MT is necessary and sufficient for cellular transformation, and wild-type MT is essential for tumor induction and efficient virion assembly (27, 28, 29). Given its constitutive expression by cells infected and transformed by polyoma virus, MT is an optimal target protein for CTL-mediated protection against polyoma oncogenesis.

Here, we describe intramolecular mimicry between MT389–397 and another Dk-restricted MT epitope, MT236–244, by polyoma virus-specific CD8+ CTL. Despite the lack of sequence homology, other than the three predicted MHC anchor positions, the MT236–244 epitope is recognized by virtually all MT389–397-specific CTL clones and MT389–397-specific splenic CD8+ T cells from acutely infected mice. We show at the level of CTL clones and primary effector CD8+ T cells that a single TCR recognizes both epitopes, and furthermore, that this cross-reactivity is mediated by polyoma virus-specific CTL bearing diverse TCRs. The potential contributions of such intramolecular mimicry to antiviral and antitumor immunity by CD8+ CTL are discussed.


   Materials and Methods
Top
 Abstract
 Introduction
 Materials and Methods
Results
 Discussion
 References
 
Animals

C57BR/cdJ and C3H/HeSnJ were purchased from The Jackson Laboratory (Bar Harbor, ME). C3H/HeNCr and C3H/BiDaCr mice were purchased from the Frederick Cancer Research and Development Center of the National Cancer Institute (Frederick, MD).

Viruses and virus inoculation

The wild-type polyoma virus strain A2 and the mutant polyoma virus strain PTA1387T were molecularly cloned and plaque purified, and virus stocks were prepared using primary baby mouse kidney cells as previously described (25). The polyoma virus strain PTA1387T encodes an MT protein lacking the carboxyl-terminal 37 amino acids (30). The PTA1387T.MT237RH mutation was introduced using the Quick Change Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) according to the manufacturer’s instructions, with the following primers: CAGCTACCAGTCACCGCCTAAGACTG (forward) and CAGTCTTAGGCGGTGACTGGTAGCTG (reverse). Each mouse was inoculated s.c. in hindfootpads with 2 x 106 plaque-forming units of virus.

Cell lines

AG104A cells were derived from a spontaneous tumor of C3H/HeN (H-2k; provided by Dr. H. Schreiber, University of Chicago, Chicago, IL). L929 (H-2k) cells were obtained from the American Type Culture Collection (Manassas, VA). Cells lines were maintained in DMEM containing 10% FBS. L929 cells are nonpermissive, and AG104A cells are highly permissive for productive infection by polyoma virus (data not shown).

Synthetic peptides

Peptides were synthesized by the solid phase method on a Symphony/Multiplex Peptide Synthesizer (Rainin, Woburn, MA) with F-moc chemistries. HPLC analysis showed that peptides were 90–95% pure. Except for the MT389–397 peptide with alanine substituted at MT residue 393, which was solubilized in 100% DMSO, peptide stock solutions were prepared in water, all at a concentration of 3 mM, and stored at -20°C. Peptides were diluted in serum-containing medium immediately before use in cytotoxicity assays. The following peptides were used in this study: T6–14 (SRADKERLL), MT102–109 (QRFCRMPL), MT236–244 (SRRLRLPSL), MT389–397 (RRLGRTLLL), gag88–96 (RRKGKYTGL), and Flu NP50–57 (SDYEGRLI).

Isolation of polyoma virus-specific CTL

Protocols for establishing polyoma-specific T cell clones and lines were described in detail previously (24). Briefly, draining popliteal and inguinal lymph node cells at approximately 2 wk postinfection were cocultured with virus-infected, irradiated, syngeneic splenocytes. T cells were cloned by limiting dilution from day 7 in vitro secondary or tertiary cultures. T cell lines were maintained by weekly restimulation with virus-infected, irradiated, syngeneic splenocytes.

51Cr release assay

Polyoma virus-infected AG104A and peptide-pulsed AG104A and L929 51Cr-labeled target cells were prepared as previously described (25). 51Cr-labeled target cells were aliquoted at 5000 cells/well into either V- or U-bottom 96-well microtiter plates (Costar, Cambridge, MA). For experiments using virus-infected or peptide-pulsed targets, 100 µl of target cells and 100 µl of T cells were cocultured in each well. In certain experiments, 50 µl of peptides were added at 3 times their final concentration to wells containing 50 µl of 51Cr-labeled cells, then after 1-h incubation at 37°C, 50 µl of T cells were added. The assay medium was Iscove’s modified Dulbecco’s medium and 10% FBS. After a 4-h incubation at 37°C, half the volume of each well was removed and counted in a 1470 Wallac Wizard gamma counter (Turku, Finland).

For cold target inhibition assays, 51Cr-labeled L929 cells were pulsed with MT389–397 peptide at a concentration of 0.1 µM for 1.5 h at 37°C, washed extensively to remove unbound peptide, and aliquoted at 5000 cells/well into flat-bottom 96-well microtiter plates (Costar). Unlabeled competitor L929 cells pulsed with MT389–397, MT236–244, or Flu NP50–57 peptides at 100 µM each were added at ratios of 1:1, 3:1, or 5:1 with respect to the labeled targets. CTL clones were then added at an E:T cell ratio of 5:1, plates were incubated for 4 h at 37°C, and supernatant was counted.

Spontaneous 51Cr release from target cells in all assays was 10–20% of the total detergent lysis. The percent specific lysis was calculated as follows: [(51Cr release with effector cells - spontaneous 51Cr release)/(total 51Cr release with 1% Triton X-100 - spontaneous 51Cr release)] x 100. The percent specific lysis values represent the mean values of quadruplicate wells. SEMs were always <5% of the mean values and are omitted.

Europium fluoroimmunoassay for peptide binding to purified Dk molecules

As described in detail previously (31), purified Dk was incubated with a biotinylated derivative of MT102–109 (0.1 µM) and various concentrations of unlabeled competitor peptides. Dk-biotin-MT102–109 complexes were captured in wells coated with 16-1-2N mAb, incubated with europium-labeled streptavidin, and quantified by time-resolved fluorescence. The data points represent the mean fluorescent counts per second/1000 (counts per second x 10-3) of duplicate or triplicate samples.

RNA extraction, cDNA synthesis, PCR, and direct sequencing of PCR products

Viable CTL clones at 6–8 days after Ag restimulation were isolated on LSM (Organon Teknika, Durham, NC) step gradients. Cytoplasmic RNA was extracted from 1–3 x 106 T cells with TRIzol reagent (Life Technologies, Gaithersburg, MD), and cDNA was synthesized from approximately 1 µg of total RNA with the Superscript Preamplification System (Life Technologies). PCR amplification was conducted on 1 µl of cDNA with either a Vß-specific sense primer and consensus Cß antisense primer or a V{alpha}-specific sense primer and consensus C{alpha} antisense primer, using conditions described previously (32). The following primers (listed 5' to 3') were used for PCR amplification and sequence determination: Vß6, CTCTCACTGTGACATCTGCC; Cß-external, CCAGAAGGTAGCAGAGACCC; and Cß-internal, CTTGGGTGGAGTCACATTTCTC. PCR products were gel purified and directly sequenced with the Cß internal primer and the ABI PRISM Dye Terminator Cycle Sequencing Ready Reaction Kit (Perkin-Elmer, Foster City, CA) according to the manufacturer’s instructions. Extension products were passed through Micro Bio-Spin 30 chromatography columns (Bio-Rad, Hercules, CA) to remove unincorporated dye terminators, and the samples were spun to dryness in a vacuum centrifuge. Samples were subsequently sequenced on the ABI Prism 377 DNA Sequencer (Perkin-Elmer). TCR sequencing for each CTL clone was performed on the products of three independent PCR reactions.

Preparation of H-2Dk tetramers

Full-length Dk cDNA was PCR amplified from cDNA prepared from L929 cells using the 5' primer CCGCTCGAGATGGGGGCGATGGTACCA and the 3' primer GCTCTAGATCACGCTTTACAATCTGGGAG and digested with XbaI and XhoI (sites underlined, respectively). DNA encoding the soluble domain of H-2Dk, residues 1–274, was then PCR amplified using the 5' primer GGAATTCCATATGGGACCACATTCACTAAGATATTTCGAGACCGTCGTG and the 3' primer CGGGATCCGGACGGAGGAGGCTCCCA, digested with NdeI and BamHI (sites underlined, respectively), and cloned into pET23-BSP (33). The Escherichia coli strain BL21 (DE3) was transformed with the pET23-Dk-BSP plasmid, and expression of Dk was induced with isopropyl ß-D-thiogalactoside (IPTG). Human ß2m was expressed in the same cell line using the pHN1-ß2m plasmid (33). The folding reaction was performed with the MT389–397 peptide. Folding, purification, and biotinylation were performed as previously described (34). Tetramers were made by mixing biotinylated Dk/MT389–397 monomers with allophycocyanin-conjugated streptavidin (Molecular Probes, Eugene, OR) in a 4:1 molar ratio.

Flow cytometry

Single cell suspensions of spleen were prepared, erythrocytes were lysed (RBC lysing buffer, Sigma, St. Louis, MO), and 1 x 106 cells were stained in phenol red-free RPMI 1640 (Life Technologies) containing 2% FBS and 0.01% sodium azide (FACS buffer) for 1 h at 4°C, followed by three washes in FACS buffer and fixation in PBS containing 1% paraformaldehyde. Samples were acquired on a FACSCalibur (Becton Dickinson, San Jose, CA), and data were analyzed using FlowJo software (Tree Star, San Carlos, CA).

Intracellular IFN-{gamma} staining

RBC-lysed spleen cells were cultured for 7 h in 96-well flat-bottom microtiter plates (Costar) at 1 x 106 cells/well in 0.2 ml/well Iscove’s modified Dulbecco’s medium (Life Technologies) containing 10% FBS, 50 µM 2-ME, and penicillin/streptomycin and supplemented with 1 µl/ml brefeldin A (Golgiplug, PharMingen, San Diego, CA), 50 U/ml human rIL-2 (PharMingen), and synthetic peptides at the indicated concentrations. Cells were then surface-stained with phycoerythrin-conjugated monoclonal rat anti-mouse CD8{alpha} Ab (Caltag, South San Francisco, CA) and allophycocyanin-conjugated Dk/MT389 tetramers. After washing, cells were permeabilized and stained for intracellular IFN-{gamma} with FITC-conjugated monoclonal rat anti-mouse IFN-{gamma} antibody (clone XMG1.2; PharMingen) using the Cytofix/Cytoperm kit according to the manufacturer’s instructions (PharMingen). No intracellular staining was seen with FITC-conjugated rat IgG1 isotype control Ab (PharMingen; data not shown).


   Results
Top
 Abstract
 Introduction
 Materials and Methods
 Results
Discussion
 References
 
Cross-recognition of two nonoverlapping MT epitopes by anti-polyoma CTL

We previously reported that H-2k mice resistant to tumors induced by polyoma virus mount a strong immunodominant CTL response to the Dk-restricted MT389–397 epitope derived from the MT protein of the virus (25). In the course of screening four potential Dk-binding peptides derived from polyoma early region proteins as candidate epitopes for anti-polyoma CTL cloned lines, another MT-derived peptide, MT236–244, was found to sensitize syngeneic target cells for lysis by nearly all the MT389–397-reactive CTL clones. This cross-reactivity, however, was revealed only at peptide concentrations approximately 2 logs higher than that of the immunodominant MT389–397 peptide. Fig. 1Go confirms and extends these observations using two representative polyoma-virus specific CTL clones, 8-1 and 24-5. Each of the four MT peptides, selected on the basis of a predicted consensus motif for Dk-binding peptides (8–9 mer peptides with P2 = basic, P5 = basic, carboxyl-terminal leucine) (25), bound Dk (Fig. 2Go). Except for identity at each of the three putative Dk anchor residues, MT389–397 and MT236–244 share no conserved amino acids.



View larger version (26K):
[in this window]
[in a new window]
  		FIGURE 1. Cross-recognition of MT236–244 by MT389–397-specific CTL clones. A, Anti-polyoma virus CTL clones 8-1 and 24-5 were assayed for cytolytic activity against 51Cr-labeled AG104A (H-2k) cells for 4 h at an E:T cell ratio of 5:1 in the presence of the indicated concentration of peptide. The gag88–96 is a Dk-restricted epitope for CTL recognizing an endogenous retrovirus (35), and the other four peptides correspond to MT sequences satisfying a predicted Dk peptide binding motif (25). B, 51Cr-labeled AG104A cells pulsed with MT389–397 or MT236–244 at the indicated peptide concentrations were assayed for lysis by CTL clones 8-1 and 24-5 at an E:T cell ratio of 3:1 in a 4-h 51Cr release assay.

 


View larger version (21K):
[in this window]
[in a new window]
  		FIGURE 2. Peptide binding to H-2Dk. Purified Dk was incubated with 1 µM biotinylated MT102–109 peptide in the presence or the absence of unlabeled competitor peptides over the indicated concentration ranges. Dk-biotin-peptide complexes were captured on assay plates coated with an anti-H-2k mAb and incubated with europium-labeled streptavidin, and bound biotinylated MT102–109 was measured using time-resolved fluorometry. Binding in the absence of competitor is indicated by a dashed line.

 
Because MT389–397 is able to sensitize target cells for anti-polyoma CTL recognition at significantly lower concentrations than MT236–244, we asked whether these peptides bound the Dk molecule with different affinities. A fluoroimmunoassay using europium-streptavidin and time-resolved fluorometry was developed to measure binding of biotinylated peptides to purified Dk molecules (31). We determined that the synthetic peptide MT102–109, biotinylated at its natural cysteine at P4, specifically bound to Dk. Purified Dk molecules were incubated with biotinylated MT102–109, and the concentration-dependent competition of unlabeled peptides with MT102–109 for binding to Dk was determined. As shown in Fig. 2Go, the immunodominant anti-polyoma CTL peptide, MT389–397, had an approximately 10-fold higher affinity for Dk than gag88–96, a Dk-restricted epitope for CTL recognizing an endogenous retrovirus (35). Flu NP50–57, a Kk-restricted epitope (36), did not compete with MT102–109 for binding to Dk. T6–14 also bound Dk, but at roughly 1 log lower affinity than gag88–96. Notably, the cross-reactive MT236–244 peptide bound to Dk with an affinity 2–3 logs lower than that of MT389–397. This affinity difference parallels the difference in minimum concentrations of MT389–397 and MT236–244 needed to sensitize target cells for lysis by MT389–397-specific CTL clones (Fig. 1GoB) (25). Because MT389–397 and MT236–244 peptides are of equal size and have identical residues at the three putative primary anchors, secondary anchor residues must play an important role in determining binding to Dk, as demonstrated for peptide binding to HLA-A2.1 (37).

MT236–244 primes MT389–397-reactive CTL

Since MT236–244 is recognized in vitro by anti-polyoma CTL clones specific for the immunodominant MT389–397 epitope, we wanted to determine whether MT236–244 plays a functional role in shaping the anti-polyoma immune response in vivo. As a first step to determine whether the MT236–244 epitope was immunogenic for MT389–397-specific CTL, we attempted to prime for CTL reactive to MT389–397 by immunization with the MT236–244 peptide. Because peptide immunogenicity for class I MHC-restricted T cell responses can be augmented by coinjection with a class II MHC-restricted T helper epitope (38, 39, 40), the MT236–244 and MT389–397 synthetic peptides were each emulsified in IFA with the I-Ak-restricted T helper epitope HEL48–62 and injected s.c. into C3H/HeN mice. T cell lines were independently established from the draining lymph nodes of six mice by in vitro restimulation with wild-type virus-infected syngeneic stimulators. As shown in Fig. 3Go, priming with either MT236–244 or MT389–397 peptide elicited polyoma virus-specific CTL that recognized target cells pulsed with either peptide, but not the gag88–96 peptide. No lysis of infected or peptide-pulsed targets was seen by draining lymph node cells from mice injected s.c. with IFA and restimulated in vitro with virus-infected stimulators (data not shown).



View larger version (50K):
[in this window]
[in a new window]
  		FIGURE 3. Immunization with either MT389–397 or MT236–244 peptides elicits polyoma virus-specific CTL that recognize both peptides. T cell lines established from mice coimmunized with IFA-emulsified MT389–397 and the I Ak T helper epitope HEL48–62 or IFA-emulsified MT236–244 and HEL48–62 were tested for cytolytic activity against uninfected, virally infected, or peptide-pulsed AG104A target cells at an E:T cell ratio of 10:1 in a 4-h 51Cr release assay.

 
To determine whether the MT236–244 epitope presented during polyoma virus infection induced MT389–397-reactive CTL, we immunized mice with the mutant polyoma virus PTA1387T, which encodes a stop codon at residue 384 of the MT protein (30) and, consequently, lacks the MT389–397 epitope. As shown in Fig. 4GoA, a T cell line established from PTA1387T virus-immune mice by in vitro selection with wild-type virus-infected syngeneic stimulators efficiently lysed not only wild-type virus-infected targets, but, notably, recognized target cells coated with either MT389–397 or MT236–244. In vitro selection of the same PTA1387T-immune T cells with PTA1387T virus-infected stimulators generated a T cell line that recognized wild-type virus-infected targets, but not target cells coated by MT389–397 or MT236–244 peptides. To directly demonstrate that the MT236–244 epitope is presented in polyoma-infected mice and is responsible for priming MT389–397-reactive CTL, we replaced histidine for arginine at residue 237 of the MT protein of PTA1387T virus, with the intention of disrupting a primary Dk anchor in MT236–244. A T cell line established from a mouse immunized with this mutant virus, designated PTA1387T.237RH, by in vitro restimulation with wild-type virus-infected syngeneic spleen cells specifically lysed wild-type virus-infected target cells, but did not recognize target cells coated with either MT389–397 or MT236–244 peptide; a T cell line generated under the same in vitro selection conditions, but from a mouse inoculated with the parental PTA1387T virus, recognized both peptides (Fig. 4GoB). Taken together, these findings indicate that the MT236–244 epitope is presented in vivo during the course of polyoma virus infection, and that it primes but is unable to drive expansion of MT389–397 CTL.



View larger version (18K):
[in this window]
[in a new window]
  		FIGURE 4. Specificities of polyoma-specific CTL elicited by infection with mutant polyoma viruses. A, T cell lines derived from pooled draining lymph nodes from three PTA1387T virus-immune mice by in vitro restimulation with wild-type virus- or PTA1387T virus-infected stimulator cells were assayed for cytolytic activity against uninfected, wild-type virus-infected, or peptide-pulsed 51Cr-labeled AG104A target cells for 4 h at the indicated E:T cell ratios. B, T cell lines isolated from draining lymph nodes from mice inoculated with PTA1387T or PTA1387T. MT237RH viruses by in vitro restimulation with wild-type virus-infected stimulator cells were tested for cytolytic activity as described in A.

 
MT389–397-specific CTL possess heterogeneous CDR3ß regions and fine specificity

Because of the strong preferential expression of the Vß6 gene segment by polyoma-specific CTL that cross-react with MT389–397 and MT236–244 (24, 25), we asked whether their CDR3ß domains possessed shared structural features. cDNA was prepared from 11 Vß6+ MT389–397-specific CTL clones isolated from 10 different H-2k, Mtv7-negative mice infected by wild-type polyoma virus. Clones 6-6, 8-1, 9-12, 10-11, and 11-1 were derived by independent limiting dilution analyses from five C57BR/cdJ mice, and the other clones were isolated by limiting dilution analyses from five individual C3H/HeSnJ mice (25) (data not shown). Of these MT389–397-specific CTL clones, only 14-1 lacks cross-reactivity for MT236–244 (25). As shown in Table IGo, the CDR3ß regions of the MT389–397-specific CTL clones are heterogeneous in both length and sequence. CDR3ß lengths range from six to nine amino acids and eight of 12 possible Jß segments are used. Within this diversity, four clones (6-6, 9-12, 10-11, and 16-3) share the CDR3ß sequence glutamine-glycine-alanine, situated at position 96 for CDR3ß regions seven amino acids in length (clones 6-6 and 16-3) and at position 98 for nine-amino acid-long CDR3ßs (clones 9-12 and 10-11). The nongermline-encoded glycine at position 97 is frequently found among class I MHC-restricted TCRs of different specificities and presumably confers flexibility to the CDR3ß loop (41, 42). Of these 11 Vß6+ CTL clones, 9-12 and 10-11 exhibit CDR3ß regions with the highest sequence similarity, differing in only two of nine amino acids. It is interesting to note that 14-1, the only MT389–397-specific CTL clone isolated to date that fails to recognize MT236–244, has the shortest CDR3ß length of the 11 Vß6+ clones sequenced.


View this table:
[in this window]
[in a new window]
  		Table I. CDR3ß sequences of Vß6+ MT389–397-specific CTL clones1

 
In view of their diverse CDR3ßs, we investigated the fine specificities of each of the MT389–397-specific CTL clones listed in Table IGo. Clonotypic differences in TCR interactions with Dk/MT389–397 complexes were suggested by our previous finding that each CTL clone exhibited distinct patterns of reactivity to truncated versions of the MT389–397 epitope (25). A TCR functional fingerprint for each clone was revealed by its capacity to differentially recognize target cells presenting each of a panel of MT389–397 peptides bearing consecutive single alanine substitutions. For any given alanine-substituted MT389–397 peptide analogue, at least one of the CTL clones was capable of recognizing it (Fig. 5Go and data not shown), indicating that each substituted peptide bound Dk. As determined by the Dk europium fluoroimmunoassay, each of the nine alanine-substituted peptides bound Dk with an affinity similar to that of MT389–397 (data not shown). With three primary anchor residues in the predicted motif for peptides binding to Dk, alanine substitution of a single primary anchor residue is apparently insufficient to affect peptide binding.



View larger version (30K):
[in this window]
[in a new window]
  		FIGURE 5. Recognition of alanine-substituted MT389–397 peptides by MT389–397-specific CTL clones. 51Cr-labeled L929 (H-2k) target cells pulsed with each of a panel of alanine-monosubstituted analogues of MT389–397 were assayed for lysis by MT389–397-reactive CTL clones at an E:T cell ratio of 5:1 in a 4-h 51Cr release assay.

 
Fig. 5Go shows a representative example of this alanine scan analysis for four MT389–397-specific CTL clones: 8-1, 14-1, and 9-12, which possess dissimilar CDR3ßs, and 10-11, whose CDR3ß domain shows high homology to that of 9-12. Clones 8-1, 14-1, and 9-12 exhibit distinct fine specificity patterns, consistent with their diverse CDR3ß domains (Table IGo). The specificity patterns for 9-12 and 10-11, on the other hand, are virtually identical.

A single TCR recognizes MT389–397 and MT236–244 epitopes

To investigate whether a single TCR or dual TCRs expressed by MT389–397-specific CTL mediate cross-recognition of MT236–244, we examined the capacity of unlabeled syngeneic target cells pulsed with MT236–244, MT389–397, or Flu NP50–57 to inhibit recognition of 51Cr-labeled, MT389–397-pulsed target cells by CTL clones 8-1 and 24-5. As shown in Fig. 6Go, cold targets pulsed with MT389–397 or MT236–244, but not those pulsed with the Kk-binding Flu NP50–57 peptide, inhibited MT389–397-specific lysis by 8-1 and 24-5. This result argues that a single TCR recognizes both MT389–397 and MT236–244 epitopes.



View larger version (12K):
[in this window]
[in a new window]
  		FIGURE 6. Cold target inhibition of MT389–397-reactive CTL mediated cell lysis. CTL clone 8-1 or 24-5 cells were added at an E:T cell ratio of 5:1 to 51Cr-labeled L929 cells pulsed with MT389 at a concentration of 0.1 µM in the absence or the presence of unlabeled L929 cells pulsed with the MT389–397, MT236–244, or the Kk-restricted Flu NP50–57 peptide at 100 µM each. Each value for the percent inhibition of lysis of hot target cells by 8-1 or 24-5 in the presence of the indicated ratio of cold targets is the mean of quadruplicate samples. Specific lysis by 8-1 and 24-5 in the absence of cold targets was 30.9 and 25.5%, respectively.

 
To directly visualize single TCR engagement of MT389–397 and MT236–244 epitopes and estimate the frequency of such cross-reactive T cells in vivo, we asked whether the MT236–244 peptide could induce TCR down-modulation of MT389–397-specific CD8+ T cells from mice acutely infected by polyoma virus. Down-regulated TCR cell surface expression by MHC/peptide complexes is associated with T cell activation and has been used as a measure of TCR occupancy (43, 44). We developed Dk tetramers containing the MT389–397 peptide to quantitate MT389–397-specific CD8+ T cells during polyoma virus infection. These Dk/MT389 tetramers specifically stain MT389–397-specific CTL clones and CD8+ T cells from polyoma virus-infected, but not uninfected, H-2k mice; Dk/gag88–96 tetramers do not stain spleen cells of polyoma-infected H-2k mice (A. E. Lukacher et al., manuscript in preparation). Here, we used Dk/MT389 tetramers to visualize changes in the surface expression levels of Dk/MT389–397-specific TCRs of CD8+ T cells stimulated by MT389–397 and MT236–244 peptides. Seven days after s.c. inoculation with wild-type polyoma virus, the peak of the MT389–397-specific CTL response (A. E. Lukacher et al., manuscript in preparation), freshly explanted spleen cells were cultured for 7 h in the presence of graded concentrations of MT389–397, MT236–344, or gag88–96 peptides. Cells were then surface stained with the Dk/MT389 tetramer and anti-CD8 Ab, and stained for intracellular IFN-{gamma}. As shown in Fig. 7Go, in the absence of peptide or the presence of gag88–96 peptide, approximately 17% of the CD8+ T cells bound the Dk/MT389 tetramer. The MT389–397 peptide induced a dose-dependent reduction of tetramer staining, with TCR down-modulation being just detectable at 10-8 M and maximal by 10-6 M. This titration curve for MT389–397 peptide-triggered down-modulation of tetramer staining coincides with the MT389–397 peptide doses that stimulated IFN-{gamma} production by the CD8+ T cells. In a parallel fashion, MT236–244 also induced Dk/MT389 tetramer down-modulation of CD8+ T cells and IFN-{gamma} production, but at 2–3 logs higher peptide concentrations than MT389–397. At the maximum TCR down-modulation induced by MT389–397 and MT236–244, the mean fluorescence intensity for Dk/MT389 tetramer staining of the CD8+ T cells decreased approximately sevenfold from that of CD8+ T cells incubated in the absence of peptide. This difference in peptide doses between MT389–397 and MT236–244 for triggering TCR down-modulation and IFN-{gamma} production by CD8+ T cells taken directly ex vivo matched that required to sensitize target cells for lysis by MT389–397-specific CTL clones (25) (Fig. 1GoA). The finding that the MT236–244 peptide triggered TCR down-regulation by virtually all the MT389–397-specific CD8+ T cells in the spleens of acutely infected mice strongly argues that a single TCR recognizes both MT epitopes and accounts for the low frequency of MT389–397-specific CTL clones that do not cross-react with MT236–244.



View larger version (28K):
[in this window]
[in a new window]
  		FIGURE 7. Effect of MT236–244 peptide stimulation on TCR expression by MT389–397-specific CD8+ T cells. Spleen cells from a C3H/HeN mouse on day 7 postinfection with wild-type virus were cultured for 7 h in the presence of the indicated concentrations of MT389–397, MT236–244, or gag88–96 peptides; surface stained with phycoerythrin-conjugated anti-CD8{alpha} and allophycocyanin-conjugated Dk/MT389 tetramers; then permeabilized and stained with FITC-conjugated anti-IFN-{gamma}. FACS events are gated on CD8+ T cells. In each panel, the value above the left gate indicates the percentage of IFN-{gamma}-negative, Dk/MT389 tetramer+ CD8+ T cells, and the value above the right gate indicates the percentage of IFN-{gamma}-positive CD8+ T cells.

 

   Discussion
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
References
 
In this report, we show that polyoma virus-specific CD8+ CTL directed to the immunodominant epitope in the MT viral oncoprotein cross-react with another, nonoverlapping MT-derived epitope presented by the same class I MHC molecule. Immunization with either the dominant MT389–397 peptide or the cross-reactive MT236–244 peptide or infection with a mutant polyoma virus lacking the MT389–397 epitope elicits polyoma virus-specific CTL that recognize both epitopes. Using soluble class I MHC tetramers containing the MT389–397 peptide, we directly visualized MT236–244 peptide-induced TCR down-modulation of virtually all Dk/MT389 tetramer+ CD8+ T cells from spleens of polyoma-infected mice. Moreover, we show that cross-reactivity for these two MT epitopes is mediated by TCRs with highly heterogeneous CDR3ß regions. Thus, individual, diverse TCRs are responsible for class I MHC epitope intramolecular mimicry by these immunodominant anti-polyoma CTL.

Degeneracy in epitope recognition by mature class I MHC- and class II MHC-restricted T cells has been described in a variety of systems and points to the flexibility in TCR interaction with its MHC/peptide ligand. While such reduced stringency in TCR recognition is well documented for positive selection of thymocytes by self MHC/peptide complexes and by T cell recognition of peptides bound to allogeneic and xenogenic MHC molecules, it is also evident in the ability of peptides bearing single or multiple substitutions at TCR contact residues to activate their cognate T cells. Evavold et al. (7) have shown that conservation of as few as a single TCR contact residue in a class II MHC-bound peptide may be sufficient for T cell activation. The MT389–397 and MT236–244 epitopes share no sequence homology other than identity at the three putative Dk anchor residues at positions 2, 5, and 9. Similar to the results described by Hagerty and Allen (23) using T cells cross-reactive for two human {alpha}1-antitrypsin peptides complexed to I-Ak, increasing sequence identity between MT389–397 and MT236–244 by single substitutions of amino acids in MT236–244 with the corresponding residues in MT389–397 completely ablated CTL recognition of the MT236–244 epitope (data not shown). This finding lends further support to the concept that structural mimicry between intramolecular epitopes with minimal sequence homology is responsible for TCR cross-recognition (23).

Several lines of evidence indicate that the MT236–244 epitope primes but fails to trigger expansion of polyoma virus-specific CTL that cross-react with MT389–397. MT389–397-specific CTL are recovered from mice infected with the PTA1387T polyoma virus mutant, whose MT terminates at amino acid 384, after restimulation in vitro with polyoma virus-infected spleen cells. In contrast, in vitro restimulation of PTA1387T virus-immune T cells with PTA1387T virus-infected stimulators elicits only non-MT389–397/MT236–244-reactive, polyoma virus-specific CTL. The inability of PTA1387T virus infection to expand MT389–397-reactive CTL in vivo was directly visualized by the absence of Dk/MT389 tetramer staining of CD8+ T cells in the spleens of mice acutely infected with the PTA1387T virus; this result was recently confirmed using a wild-type A2 strain polyoma virus bearing mutations in the MT389–397 sequence that abrogated MT389–397-specific CTL recognition (C. S. Wilson et al., manuscript in preparation). Recent studies indicate that the density of cell surface MHC/peptide complexes correlates with the magnitude of the CTL response to that epitope (45, 46). Different threshold levels of MHC/peptide complexes, which result in different levels of TCR occupancy, have been shown to elicit different responses from class I MHC-restricted CTL clones and lines, with sensitization for target cell lysis requiring lower peptide concentrations than proliferation (47, 48). Although we have not determined off-rates for the MT389–397 and MT236–244 peptides from Dk molecules, peptide competition studies indicate roughly 1000-fold higher affinity of Dk for MT389–397 than MT236–244 (Fig. 2Go). It is interesting to note that in the only other report of intramolecular mimicry, involving two I-Ak-restricted epitopes in the human {alpha}1-antitrypsin protein, a 3-log higher concentration of the cross-reactive epitope than the dominant epitope was also required to achieve equivalent levels of T cell stimulation (23). While the differences in binding affinity clearly fit the concentration differences between MT389–397 and MT236–244 in sensitizing target cells for CTL lysis (Fig. 1Go) and inducing TCR down-modulation (Fig. 7Go), the relative efficiencies for intracellular processing of these two epitopes from MT and their respective availability for binding to newly synthesized Dk molecules in the endoplasmic reticulum may also vary, as described for CTL epitopes generated from the same Listeria monocytogenes protein (49). We propose that MHC/peptide levels below the threshold for triggering proliferation in vivo may be sufficient to drive naive CTL precursors to memory CTL that are capable of expansion when exposed to a strong agonist MHC/peptide ligand. The phenomenon of MT236–244 and MT389–397 intramolecular mimicry presented here extends this concept in that a weak agonist ligand (i.e., Dk/MT236–244) triggers antiviral CTL precursors to memory CTL whose differentiation to effector CTL depends on engagement of a strong agonist ligand (i.e., Dk/MT389–397) derived from the same viral protein.

A number of studies describe shifts in CTL epitope hierarchies following infection with dominant epitope-loss viruses and point toward a general strategy for uncovering subdominant epitopes recognized by antiviral CTL (50, 51). Immunization and in vitro restimulation with the MT389–397 epitope-loss mutant polyoma virus PTA1387T select polyoma virus-specific CTL recognizing a class I MHC-restricted subdominant epitope(s). CTL clones recognizing viral epitopes other than the immunodominant MT389–397 epitope are infrequently isolated from H-2k mice infected by wild-type polyoma virus (25). CTL directed to subdominant viral epitopes may be primed early in the course of an antiviral CTL response, but fail to expand because the dominant epitope-specific CTL response emerges rapidly and clears the source of Ag, i.e., virus-infected cells (38, 50). Studies are in progress to define these subdominant polyoma epitopes.

The unique fine specificity patterns among the MT389–397-specific CTL clones reveals that different modifications in this immunodominant epitope are tolerated by TCRs bearing heterogeneous CDR3ß regions. Analogous to the structural and functional TCR diversity among these anti-polyoma CTL, murine CTL responses to dominant class I MHC-restricted vesicular stomatitis virus and Sendai virus epitopes are characterized by diverse TCRs with distinct fine specificities (52, 53). Such diversity in TCR recognition among monospecific antiviral CTL clones within an individual would be advantageous in impeding selection of immunodominant CTL epitope-loss mutant viruses. Although several solvent-exposed side chains in the MHC-bound peptide may form TCR contacts, a single peptide residue often dominates TCR engagement (7). For the MT389–397 epitope, alanine substitution of the threonine at position 6 in MT389–397 is the only substitution that uniformly impairs recognition by all the MT389–397-specific CTL clones examined (Fig. 5Go and data not shown). Because this substitution does not affect peptide binding to Dk (data not shown), threonine 394 is likely to be a major TCR contact residue in the MT389–397 epitope.

TCR structure-function studies confirm the critical contribution of the V{alpha} and Vß CDR3 junctional domains to peptide specificity (54, 55). In some instances the CDR3ß has been implicated in playing a primary role in peptide recognition by TCRs (5, 56), whereas in others it has been found to have negligible direct contact with peptides complexed to class I MHC molecules (6). In the latter case, the unusual stretch of four glycines in the 2C ß-chain CDR3 region may mitigate its capacity to interact with its antigenic peptide. For the CDR3ß domains of the MT389–397-specific CTL, except for the single glycine at position 97, a common feature of class I MHC-restricted TCRs (41), there are no glycine runs. In addition, the incorporation of a D gene segment in the ß-chain, but not the {alpha}-chain, CDR3 affords greater potential for diversity in the ß-chain CDR3 and a larger contribution of the CDR3ß to peptide specificity. The lack of MT236–244 cross-reactivity by MT389–397-specific CTL clone 14-1 may reflect limitations in plasticity of TCR recognition imposed by its short CDR3ß domain. In addition, the identical recognition profile for alanine-monosubstituted MT389–397 peptides by CTL clones 9-12 and 10-11, whose CDR3ß regions are of identical lengths and differ in only two residues points toward a dominant role for the Vß-chain in MT389–397 peptide recognition by anti-polyoma CTL.

The capacity of immunodominant antiviral CTL to cross-react with another epitope from the same virus could conceivably confer strong protection against CTL escape variant viruses. Viruses mutated in immunodominant CTL epitopes have been identified in situations where the anti-viral CTL response is functionally monospecific (57, 58, 59). The pronounced immunodominance of polyoma virus-specific CTL directed to the middle T protein epitope MT389–397 would likewise favor selection for viruses mutated in this epitope. Because the MT389–397 sequence is situated at the cytoplasmic-plasma membrane interface, the virus can tolerate certain amino acid substitutions in this region without deficits in transformation-competence or infectivity, but which abrogate recognition by MT389–397-specific CTL (60) (C. S. Wilson and A. E. Lukacher, unpublished observations). Because constitutive expression of fully functional MT is required to maintain cellular transformation, induce tumors, and permit efficient virion assembly, CTL epitope intramolecular mimicry within MT would be expected to prevent emergence of not only immune-escape viruses but immune-escape tumors as well.


   Acknowledgments
 
We thank Joseph Miller, Joseph Moore, and Annette Hadley for expert technical assistance, and Drs. Melissa Brown, Brian Evavold, and Judith Kapp for critically reviewing this manuscript.


   Footnotes
 
1 This work was supported by National Institutes of Health Grants CA71971 (to A.E.L.), AI42373 (to J.D.A.), and AI33614 (to P.E.J.). Back

2 Address correspondence and reprint requests to Dr. Aron Lukacher, Department of Pathology, Woodruff Memorial Research Building, Room 7301, Emory University School of Medicine, 1639 Pierce Dr., Atlanta, GA 30322. E-mail address: Back

3 Abbreviations used in this paper: CDR, complementarity-determining region; MT, middle T protein; Mtv, mouse mammary tumor provirus. Back

Received for publication December 11, 1998. Accepted for publication January 6, 1999.


   References
Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

  1. Townsend, A. R., J. Rothbard, F. M. Gotch, G. Bahadur, D. Wraith, A. J. McMichael. 1986. The epitopes of influenza nucleoprotein recognized by cytotoxic T lymphocytes can be defined with short synthetic peptides. Cell 44:959.[Medline]
  2. Rotzschke, O., K. Falk, K. Deres, H. Schild, M. Norda, J. Metzger, G. Jung, H. G. Rammensee. 1990. Isolation and analysis of naturally processed viral peptides as recognized by cytotoxic T cells. Nature 348:252.[Medline]
  3. Marrack, P., J. Kappler. 1987. The T cell receptor. Science 238:1073.[Abstract/Free Full Text]
  4. Davis, M. M., P. J. Bjorkman. 1988. T-cell antigen receptor genes and T-cell recognition. Nature 334:395.[Medline]
  5. Garboczi, D. N., P. Ghosh, U. Utz, Q. R. Fan, W. E. Biddison, D. C. Wiley. 1996. Structure of the complex between human T-cell receptor, viral peptide and HLA-A2. Nature 384:134.[Medline]
  6. Garcia, K. C., M. Degano, R. L. Stanfield, A. Brunmark, M. R. Jackson, P. A. Peterson, L. Teyton, I. A. Wilson. 1996. An {alpha}ß T cell receptor structure at 2.5 Å and its orientation in the TCR-MHC complex. Science 274:209.[Abstract/Free Full Text]
  7. Evavold, B. D., J. Sloan-Lancaster, K. J. Wilson, J. B. Rothbard, P. M. Allen. 1995. Specific T cell recognition of minimally homologous peptides: evidence for multiple endogenous ligands. Immunity 2:655.[Medline]
  8. Shirai, M., M. S. Vacchio, R. J. Hodes, J. A. Berzofsky. 1993. Preferential Vß usage by cytotoxic T cells cross-reactive between two epitopes of HIV-1 gp160 and degenerate in class I MHC restriction. J. Immunol. 151:2283.[Abstract]
  9. Brock, R., K. H. Wiesmuller, G. Jung, P. Walden. 1996. Molecular basis for the recognition of two structurally different major histocompatibility complex/peptide complexes by a single T-cell receptor. Proc. Natl. Acad. Sci. USA 93:13108.[Abstract/Free Full Text]
  10. Burrows, S. R., S. L. Silins, R. Khanna, J. M. Burrows, M. Rischmueller, J. McCluskey, D. J. Moss. 1997. Cross-reactive memory T cells for Epstein-Barr virus augment the alloresponse to common human leukocyte antigens: degenerate recognition of major histocompatibility complex-bound peptide by T cells and its role in alloreactivity. Eur. J. Immunol. 27:1726.[Medline]
  11. Loftus, D. J., Y. Chen, D. G. Covell, V. H. Engelhard, E. Appella. 1997. Differential contact of disparate class I/peptide complexes as the basis for epitope cross-recognition by a single T cell receptor. J. Immunol. 158:3651.[Abstract]
  12. Tallquist, M. D., T. J. Yun, L. R. Pease. 1996. A single T cell receptor recognizes structurally distinct MHC/peptide complexes with high specificity. J. Exp. Med. 184:1017.[Abstract/Free Full Text]
  13. Jameson, S. C., M. J. Bevan. 1998. T-cell selection. Curr. Opin. Immunol. 10:214.[Medline]
  14. Jr Janeway, C. A.. 1998. A tale of two T cells. Immunity 8:391.[Medline]
  15. Ignatowicz, L., J. Kappler, P. Marrack. 1996. The repertoire of T cells shaped by a single MHC/peptide ligand. Cell 84:521.[Medline]
  16. Surh, C. D., D. S. Lee, W. P. Fung-Leung, L. Karlsson, J. Sprent. 1997. Thymic selection by a single MHC/peptide ligand produces a semidiverse repertoire of CD4+ T cells. Immunity 7:209.[Medline]
  17. Hu, Q., C. R. Bazemore Walker, C. Girao, J. T. Opferman, J. Sun, J. Shabanowitz, D. F. Hunt, P. G. Ashton-Rickardt. 1997. Specific recognition of thymic self-peptides induces the positive selection of cytotoxic T lymphocytes. Immunity 7:221.[Medline]
  18. Grubin, C. E., S. Kovats, P. deRoos, A. Y. Rudensky. 1997. Deficient positive selection of CD4 T cells in mice displaying altered repertoires of MHC class II-bound self-peptides. Immunity 7:197.[Medline]
  19. Oldstone, M. B.. 1987. Molecular mimicry and autoimmune disease. Cell 50:819.[Medline]
  20. Davies, J. M.. 1997. Molecular mimicry: can epitope mimicry induce autoimmune disease?. Immunol. Cell. Biol. 75:113.[Medline]
  21. Wucherpfennig, K. W., J. L. Strominger. 1995. Molecular mimicry in T cell-mediated autoimmunity: viral peptides activate human T cell clones specific for myelin basic protein. Cell 80:695.[Medline]
  22. Zhao, Z. S., F. Granucci, L. Yeh, P. A. Schaffer, H. Cantor. 1998. Molecular mimicry by herpes simplex virus-type 1: autoimmune disease after viral infection. Science 279:1344.[Abstract/Free Full Text]
  23. Hagerty, D. T., P. M. Allen. 1995. Intramolecular mimicry. Identification and analysis of two cross-reactive T cell epitopes within a single protein. J. Immunol. 155:2993.[Abstract]
  24. Lukacher, A. E., Y. Ma, J. P. Carroll, S. R. Abromson-Leeman, J. C. Laning, M. E. Dorf, T. L. Benjamin. 1995. Susceptibility to tumors induced by polyoma virus is conferred by an endogenous mouse mammary tumor virus superantigen. J. Exp. Med. 181:1683.[Abstract/Free Full Text]
  25. Lukacher, A. E., C. S. Wilson. 1998. Resistance to polyoma virus-induced tumors correlates with CTL recognition of an immunodominant H-2Dk-restricted epitope in the middle T protein. J. Immunol. 160:1724.[Abstract/Free Full Text]
  26. Brodsky, J. L., J. M. Pipas. 1998. Polyomavirus T antigens: molecular chaperones for multiprotein complexes. J. Virol. 72:5329.[Free Full Text]
  27. Raptis, L., H. Lamfrom, T. L. Benjamin. 1985. Regulation of cellular phenotype and expression of polyomavirus middle T antigen in rat fibroblasts. Mol. Cell. Biol. 5:2476.[Abstract/Free Full Text]
  28. Garcea, R. L., D. A. Talmage, A. Harmatz, R. Freund, T. L. Benjamin. 1989. Separation of host range from transformation functions of the hr-t gene of polyomavirus. Virology 168:312.[Medline]
  29. Freund, R., A. Sotnikov, R. T. Bronson, T. L. Benjamin. 1992. Polyoma virus middle T is essential for virus replication and persistence as well as for tumor induction in mice. Virology 191:716.[Medline]
  30. Carmichael, G. G., B. S. Schaffhausen, D. I. Dorsky, D. B. Oliver, T. L. Benjamin. 1982. Carboxy terminus of polyoma middle-sized tumor antigen is required for attachment to membranes, associated protein kinase activities, and cell transformation. Proc. Natl. Acad. Sci. USA 79:3579.[Abstract/Free Full Text]
  31. Jensen, P. E., J. C. Moore, A. E. Lukacher. 1998. A europium fluoroimmunoassay for measuring peptide binding to MHC class I molecules. J. Immunol. Methods 215:71.[Medline]
  32. Casanova, J. L., P. Romero, C. Widmann, P. Kourilsky, J. L. Maryanski. 1991. T cell receptor genes in a series of class I major histocompatibility complex-restricted cytotoxic T lymphocyte clones specific for a Plasmodium berghei nonapeptide: implications for T cell allelic exclusion and antigen-specific repertoire. J. Exp. Med. 174:1371.[Abstract/Free Full Text]
  33. Murali-Krishna, K., J. D. Altman, M. Suresh, D. J. Sourdive, A. J. Zajac, J. D. Miller, J. Slansky, R. Ahmed. 1998. Counting antigen-specific CD8 T cells: a reevaluation of bystander activation during viral infection. Immunity 8:177.[Medline]
  34. Altman, J. D., P. A. H. Moss, P. J. R. Goulder, D. H. Barouch, M. G. McHeyzer-Williams, J. I. Bell, A. J. McMichael, M. M. Davis. 1996. Phenotypic analysis of antigen-specific T lymphocytes. Science 274:94.[Abstract/Free Full Text]
  35. de Bergeyck, V., E. De Plaen, P. Chomez, T. Boon, A. Van Pel. 1994. An intracisternal A-particle sequence codes for an antigen recognized by syngeneic cytolytic T lymphocytes on a mouse spontaneous leukemia. Eur. J. Immunol. 24:2203.[Medline]
  36. Gould, K. G., H. Scotney, G. G. Brownlee. 1991. Characterization of two distinct major histocompatibility complex class I Kk-restricted T-cell epitopes within the influenza A/PR/8/34 virus hemagglutinin. J. Virol. 65:5401.[Abstract/Free Full Text]
  37. Ruppert, J., J. Sidney, E. Celis, R. T. Kubo, H. M. Grey, A. Sette. 1993. Prominent role of secondary anchor residues in peptide binding to HLA-A2.1 molecules. Cell 74:929.[Medline]
  38. van der Most, R. G., A. Sette, C. Oseroff, J. Alexander, K. Murali-Krishna, L. L. Lau, S. Southwood, J. Sidney, R. W. Chesnut, M. Matloubian, et al 1996. Analysis of cytotoxic T cell responses to dominant and subdominant epitopes during acute and chronic lymphocytic choriomeningitis virus infection. J. Immunol. 157:5543.[Abstract]
  39. Vitiello, A., L. Yuan, R. W. Chesnut, J. Sidney, S. Southwood, P. Farness, M. R. Jackson, P. A. Peterson, A. Sette. 1996. Immunodominance analysis of CTL responses to influenza PR8 virus reveals two new dominant and subdominant Kb-restricted epitopes. J. Immunol. 157:5555.[Abstract]
  40. Sauzet, J. P., H. Gras-Masse, J. G. Guillet, E. Gomard. 1996. Influence of strong CD4 epitope on long-term virus-specific cytotoxic T cell responses induced in vivo with peptides. Int. Immunol. 8:457.[Abstract/Free Full Text]
  41. Maryanski, J. L., C. V. Jongeneel, P. Bucher, J. L. Casanova, P. R. Walker. 1996. Single-cell PCR analysis of TCR repertoires selected by antigen in vivo: a high magnitude CD8 response is comprised of very few clones. Immunity 4:47.[Medline]
  42. Abergel, C., J. M. Claverie. 1991. A strong propensity toward loop formation characterizes the expressed reading frames of the D segments at the Ig H and T cell receptor loci. Eur. J. Immunol. 21:3021.[Medline]
  43. Valitutti, S., S. Muller, M. Cella, E. Padovan, A. Lanzavecchia. 1995. Serial triggering of many T-cell receptors by a few peptide-MHC complexes. Nature 375:148.[Medline]
  44. Viola, A., A. Lanzavecchia. 1996. T cell activation determined by T cell receptor number and tunable thresholds. Science 273:104.[Abstract]
  45. Gallimore, A., T. Dumrese, H. Hengartner, R. M. Zinkernagel, H. G. Rammensee. 1998. Protective immunity does not correlate with the hierarchy of virus-specific cytotoxic T cell responses to naturally processed peptides. J. Exp. Med. 187:1647.[Abstract/Free Full Text]
  46. Sijts, A. J., E. G. Pamer. 1997. Enhanced intracellular dissociation of major histocompatibility complex class I-associated peptides: a mechanism for optimizing the spectrum of cell surface-presented cytotoxic T lymphocyte epitopes. J. Exp. Med. 185:1403.[Abstract/Free Full Text]
  47. Gervois, N., Y. Guilloux, E. Diez, F. Jotereau. 1996. Suboptimal activation of melanoma infiltrating lymphocytes (TIL) due to low avidity of TCR/MHC-tumor peptide interactions. J. Exp. Med. 183:2403.[Abstract/Free Full Text]
  48. Valitutti, S., S. Muller, M. Dessing, A. Lanzavecchia. 1996. Different responses are elicited in cytotoxic T lymphocytes by different levels of T cell receptor occupancy. J. Exp. Med. 183:1917.[Abstract/Free Full Text]
  49. Sijts, A. J. A. M., A. Neisig, J. Neefjes, E. G. Pamer. 1996. Two Listeria monocytogenes CTL epitopes are processed from the same antigen with different efficiencies. J. Immunol. 156:685.
  50. Weidt, G., O. Utermohlen, J. Heukeshoven, F. Lehmann-Grube, W. Deppert. 1998. Relationship among immunodominance of single CD8+ T cell epitopes, virus load, and kinetics of primary antiviral CTL response. J. Immunol. 160:2923.[Abstract/Free Full Text]
  51. Oldstone, M. B., H. Lewicki, P. Borrow, D. Hudrisier, J. E. Gairin. 1995. Discriminated selection among viral peptides with the appropriate anchor residues: implications for the size of the cytotoxic T-lymphocyte repertoire and control of viral infection. J. Virol. 69:7423.[Abstract]
  52. Cole, G. A., T. L. Hogg, D. L. Woodland. 1994. The MHC class I-restricted T cell response to Sendai virus infection in C57BL/6 mice: a single immunodominant epitope elicits an extremely diverse repertoire of T cells. Int. Immunol. 6:1767.[Abstract/Free Full Text]
  53. Imarai, M., E. C. Goyarts, G. M. van Bleek, S. G. Nathenson. 1995. Diversity of T cell receptors specific for the VSV antigenic peptide (N52–59) bound by the H-2Kb class I molecule. Cell. Immunol. 160:33.[Medline]
  54. Engel, I., S. M. Hedrick. 1988. Site-directed mutations in the VDJ junctional region of a T cell receptor ß chain cause changes in antigenic peptide recognition. Cell 54:473.[Medline]
  55. Katayama, C. D., F. J. Eidelman, A. Duncan, F. Hooshmand, S. M. Hedrick. 1995. Predicted complementarity determining regions of the T cell antigen receptor determine antigen specificity. EMBO J. 14:927.[Medline]
  56. Turner, S. J., S. C. Jameson, F. R. Carbone. 1997. Functional mapping of the orientation for TCR recognition of an H2-Kb-restricted ovalbumin peptide suggests that the ß-chain subunit can dominate the determination of peptide side chain specificity. J. Immunol. 159:2312.[Abstract/Free Full Text]
  57. Phillips, R. E., S. Rowland-Jones, D. F. Nixon, F. M. Gotch, J. P. Edwards, A. O. Ogunlesi, J. G. Elvin, J. A. Rothbard, C. R. Bangham, C. R. Rizza, et al 1991. Human immunodeficiency virus genetic variation that can escape cytotoxic T cell recognition. Nature 354:453.[Medline]
  58. Bertoletti, A., A. Costanzo, F. V. Chisari, M. Levrero, M. Artini, A. Sette, A. Penna, T. Giuberti, F. Fiaccadori, C. Ferrari. 1994. Cytotoxic T lymphocyte response to a wild type hepatitis B virus epitope in patients chronically infected by variant viruses carrying substitutions within the epitope. J. Exp. Med. 180:933.[Abstract/Free Full Text]
  59. de Campos-Lima, P. O., V. Levitsky, J. Brooks, S. P. Lee, L. F. Hu, A. B. Rickinson, M. G. Masucci. 1994. T cell responses and virus evolution: loss of HLA A11-restricted CTL epitopes in Epstein-Barr virus isolates from highly A11-positive populations by selective mutation of anchor residues. J. Exp. Med. 179:1297.[Abstract/Free Full Text]
  60. Dahl, J., U. Thathamangalam, R. Freund, T. L. Benjamin. 1992. Functional asymmetry of the regions juxtaposed to the membrane-binding sequence of polyomavirus middle T antigen. Mol. Cell. Biol. 12:5050.[Abstract/Free Full Text]
  61. Chothia, C., D. R. Boswell, A. M. Lesk. 1988. The outline structure of the T-cell {alpha}ß receptor. EMBO J. 7:3745.[Medline]



This article has been cited by other articles:


Home page
 JEMHome page
P. A. Swanson II, C. D. Pack, A. Hadley, C.-R. Wang, I. Stroynowski, P. E. Jensen, and A. E. Lukacher
An MHC class Ib-restricted CD8 T cell response confers antiviral immunity
J. Exp. Med., July 7, 2008; 205(7): 1647 - 1657.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. M. Byers, N. P. Andrews, and A. E. Lukacher
CD94/NKG2A Expression Is Associated with Proliferative Potential of CD8 T Cells during Persistent Polyoma Virus Infection
J. Immunol., May 15, 2006; 176(10): 6121 - 6129.
[Abstract] [Full Text] [PDF]

Home page
 Cancer Res.Home page
S. Oh, M. Terabe, C. D. Pendleton, A. Bhattacharyya, T. K. Bera, M. Epel, Y. Reiter, J. Phillips, W. M. Linehan, C. Kasten-Sportes, et al.
Human CTLs to Wild-Type and Enhanced Epitopes of a Novel Prostate and Breast Tumor-Associated Protein, TARP, Lyse Human Breast Cancer Cells
Cancer Res., April 1, 2004; 64(7): 2610 - 2618.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. A. Brehm, T. G. Markees, K. A. Daniels, D. L. Greiner, A. A. Rossini, and R. M. Welsh
Direct Visualization of Cross-Reactive Effector and Memory Allo-Specific CD8 T Cells Generated in Response to Viral Infections
J. Immunol., April 15, 2003; 170(8): 4077 - 4086.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
V. Rubio-Godoy, V. Dutoit, Y. Zhao, R. Simon, P. Guillaume, R. Houghten, P. Romero, J.-C. Cerottini, C. Pinilla, and D. Valmori
Positional Scanning-Synthetic Peptide Library-Based Analysis of Self- and Pathogen-Derived Peptide Cross-Reactivity with Tumor-Reactive Melan-A-Specific CTL
J. Immunol., November 15, 2002; 169(10): 5696 - 5707.
[Abstract] [Full Text] [PDF]

Home page
 Biol Res NursHome page
C. M. Constantin, E. E. Bonney, J. D. Altman, and O. L. Strickland
Major Histocompatibility Complex (MHC) Tetramer Technology: An Evaluation
Biol Res Nurs, October 1, 2002; 4(2): 115 - 127.
[Abstract] [PDF]

Home page
 J. Gen. Virol.Home page
M. Lomas, E. Hanon, Y. Tanaka, C. R. M. Bangham, and K. G. Gould
Presentation of a new H-2Dk-restricted epitope in the Tax protein of human T-lymphotropic virus type I is enhanced by the proteasome inhibitor lactacystin
J. Gen. Virol., March 1, 2002; 83(3): 641 - 650.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
I. Messaoudi, J. LeMaoult, B. M. Metzner, M. J. Miley, D. H. Fremont, and J. Nikolich-Zugich
Functional Evidence That Conserved TCR CDR{{alpha}}3 Loop Docking Governs the Cross-Recognition of Closely Related Peptide:Class I Complexes
J. Immunol., July 15, 2001; 167(2): 836 - 843.
[Abstract] [Full Text] [PDF]

Home page
 J. Gen. Virol.Home page
S. Tourdot, S. Herath, and K. G. Gould
Characterization of a new H-2Dk-restricted epitope prominent in primary influenza A virus infection
J. Gen. Virol., July 1, 2001; 82(7): 1749 - 1755.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
M. Regner, M. Lobigs, R. V. Blanden, P. Milburn, and A. Mullbacher
Antiviral Cytotoxic T Cells Cross-Reactively Recognize Disparate Peptide Determinants from Related Viruses but Ignore More Similar Self- and Foreign Determinants
J. Immunol., March 15, 2001; 166(6): 3820 - 3828.
[Abstract] [Full Text] [PDF]

Home page
 JEMHome page
J. M. Moser, J. D. Altman, and A. E. Lukacher
Antiviral CD8+ T Cell Responses in Neonatal Mice: Susceptibility to Polyoma Virus-induced Tumors Is Associated with Lack of Cytotoxic Function by Viral Antigen-specific T Cells
J. Exp. Med., March 5, 2001; 193(5): 595 - 606.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
A. E. Lukacher, J. M. Moser, A. Hadley, and J. D. Altman
Visualization of Polyoma Virus-Specific CD8+ T Cells In Vivo During Infection and Tumor Rejection
J. Immunol., September 15, 1999; 163(6): 3369 - 3378.
[Abstract] [Full Text] [PDF]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow Request Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wilson, C. S.
Right arrow Articles by Lukacher, A. E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wilson, C. S.
Right arrow Articles by Lukacher, A. E.

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS